ID: 1138500838

View in Genome Browser
Species Human (GRCh38)
Location 16:57443048-57443070
Sequence CTGTTTTCCTTAATGACAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 277}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138500838 Original CRISPR CTGTTTTCCTTAATGACAGA GGG Intronic
900026756 1:280585-280607 CTGTTTCCACTCATGACAGAAGG - Intergenic
901483342 1:9540580-9540602 CTTTTTTCCTTTATCACAGCCGG + Intronic
901770590 1:11528603-11528625 CTGTTCTCCACAATGACAGTGGG - Intronic
903050249 1:20595180-20595202 CTTTTTCCCTAAATGGCAGACGG - Intronic
903462959 1:23531728-23531750 CTGTTCCCTTTAATGGCAGAGGG + Intergenic
905246636 1:36619479-36619501 CTGTTATCCTTAATAGCAGCAGG + Intergenic
908178716 1:61582412-61582434 CTGTTTACTTTAATGTCACATGG - Intergenic
908825752 1:68131370-68131392 GTGTTTTCCTAAATGCCAGTGGG - Intronic
909168444 1:72259575-72259597 CTTTTTTCTCTAATTACAGATGG - Intronic
909848970 1:80435428-80435450 CTGCTTTACTTAATGTCAGCTGG - Intergenic
909954756 1:81765787-81765809 CTTTTGTCCTTAATGAAATAAGG - Intronic
910121936 1:83799677-83799699 CTGGTTTCCTTAATGCATGAAGG + Intergenic
911025220 1:93428220-93428242 CTGTTTTCCTTTTTGAGACAGGG - Intergenic
914394009 1:147247506-147247528 CTGTTTCCACTAATGGCAGAAGG - Intronic
918353152 1:183678814-183678836 CTGGTTACCTGCATGACAGAAGG + Intronic
918405049 1:184203877-184203899 TTGTTTTCCATAATGTCAGTGGG - Intergenic
918794183 1:188871842-188871864 ATGATTTCCTTAATGACATCTGG - Intergenic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
921694657 1:218194376-218194398 ATTATTTCCTTAATGAAAGATGG - Intergenic
923083487 1:230682963-230682985 CTTTTTTCCCTGATGACAGCTGG - Intronic
1062854879 10:774994-775016 CTGTTATCTTTAAAGACACAGGG - Intergenic
1063594952 10:7426227-7426249 ATGTTTTCCTTAATGGCAAGGGG - Intergenic
1064602746 10:17009877-17009899 CTGTTTGTTTTAATGACAGTAGG - Intronic
1065836296 10:29661217-29661239 CTGGTTTGCTTAAAGACAAAGGG + Intronic
1065931346 10:30481878-30481900 ATGTCTTCCTGCATGACAGATGG - Intergenic
1067538496 10:47134976-47134998 CTTTTTTCCTGATTGGCAGATGG + Intergenic
1068081890 10:52329240-52329262 CTGATGTCCTTAATGTCACATGG + Intergenic
1068712693 10:60151509-60151531 ATGCTTTCATTCATGACAGAAGG - Intronic
1069562312 10:69439467-69439489 CTGCCCTCCTGAATGACAGATGG + Intergenic
1070461336 10:76673603-76673625 CTGCGTTCCTTATTAACAGAAGG - Intergenic
1070896917 10:79992103-79992125 CTGTACTCCTGAGTGACAGAGGG + Intergenic
1071587819 10:86842343-86842365 GTGTTTTCCATACTCACAGAAGG + Intronic
1072552183 10:96487424-96487446 CTGTATTCCTTTAGGACAAATGG + Intronic
1073799335 10:107024280-107024302 CTGCTTTCATTCATGGCAGAAGG + Intronic
1074326180 10:112453779-112453801 CTGTTTCCTTTAATTAAAGAAGG + Intronic
1075102633 10:119517105-119517127 GTGGTTTCCTTAAGGGCAGAAGG - Intronic
1076251607 10:128988529-128988551 CTGTTATCCTTCATGAAATATGG + Intergenic
1077364206 11:2155019-2155041 CTGTTTTCCAAAAACACAGATGG + Intronic
1078134346 11:8639956-8639978 CTGTCTTCCTGGATGACAGTAGG - Intronic
1080298808 11:30760695-30760717 CTGTTTTCCTCAAACACAGTTGG + Intergenic
1080706948 11:34704377-34704399 CTGTGCTCCTGAATGACTGATGG - Intergenic
1080960480 11:37152366-37152388 CTGCTTGCCCTAAAGACAGAGGG - Intergenic
1082767517 11:57181129-57181151 GTGCTTTCCTTGTTGACAGAGGG + Intergenic
1082931874 11:58616978-58617000 CTGTTTGCCTGAAAAACAGAGGG - Intronic
1084492407 11:69486055-69486077 ATGTCTTCCTGCATGACAGAAGG + Intergenic
1086201329 11:84205943-84205965 CTGATTTTTTTAAAGACAGATGG + Intronic
1086476097 11:87176320-87176342 CTGCTTCTCTTCATGACAGAAGG - Intronic
1087568483 11:99894023-99894045 CTGGTATCCTTAATGCCAGCTGG + Intronic
1087806008 11:102556328-102556350 TTGTTTTCCTGAATGAAAAATGG - Intergenic
1088987680 11:114924516-114924538 CTGTTTTCCTAAATGCCCCAAGG + Intergenic
1089229486 11:116959443-116959465 TTATTTACCTTAATAACAGAGGG + Intronic
1089791697 11:120949852-120949874 CAATTTTCCATACTGACAGATGG - Intronic
1090326750 11:125894032-125894054 CTGGTCTGCTTTATGACAGAGGG + Exonic
1091533859 12:1387136-1387158 CTGTTTCGCATATTGACAGATGG + Intronic
1093445510 12:19252515-19252537 CTGTCTTCTTGAATGAAAGAAGG - Intronic
1094448352 12:30558026-30558048 CTTTTTTTTTTAATAACAGAGGG - Intergenic
1096877861 12:54644552-54644574 GTGTTTTCCTTAAGAAGAGATGG - Intergenic
1098764217 12:74465918-74465940 CTGTTTTTATTTATGAAAGATGG - Intergenic
1099419857 12:82443684-82443706 CTGCTTTCATTCATGACAGAAGG + Intronic
1099673638 12:85728615-85728637 CTGTTTTCCTGTATGACTGAGGG + Intergenic
1100512313 12:95287643-95287665 CTGTTTTTCTTTATGACTCAGGG + Exonic
1100842206 12:98624050-98624072 CTGTTCTCTATAATGACACAAGG - Intronic
1101206972 12:102498336-102498358 CTGTTTTCCTTAAGTAGACAGGG - Intergenic
1103248011 12:119474834-119474856 TTTTTTTCCTTAAAGAGAGATGG - Intronic
1103266277 12:119633276-119633298 CTGTTTTCTTTAATAACAGAGGG - Intronic
1104449805 12:128859812-128859834 GTGATTTCCTTCATGATAGAGGG + Intronic
1104908362 12:132227724-132227746 TTGTCATCCTTAGTGACAGATGG + Intronic
1105533454 13:21241960-21241982 CTTTTTTCCTGAATAATAGAAGG - Intergenic
1106697857 13:32197343-32197365 CTGTCTTCCTTGTTGATAGATGG - Intronic
1106894828 13:34288791-34288813 CTGTGTCCCTAAATGACAGGAGG + Intergenic
1108874389 13:55026405-55026427 GTATTTTTCTTAATGACAGAAGG - Intergenic
1110051586 13:70908942-70908964 CTGACTTCATTTATGACAGACGG + Intergenic
1111954707 13:94743723-94743745 CTGTTTTGCTTTATTACAGAAGG - Intergenic
1113022882 13:105908408-105908430 GTGTTTCCCTTAATGACATCTGG + Intergenic
1113181074 13:107627335-107627357 CTGTTCTCTTTAATAACACAGGG - Intronic
1116543903 14:46137982-46138004 TTGCTTTCTTTAATGTCAGATGG - Intergenic
1116664395 14:47756621-47756643 CTTGTTTCCTTAACTACAGAAGG + Intergenic
1118815420 14:69309823-69309845 GTGTTTTCTTTTATGACATATGG + Intronic
1121832275 14:97062763-97062785 CTGTTGTCCTTATTCAGAGAAGG + Intergenic
1123794580 15:23758570-23758592 TTGTTTTCCTTTTTGACACATGG + Intergenic
1124138794 15:27059121-27059143 CTGCTTCCCTGAATGGCAGAGGG - Intronic
1124467668 15:29953117-29953139 CTGTCTTCTTTTATGAAAGAAGG - Intronic
1126311964 15:47327679-47327701 ATGTTTTCCTTAATGAGGAAAGG - Intronic
1126470137 15:49001249-49001271 CTGTTTTTGTAAATGACTGAAGG - Intronic
1128004618 15:64226953-64226975 CTGTCTTCCCTACTAACAGAAGG + Intronic
1129072105 15:72960237-72960259 CTGTTTTCCTTACTGGAGGAGGG + Intergenic
1129084387 15:73073293-73073315 CTGTTGACCTTACTGACAGCTGG + Intronic
1130046551 15:80450327-80450349 CTGTCTTCGTCAATAACAGAGGG + Intronic
1130547179 15:84865247-84865269 CAGTTCTGCTTAATGACAGTAGG - Intronic
1130698713 15:86157284-86157306 CTCTTTTCCTTTATTAGAGATGG - Intronic
1131005537 15:88974440-88974462 CTGTTTTCCTACAGGGCAGACGG - Intergenic
1131432621 15:92398932-92398954 CTGTCTTTCTAAATGACTGATGG - Intronic
1131501418 15:92970649-92970671 CTTTTTTCCTTAATGATACATGG + Intronic
1133792805 16:9022244-9022266 CTGTGTTGATAAATGACAGAGGG + Intergenic
1133883885 16:9807855-9807877 ATGTTTTCCTTCCTGTCAGATGG - Intronic
1135346028 16:21689264-21689286 CTGTTTTCCTTACTGTCATTTGG - Intronic
1135764845 16:25168616-25168638 TTTTTTTCCTTGAAGACAGATGG + Intronic
1138387385 16:56644892-56644914 CTGTTTTCTTAAATGAAATATGG + Intronic
1138500838 16:57443048-57443070 CTGTTTTCCTTAATGACAGAGGG + Intronic
1140612249 16:76614404-76614426 TTGTTTTCCTTTGTGACAAATGG + Intronic
1140957502 16:79879008-79879030 TTTTTTTCCTTAAAGAGAGAAGG - Intergenic
1145765101 17:27453588-27453610 CAGTTTTCCTTCCTCACAGATGG - Intergenic
1146974959 17:37103271-37103293 CTGTTCTCCTGAAAGAAAGAAGG + Intronic
1146982848 17:37182102-37182124 CTTCTTTCCTCAATGGCAGAAGG + Intronic
1147292595 17:39456018-39456040 ATGTTTTACATGATGACAGATGG - Intergenic
1147928979 17:43964823-43964845 CTGTTTTCCGTAATAACTGGTGG + Intronic
1149879763 17:60277520-60277542 CTTTATTCCCTATTGACAGAAGG + Intronic
1151261037 17:72916262-72916284 CTTTTTTCCCTCTTGACAGAAGG - Intronic
1155466208 18:26138517-26138539 TTGATTTGCTTAGTGACAGATGG + Intronic
1156437379 18:37147089-37147111 CTGTTTCCATTAATGGCAGAAGG - Intronic
1158914673 18:62111150-62111172 CTGTTTTCCACAAGGACACATGG - Intronic
1163569533 19:18072576-18072598 TTGTTTTCCTGAATGTCAGTGGG - Intronic
1166271362 19:41716311-41716333 CTTTTTTCCCAAATGAGAGAAGG + Intronic
1166678508 19:44753877-44753899 CTGTATTCCTTAATCTCCGAGGG + Intronic
1168367450 19:55800829-55800851 CTTTTTGCATTAATGACATATGG + Intronic
925849905 2:8069939-8069961 TTGTGTTCATTAATGACAAATGG - Intergenic
926866418 2:17363963-17363985 CTGTTTTCCATCTTCACAGAGGG - Intergenic
927995846 2:27485352-27485374 CTGTTTACCTTCATGTCAGCTGG + Exonic
928411690 2:31059234-31059256 GTTTTTTCATTAATGACAAATGG - Intronic
929190742 2:39137309-39137331 ATGTTTTCCATAATGGCAGAGGG - Intergenic
933544121 2:83688314-83688336 GTGTTTCGCTTAATGACAAATGG - Intergenic
935263251 2:101373022-101373044 CTGTTTTCCTAAATGTATGAGGG - Intronic
935976422 2:108583384-108583406 ATGTTTTCCTGAGTGACATAGGG + Intronic
938916855 2:135950572-135950594 CTGTTTTTAATAATAACAGAAGG + Intronic
939104812 2:137936876-137936898 CTCTTTTCCTTGCTCACAGATGG + Intergenic
939535632 2:143424287-143424309 CTGACCTCCTTAATGACAGATGG - Intronic
944041210 2:195357186-195357208 CTGTTTTCCTAGCTTACAGATGG - Intergenic
944319133 2:198316000-198316022 CTGGATTCCATAATAACAGATGG + Intronic
944552783 2:200860791-200860813 CTGGTTTGCTTAGTGAAAGAAGG + Intronic
944568272 2:201013955-201013977 CAGTTTTTCTTAATCACAGTGGG - Intronic
945395902 2:209317188-209317210 CTTTTCTCCTTAAAGTCAGAGGG - Intergenic
945664627 2:212725448-212725470 CTGTTTTCTCGAATGTCAGAAGG + Intergenic
945671355 2:212806138-212806160 CTTTTTTTCTTAGTGGCAGAAGG - Intergenic
946047503 2:216833432-216833454 CTGTTTCCCTACATCACAGAGGG - Intergenic
947195278 2:227558724-227558746 CTTTTTTCTTTCATGAAAGATGG - Intronic
948357433 2:237390713-237390735 TTGTTTTTCTTAATGAAAGGAGG - Intronic
948639380 2:239365165-239365187 CTGTTTTCCTTAGTGAAATGTGG + Intronic
1170222735 20:13958115-13958137 CTGTTTGACTTAAAGCCAGATGG - Intronic
1170884060 20:20322987-20323009 TTGTTTTCAATAATGTCAGATGG + Intronic
1171536883 20:25900372-25900394 CTGTCTTCCTGACTTACAGATGG + Intergenic
1171804222 20:29660781-29660803 CTGTCTTCCTGACTTACAGATGG - Intergenic
1171839829 20:30195642-30195664 CTGTCTTCCTGACTTACAGATGG + Intergenic
1172713757 20:36948169-36948191 CTGTATTCCATAATGAGAAAAGG + Intronic
1174570144 20:51495579-51495601 GGGTTTTCTTTGATGACAGAAGG + Intronic
1174819141 20:53712291-53712313 CTGTTTTGCTAAATGCCTGAAGG - Intergenic
1177407034 21:20683229-20683251 CTGTCTTCATTAATGACATTAGG + Intergenic
1177582813 21:23049650-23049672 CTGTTTCCATTCATGTCAGAGGG + Intergenic
951123114 3:18951535-18951557 TTGGGTTCCTTAACGACAGATGG - Intergenic
953358330 3:42273154-42273176 CTGCTTTCCTGCATGTCAGATGG - Intergenic
953562856 3:44007975-44007997 CTGTCTTCTTTAATGTCATAGGG - Intergenic
954970592 3:54648762-54648784 CTGTTTCCACTAATGGCAGAAGG + Intronic
956234888 3:67058699-67058721 CTGCTTTTCTTCATGGCAGAAGG + Intergenic
956853574 3:73254779-73254801 CTGTTTTTCTTAATTGCAGGGGG - Intergenic
957228264 3:77476729-77476751 CTGTTCTCCTTAATGAAAGGAGG + Intronic
957372145 3:79308876-79308898 TTGTTTTCCTTAATGAGGGTTGG - Intronic
958132373 3:89444776-89444798 CTGTTTCCCTCAATGATGGATGG + Intronic
960194648 3:114750166-114750188 CTCTTATCCTTTATGATAGAAGG - Intronic
963224759 3:142851022-142851044 CAGTTTTGCCCAATGACAGAAGG + Intronic
963497691 3:146088155-146088177 CTGTTTTGATTAATTACACAAGG - Intronic
964636528 3:158863649-158863671 ATGTTTTGATTAATGACAGACGG + Intergenic
964995737 3:162877986-162878008 CAGTCTTCCTTAATGTCAGGTGG - Intergenic
965610926 3:170543341-170543363 CTGTGCTTCTTAAAGACAGAGGG - Intronic
966381295 3:179347606-179347628 CCATTTTCCTTAAGGGCAGAAGG - Intergenic
969038213 4:4273213-4273235 CTTTTCTCCTTAAAGACAGTGGG + Intronic
970179012 4:13368647-13368669 CTGTTTTCTTTTATGACAGAGGG - Exonic
970577518 4:17442451-17442473 CTGTTTTTCTTTTTGACATAGGG - Intergenic
974878825 4:67729725-67729747 CTGTTTTCATGAATGATAAATGG + Intergenic
975177343 4:71303015-71303037 ATACTTTCCTTAATGGCAGATGG - Intronic
976612943 4:87048588-87048610 ATGTTTTACATAATGCCAGAAGG + Intronic
977169898 4:93749250-93749272 CTCATTTCCTTTATGACACAAGG + Intronic
977920638 4:102638800-102638822 ATGTTTTCATTAGTGCCAGATGG - Intronic
979785121 4:124707729-124707751 CTGCTTTTCTGATTGACAGAAGG - Intronic
981503616 4:145477489-145477511 CTGTCTTCCTTAATGAGGGCAGG + Intergenic
982959045 4:161812499-161812521 GTGTTTTTCTTAACTACAGATGG - Intronic
983014132 4:162588888-162588910 ATGTTTACCTTAATTAAAGATGG - Intergenic
983164815 4:164462149-164462171 CTGTATTCTTTAGTGAAAGAAGG + Intergenic
984133373 4:175905845-175905867 CTTTTTTTCTTAATGACGAAAGG - Intronic
984664876 4:182415637-182415659 CTGTTTTCATATATGACAGTGGG + Intronic
984860815 4:184236310-184236332 CTGATTTCCTTTGTGTCAGAAGG - Intergenic
984887818 4:184466355-184466377 GTGTTTTCCTAAAGAACAGATGG - Intronic
987815564 5:22896945-22896967 CTGTCATCCTTAATGAAATATGG - Intergenic
988196080 5:28007761-28007783 CTTTTTTCCCTAGTGACTGATGG - Intergenic
988656143 5:33213892-33213914 TTGTTTTCCTCGATGACATAAGG - Intergenic
989777783 5:45230112-45230134 TTGTTTCCCCTCATGACAGAAGG - Intergenic
990390043 5:55309523-55309545 TTGTTTTCCTTAATTAATGAAGG - Intronic
990586381 5:57215466-57215488 TTGTTTTCATTAATGCCTGAAGG + Intronic
991673547 5:69071191-69071213 TTTTTTTCCTGGATGACAGAGGG + Intergenic
992187606 5:74259356-74259378 CTGTTTTCCTTAAAGTCATCTGG + Intergenic
992508747 5:77413037-77413059 CTGTTTTCTTTGATGATAGTGGG - Intronic
993975258 5:94472298-94472320 TTCTCTTCCTTAATGGCAGAAGG + Intronic
996143340 5:119942165-119942187 CTCTTTTCTTTAAAGGCAGATGG + Intergenic
997321128 5:132979627-132979649 CTGTTTCCATTCATGACAGAAGG + Intergenic
999192332 5:149757718-149757740 CTGGGTTGCTTAATGAAAGAGGG + Intronic
1000402564 5:160846546-160846568 CTGTATTCCTTAATGAGTGAGGG + Intronic
1001366892 5:171150890-171150912 CAGTGTTCCTCAATGACAAAAGG - Intronic
1002390456 5:178907666-178907688 CAGTTTTCCTTAAAGTCAGTTGG + Intronic
1003334453 6:5157551-5157573 CAGTATGCCTTAATGACAGAAGG + Intronic
1003388805 6:5694386-5694408 CTTTTTTCCTGAATAATAGAAGG + Intronic
1003486664 6:6586134-6586156 ATGTTTTGTTTTATGACAGATGG - Intergenic
1003780594 6:9420877-9420899 CTGTCTTCCTAAATGGCAGTGGG + Intergenic
1003826657 6:9960239-9960261 CTGGTTTCCTAACTGACAGCTGG - Intronic
1006354794 6:33548890-33548912 CCGTTTTGGTCAATGACAGAAGG + Intergenic
1008119571 6:47596837-47596859 CTGTTTTCCATAATGGCTGTGGG + Intronic
1008310803 6:49970825-49970847 TTATTTCCCTAAATGACAGAAGG - Intergenic
1008660432 6:53662208-53662230 CATTTTTCCTAAATGACAGCAGG + Intronic
1008784729 6:55153531-55153553 ATGTTTTCATCAATGACTGATGG - Intronic
1009344876 6:62600955-62600977 CTGTTTCCCCTCATGGCAGAAGG - Intergenic
1012760694 6:103296961-103296983 CTGTTTACAGTCATGACAGAAGG + Intergenic
1013708125 6:112863800-112863822 TTGTTTTCTTTAATTATAGAAGG - Intergenic
1014179876 6:118373139-118373161 CTGCTTTCATTATTGAAAGAGGG - Intergenic
1015680268 6:135799664-135799686 CTGCTTCCATTAATGGCAGAAGG - Intergenic
1017298504 6:152828588-152828610 CTGCTTTTATTAATGACAGGTGG + Intergenic
1020362744 7:7347273-7347295 TTGATTTGCTTAATGACAAAGGG - Intergenic
1020856416 7:13430843-13430865 ATATTTTACTTAATGAAAGATGG + Intergenic
1021255691 7:18389706-18389728 ATGTTTACCTTAAAGACAGTTGG + Intronic
1021828562 7:24579228-24579250 CTGTTTCACCTACTGACAGATGG + Intronic
1022364855 7:29702642-29702664 CTGTTTTACTTCATGATAGTTGG + Intergenic
1022802436 7:33789030-33789052 CGTCTTTCATTAATGACAGATGG - Intergenic
1023157604 7:37266338-37266360 CTATTTTTCTTATTGCCAGAGGG + Intronic
1023241234 7:38150001-38150023 CTATGTTCCTGAATGACAGTTGG + Intergenic
1023819012 7:43969988-43970010 CTGGTATCCCCAATGACAGATGG + Intergenic
1024030274 7:45454892-45454914 CTGTGTAACTTAATGTCAGAGGG + Intergenic
1025758737 7:64370644-64370666 CTGTTTTCATGACTGACAGTTGG - Intergenic
1025761016 7:64391682-64391704 CTGCTTTACTTAATGCCTGATGG - Intergenic
1027236641 7:76302473-76302495 TTGCTTTCCTTAACGAGAGAAGG + Intergenic
1028662690 7:93298620-93298642 CTGTTTTACTTATTGTCAAAAGG + Intronic
1029744065 7:102506948-102506970 CTGGTATCCCCAATGACAGATGG + Intronic
1029762055 7:102606111-102606133 CTGGTATCCCCAATGACAGATGG + Intronic
1030022677 7:105291378-105291400 CTACTTTCTTTAAAGACAGAGGG + Intronic
1031901202 7:127413500-127413522 CTGTATACCTTAGTGACACATGG + Intronic
1032612251 7:133427514-133427536 CTGTTTTCCTTTCTGACTGGAGG - Intronic
1032741054 7:134739692-134739714 TAGATTTCCTTAATGACACATGG + Intergenic
1032900756 7:136304342-136304364 CTCTTTTCATTAATGAGAGTGGG + Intergenic
1033047299 7:137974280-137974302 CTGTATTCCTTTATTTCAGAGGG - Intronic
1033516948 7:142116160-142116182 CTGATTTTCTTACTAACAGATGG - Intronic
1034104009 7:148475240-148475262 CTGTTTTCTTTTCTGACAAATGG + Intergenic
1034831361 7:154310934-154310956 CTCTCTTTCTCAATGACAGAGGG - Intronic
1036204257 8:6793861-6793883 CCTGTCTCCTTAATGACAGATGG + Intergenic
1036724594 8:11208519-11208541 TTGTTTTTCTTAATCACAGGAGG + Intergenic
1037163264 8:15797387-15797409 CAGTCTTCCTTGATGCCAGAGGG + Intergenic
1037484046 8:19330902-19330924 CTGTTTGACATAATGCCAGATGG - Intronic
1037779087 8:21855546-21855568 CTGTTTGCATTGATGACAGTGGG - Intergenic
1038160581 8:25033492-25033514 GTGTATCCCTAAATGACAGAAGG - Intergenic
1038369258 8:26971235-26971257 CTGTTATAATTAAGGACAGATGG - Intergenic
1039474284 8:37831306-37831328 CTTTTTTCTTTAATGAAACAAGG - Intronic
1040375232 8:46818516-46818538 CTGTTTTCATGAGTGACAGTTGG - Intergenic
1040383110 8:46892165-46892187 CTGTTTTCATGAATAACAGTTGG + Intergenic
1041416338 8:57613116-57613138 ATGTTCTCCTAAATGACAAATGG + Intergenic
1042060901 8:64816326-64816348 CTGTTTTAATTATTGACATATGG + Intergenic
1042672095 8:71275506-71275528 CTCATTTCCTTAATTACATATGG - Intronic
1042993096 8:74662747-74662769 CGGTTTTCTTTAATGATAGGAGG + Intronic
1043005205 8:74810029-74810051 CTGTTTTCTATATTGAAAGAGGG + Intronic
1044870142 8:96611574-96611596 CTGTGTCCCTCAATTACAGAGGG + Exonic
1046215533 8:111141054-111141076 ATTTTTTCCTTCGTGACAGAAGG + Intergenic
1047116418 8:121846260-121846282 CTGTTATCCTTGGTGACAGTCGG - Intergenic
1047295126 8:123563979-123564001 ATATTTTCCTTTAGGACAGAGGG - Intergenic
1047706555 8:127505266-127505288 CTCTTTTTCTTTATGACAGAGGG - Intergenic
1048389651 8:133949965-133949987 TTGTTTTTTTTAATTACAGACGG - Intergenic
1050029192 9:1367398-1367420 AAGTTTTCATTTATGACAGAAGG + Intergenic
1051308134 9:15738285-15738307 CTTTTTTCCTTAATGAATCACGG - Intronic
1051676598 9:19564650-19564672 CTGATTTCCCTAAGGACAGAAGG + Intronic
1052111764 9:24594412-24594434 CTATTTTCATCAAAGACAGAAGG + Intergenic
1052268074 9:26596843-26596865 TTTTTTTCCTTAAACACAGAGGG - Intergenic
1055000625 9:71445908-71445930 ATGTTTTCCTTTATCCCAGAGGG - Intronic
1055806587 9:80102100-80102122 TTGTGTTTCCTAATGACAGATGG + Intergenic
1056700399 9:88900958-88900980 CTGTGTTCTTACATGACAGAAGG + Intergenic
1058235325 9:102483814-102483836 TTGTTTTCGTTATTCACAGATGG - Intergenic
1058414914 9:104777458-104777480 TTGTTTTCTTTAGTGACAGTTGG + Intergenic
1059227752 9:112688478-112688500 TTTTTTTTTTTAATGACAGAGGG - Intronic
1060650525 9:125322670-125322692 CTGTTTTCCTTAACCTCACATGG + Intronic
1185472922 X:395722-395744 ACATTTTTCTTAATGACAGAAGG + Intergenic
1186058280 X:5674763-5674785 CTGTTTTTCTTAATGATAAATGG + Intergenic
1186517746 X:10179194-10179216 CAGTTTTAATTAATGACAAAAGG + Intronic
1186612285 X:11149201-11149223 TTGTTTTCATTATTTACAGAGGG + Intronic
1186625949 X:11294012-11294034 CTGTTTTGCTTAATGTCCCAAGG + Intronic
1188346393 X:29071704-29071726 TTTTCTTCCTTTATGACAGATGG + Intronic
1188546835 X:31317153-31317175 CTGCTTCCTTAAATGACAGAGGG + Intronic
1188904871 X:35779853-35779875 AAGTTCTCCTTAATGACTGAAGG - Intergenic
1189524263 X:41803175-41803197 TTGTTTTTCTTGGTGACAGAGGG - Intronic
1190586471 X:51948580-51948602 CTGCTTTCATTCATGGCAGAAGG - Intergenic
1191650246 X:63529383-63529405 GTGTTTTCCTTCAAGACAGCAGG - Intergenic
1193960521 X:87919688-87919710 CTGTTTTCACTCATGGCAGAAGG + Intergenic
1195459079 X:105103360-105103382 CTGTTTTTCTTGCTCACAGATGG - Intronic
1196610117 X:117703711-117703733 CTGTTTTCCTAAGTGCAAGAAGG - Intergenic
1197517619 X:127454974-127454996 CTGTCTTCAGCAATGACAGAGGG - Intergenic
1199372557 X:147068448-147068470 CTGCTTGCATTTATGACAGAGGG + Intergenic
1200850651 Y:7879736-7879758 CTGTTTTCATTAGTGACAATTGG + Intergenic
1200858404 Y:7963823-7963845 CTGTTTTCATGAATGACAGTTGG + Intergenic
1200900541 Y:8426930-8426952 CTGTTTTCATATATGACAGTTGG + Intergenic
1202182745 Y:22153492-22153514 CTGTCTCCCTTTTTGACAGAGGG + Intergenic
1202208614 Y:22432909-22432931 CTGTCTCCCTTTTTGACAGAGGG - Intergenic
1202244634 Y:22807537-22807559 CTGTTTTCATGAGTGACAGTTGG - Intergenic
1202264846 Y:23007364-23007386 CTGTTTTCATGATTGACAGTTGG - Intergenic
1202397623 Y:24441283-24441305 CTGTTTTCATGAGTGACAGTTGG - Intergenic
1202417837 Y:24641106-24641128 CTGTTTTCATGATTGACAGTTGG - Intergenic
1202452949 Y:25028980-25029002 CTGTTTTCATGATTGACAGTTGG + Intergenic
1202473158 Y:25228804-25228826 CTGTTTTCATGAGTGACAGTTGG + Intergenic