ID: 1138502629

View in Genome Browser
Species Human (GRCh38)
Location 16:57457253-57457275
Sequence TAGGAGAACCCCACCCAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 172}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138502629_1138502635 8 Left 1138502629 16:57457253-57457275 CCATCCTGGGTGGGGTTCTCCTA 0: 1
1: 0
2: 0
3: 15
4: 172
Right 1138502635 16:57457284-57457306 AGTGTGCCACCAGGTCTGCAGGG 0: 1
1: 0
2: 0
3: 12
4: 173
1138502629_1138502634 7 Left 1138502629 16:57457253-57457275 CCATCCTGGGTGGGGTTCTCCTA 0: 1
1: 0
2: 0
3: 15
4: 172
Right 1138502634 16:57457283-57457305 GAGTGTGCCACCAGGTCTGCAGG 0: 1
1: 0
2: 2
3: 10
4: 159
1138502629_1138502638 14 Left 1138502629 16:57457253-57457275 CCATCCTGGGTGGGGTTCTCCTA 0: 1
1: 0
2: 0
3: 15
4: 172
Right 1138502638 16:57457290-57457312 CCACCAGGTCTGCAGGGAGGAGG 0: 1
1: 0
2: 3
3: 52
4: 445
1138502629_1138502640 26 Left 1138502629 16:57457253-57457275 CCATCCTGGGTGGGGTTCTCCTA 0: 1
1: 0
2: 0
3: 15
4: 172
Right 1138502640 16:57457302-57457324 CAGGGAGGAGGAATCCATGCAGG 0: 1
1: 0
2: 3
3: 36
4: 436
1138502629_1138502641 29 Left 1138502629 16:57457253-57457275 CCATCCTGGGTGGGGTTCTCCTA 0: 1
1: 0
2: 0
3: 15
4: 172
Right 1138502641 16:57457305-57457327 GGAGGAGGAATCCATGCAGGAGG 0: 1
1: 0
2: 2
3: 64
4: 501
1138502629_1138502636 11 Left 1138502629 16:57457253-57457275 CCATCCTGGGTGGGGTTCTCCTA 0: 1
1: 0
2: 0
3: 15
4: 172
Right 1138502636 16:57457287-57457309 GTGCCACCAGGTCTGCAGGGAGG 0: 1
1: 0
2: 5
3: 26
4: 196
1138502629_1138502633 -1 Left 1138502629 16:57457253-57457275 CCATCCTGGGTGGGGTTCTCCTA 0: 1
1: 0
2: 0
3: 15
4: 172
Right 1138502633 16:57457275-57457297 AGTGGTCTGAGTGTGCCACCAGG 0: 1
1: 0
2: 1
3: 11
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138502629 Original CRISPR TAGGAGAACCCCACCCAGGA TGG (reversed) Intronic
900361551 1:2291523-2291545 CAGGAGAACCCCAGCAAGGTTGG + Intronic
900878639 1:5364650-5364672 AGGGAGAACCCAACCAAGGAGGG - Intergenic
901237871 1:7677213-7677235 TACCCGAGCCCCACCCAGGAAGG + Intronic
903179289 1:21597354-21597376 TCAGAGAACCCCACCCTGGGAGG + Intronic
903275405 1:22218281-22218303 TACGCGAACCCCAGCCAGGCAGG - Intergenic
904585203 1:31576303-31576325 TAGGGGAACCCCAAGCAGGAAGG - Intergenic
911087989 1:93995465-93995487 AAGGAGCACACCACCCAAGAAGG - Intronic
912631043 1:111247117-111247139 AGGGATAAACCCACCCAGGATGG + Intergenic
914044571 1:144079877-144079899 TAAGAGGGCCCCACACAGGAGGG - Intergenic
914133539 1:144880809-144880831 TAAGAGGGCCCCACACAGGAGGG + Intergenic
915321062 1:155056785-155056807 TAGGAGAACCCAGGCCTGGATGG - Intronic
915697786 1:157762042-157762064 GAGGATAAGCCCACCCAGCATGG + Intronic
918610489 1:186484749-186484771 TAGAAGACCTGCACCCAGGAAGG + Intergenic
920093301 1:203469704-203469726 TAGGAGGACCTCACCTTGGAAGG + Intergenic
921346244 1:214188296-214188318 TGGGAAAACCCCAGCCAGGGAGG - Intergenic
922565025 1:226596195-226596217 TAGGGGAACCCCATCAGGGAGGG + Intronic
1063380930 10:5585332-5585354 TTGGAGAGCCCCACTAAGGAAGG + Intergenic
1063884257 10:10561787-10561809 TAGAAGACACCCAGCCAGGAAGG - Intergenic
1063884451 10:10563231-10563253 TAGAAGACACCCAGCCAGGAAGG + Intergenic
1066956699 10:42179564-42179586 TAAGAGGGCCCCACACAGGAGGG - Intergenic
1067228855 10:44392957-44392979 TAGGGAAAGCCCACCCAGGCAGG + Intergenic
1069695412 10:70382232-70382254 TCGGAGAACCGCTCCCAGGCGGG - Intronic
1069855818 10:71440458-71440480 CAGGAGAAACCCAGCCAGAAGGG + Intronic
1070830050 10:79412546-79412568 TGGGAGAATCCCACCGAGGGAGG + Intronic
1072608228 10:97000967-97000989 TGGCACCACCCCACCCAGGAGGG + Exonic
1072623610 10:97096895-97096917 GAGGATAAAGCCACCCAGGAGGG - Intronic
1074190158 10:111128599-111128621 TAGCAGAGGCTCACCCAGGATGG + Intergenic
1077491316 11:2862279-2862301 TCGGAGCCCCCCACCCAGGCTGG - Intergenic
1079469305 11:20763292-20763314 TAGGACAACCCCATGCAGGCTGG - Intronic
1079478846 11:20859704-20859726 TAGGAGACCCCCATTTAGGAGGG + Intronic
1082081934 11:48019042-48019064 ATGGAGAACCCCTCTCAGGAGGG + Intronic
1082741445 11:56916037-56916059 TAGAAGAACCAGAACCAGGATGG - Intergenic
1083769005 11:64856058-64856080 TGGGAGAATCCCACCCCGCAGGG - Intronic
1083822986 11:65182979-65183001 TAGCCGAGTCCCACCCAGGATGG - Intronic
1084586224 11:70064293-70064315 TCAGAGAACCCCCACCAGGAGGG - Intergenic
1085015903 11:73173919-73173941 TAGGAGAATCAGATCCAGGATGG + Intergenic
1085130462 11:74033718-74033740 TAGGAGAACCCTGCCTAGGCAGG + Exonic
1085284924 11:75353236-75353258 CAGGAGATCCCTAACCAGGATGG + Intergenic
1091160114 11:133412231-133412253 TTGGAGAGGCCCACCTAGGAGGG + Intronic
1091367853 11:135037280-135037302 TTCGAGATCCTCACCCAGGAGGG - Intergenic
1092597947 12:10027929-10027951 TGTGATAACCCCAGCCAGGAAGG + Intergenic
1097069353 12:56343572-56343594 TAGGAGTTCCCAACCCAGCAGGG + Intronic
1097741682 12:63250782-63250804 TAGGTTAACCCCACCCAGTGAGG - Intergenic
1104773002 12:131375992-131376014 TAGGAGACCCCCACCTTAGATGG + Intergenic
1105593281 13:21813288-21813310 TGGGAGAGCGCCACCTAGGAAGG - Intergenic
1108503362 13:51087734-51087756 TAAGAGATCCCCACAGAGGATGG + Intergenic
1112352793 13:98650499-98650521 TAGGCGAAGCCCTTCCAGGAAGG - Intergenic
1113201215 13:107868312-107868334 TCGGAGGAGCCCACCCGGGAGGG - Intergenic
1113835535 13:113326187-113326209 TGGGAGGACCCCTCCCAAGAGGG + Intronic
1114937478 14:27559741-27559763 GAGGATTACCCAACCCAGGAAGG - Intergenic
1115657059 14:35453430-35453452 AAGCAGAAACCCACCCTGGACGG - Intergenic
1125573281 15:40737534-40737556 TAGGAAAACCCCTCCCATTAAGG + Intronic
1126567108 15:50112356-50112378 TAGAAGATCCCCACCCTGGTGGG - Intronic
1126966703 15:54062345-54062367 TAGGAGAATCACACAGAGGATGG - Intronic
1126969249 15:54091103-54091125 CAGGGGAACCCCACTGAGGAAGG - Intronic
1127723616 15:61726368-61726390 TAAGAGAACCCTACCGGGGAGGG + Intergenic
1128616917 15:69117474-69117496 TCGCAGCACCCCGCCCAGGATGG - Intergenic
1132601823 16:776205-776227 GAGGAGGAGCCCACCCAGGGTGG + Intronic
1132681493 16:1144315-1144337 TCAGACACCCCCACCCAGGATGG + Intergenic
1132690836 16:1181160-1181182 CAGCAGAAACCCAGCCAGGAGGG - Intronic
1133067140 16:3216335-3216357 GAGGAGAACCACAGCCAGGTGGG - Intergenic
1133391619 16:5414828-5414850 AAGAAGAATCCCACCGAGGATGG - Intergenic
1137359315 16:47798283-47798305 TAGCAGATGCACACCCAGGAAGG - Intergenic
1137792589 16:51187405-51187427 CAGGAGAACCCCTCCCAGGCAGG - Intergenic
1138133367 16:54500902-54500924 TAGGAGGATCCCATCCAGGGAGG - Intergenic
1138502629 16:57457253-57457275 TAGGAGAACCCCACCCAGGATGG - Intronic
1139938887 16:70590788-70590810 TGGGAGACTTCCACCCAGGATGG - Intronic
1144340871 17:14309519-14309541 GAGGAGAACCCCGCCCAGAGAGG + Intronic
1144595504 17:16567122-16567144 AAGGAGAACACCATGCAGGATGG + Intronic
1146410072 17:32575641-32575663 TAGGAGAAACACACCCCAGAGGG - Intronic
1147305044 17:39557357-39557379 TAGGAGAAAATGACCCAGGAAGG - Intronic
1147732791 17:42614395-42614417 GAGGTGGACCCCACCCAGGTAGG + Exonic
1147740048 17:42666222-42666244 GAGGTGGACCCCACCCAGGTAGG + Exonic
1147920505 17:43913756-43913778 TAGGTGAACCCCAATGAGGAGGG - Intergenic
1149292901 17:55234480-55234502 CAGGAGAACCCAACCTAGTAGGG - Intergenic
1150004507 17:61461799-61461821 TAGGGGAACACCAGCCAGAAGGG - Intronic
1150327819 17:64270924-64270946 TAGGTCTACCCCACCCAGGAGGG + Intergenic
1152641203 17:81450001-81450023 CGGGAGAACCCCATCCACGATGG - Intronic
1152880869 17:82814355-82814377 TGGGAAAACCCCACCTGGGACGG + Intronic
1155413236 18:25568992-25569014 TTGGGCAACCCCACTCAGGAGGG + Intergenic
1155455322 18:26005652-26005674 GGGCAGAACCCCACCCATGAGGG - Intergenic
1158453791 18:57589361-57589383 AAGGAGCACCCCAACCAGGAGGG + Intergenic
1160077649 18:75693462-75693484 TACCAGAACCCCAAGCAGGATGG - Intergenic
1160525546 18:79533438-79533460 CATGAGAACCACACCCAAGAAGG - Intergenic
1165117997 19:33540679-33540701 TTGGACAAGCCCACGCAGGAGGG + Intergenic
1165119866 19:33552103-33552125 TAGAAGAGCCCCACTCAGGATGG - Intergenic
1165339291 19:35199198-35199220 TAGAAGAACCCCAGACAGGAGGG + Intergenic
1166752192 19:45169640-45169662 GAGGAGAACCCCAGGAAGGAAGG + Intronic
1202684130 1_KI270712v1_random:33296-33318 TAAGAGGGCCCCACACAGGAGGG - Intergenic
927069272 2:19508952-19508974 TATCAGAACCTCACTCAGGAAGG - Intergenic
930032934 2:47069417-47069439 CAGGAGACCCCCACCTAGGTTGG + Intronic
934168299 2:89317072-89317094 TATGAGAACTCCATCCAGCATGG + Intergenic
934198988 2:89865510-89865532 TATGAGAACTCCATCCAGCATGG - Intergenic
934247591 2:90321556-90321578 TAAGAGGGCCCCACACAGGAGGG + Intergenic
934261733 2:91481045-91481067 TAAGAGGGCCCCACACAGGAGGG - Intergenic
934304774 2:91812024-91812046 TAAGAGGGCCCCACACAGGAGGG - Intergenic
934328483 2:92040726-92040748 TAAGAGGGCCCCACACAGGAGGG + Intergenic
934466858 2:94271232-94271254 TAAGAGCGCCCCACACAGGAGGG + Intergenic
934661861 2:96147315-96147337 TGGGAGGACCCCAGCCAGGTGGG + Intergenic
936095702 2:109528902-109528924 GAGGAGGACTCCACCAAGGAGGG + Intergenic
939177772 2:138769592-138769614 AAGGAGAACCACACGCAGGCAGG + Intronic
943520275 2:188940918-188940940 TTGGAGAAACCCAGCCAGTACGG - Intergenic
943797180 2:192011153-192011175 TAGGAGCATCCACCCCAGGAAGG + Intronic
944835030 2:203570877-203570899 TATGAGGACCCTACCTAGGATGG - Intergenic
946038718 2:216765820-216765842 AAAGAGAATCCCACCCAGAAAGG - Intergenic
946333531 2:219023337-219023359 GAGGAGCAGCCCACCCAGGTGGG + Exonic
947715750 2:232338135-232338157 CAGGAGAGCCCCAAACAGGAAGG + Intronic
948242242 2:236447301-236447323 TAGGAGGGCCCCATCCAGTAGGG + Intronic
1171986583 20:31665292-31665314 GAGGCCAGCCCCACCCAGGAGGG - Exonic
1173800662 20:45892425-45892447 TAGGAGAAGCCCACCCCAGCTGG - Exonic
1173857839 20:46262276-46262298 TAGCTGAACATCACCCAGGAAGG + Intronic
1174194936 20:48766412-48766434 TCTGAGAACCCCATCCAGAAGGG + Intronic
1174270942 20:49367941-49367963 TGGGAGCAGCCCAGCCAGGAGGG + Exonic
1174411889 20:50341650-50341672 TATGAGAACCCCTCCCACAATGG + Intergenic
1174549945 20:51354972-51354994 TGGGAGGACCACACCCTGGAGGG + Intergenic
1175383079 20:58577105-58577127 TAGGAGAAACCCAGACAGCACGG + Intergenic
1175762895 20:61573218-61573240 GAATAGAACCCCACCCAGCAGGG + Intronic
1176587080 21:8597403-8597425 TAAGAGGGCCCCACACAGGAGGG - Intergenic
1178544476 21:33481187-33481209 TAGGAGAACATTATCCAGGATGG - Intergenic
1178749538 21:35287340-35287362 TTGGGGAACCCCACACAGCAAGG + Intronic
1179306590 21:40159072-40159094 AGGAAGAACCCCAGCCAGGAGGG - Intronic
1180269909 22:10574400-10574422 TAAGAGGGCCCCACACAGGAGGG - Intergenic
1180995717 22:19964297-19964319 GAGGTGAGCCCCAACCAGGATGG + Exonic
1181308568 22:21931066-21931088 TAGGGGAACCCCACCCAGCCTGG - Intronic
1181582857 22:23837555-23837577 GAGGAGAACTCCAGCAAGGATGG + Intronic
1182013831 22:27022569-27022591 TATGCTAAGCCCACCCAGGAGGG - Intergenic
1182368085 22:29792124-29792146 TAGCAGCACCATACCCAGGATGG - Intronic
1183605683 22:38865816-38865838 TAGGAGCCCCCCACCGAGGGTGG - Exonic
1185222531 22:49636241-49636263 GAGGAGACCCCCACCCAGGGTGG + Intronic
1185298544 22:50066936-50066958 GAGGATAACCCCACACAGAAAGG + Intronic
950646838 3:14382411-14382433 TGGGAGAAAGCCACCCAGGAAGG + Intergenic
951757194 3:26103864-26103886 TAGCAGAATCCCAGACAGGATGG - Intergenic
953371066 3:42388931-42388953 TTGGAGAGCCCCAGCAAGGAGGG + Intergenic
953865574 3:46580398-46580420 TAGGGGGACCCAAACCAGGATGG + Intronic
954034022 3:47840869-47840891 TAGCAGACCCCAACCCTGGAGGG - Exonic
954457826 3:50609544-50609566 TAGGGGAAGCCCACCCAGCAGGG + Intronic
954807435 3:53228716-53228738 TTGGAGAACCCAACTCAGGAGGG + Intronic
954962306 3:54577266-54577288 TGGGAAATCCCCACGCAGGAAGG - Intronic
958151872 3:89702222-89702244 TAGAATAACTGCACCCAGGAAGG + Intergenic
958530945 3:95329758-95329780 TAGGATAACTGCACTCAGGAAGG - Intergenic
961603543 3:128077592-128077614 TAGCTGAGCCTCACCCAGGATGG + Intronic
962365005 3:134772974-134772996 TTGTAGAACCCCTCCCAGGAAGG - Intronic
967319822 3:188184343-188184365 AAGGAGCTCCCCATCCAGGAGGG + Intronic
969149238 4:5154633-5154655 TAGGAGCACCAGACACAGGAAGG - Intronic
971615373 4:28783115-28783137 TATGAGAACCCTAGCCAGGCTGG + Intergenic
971758576 4:30734889-30734911 TTGGAGACACCCACCCAGCAGGG - Intronic
974383800 4:61178179-61178201 TTGGAGAACCCCACTCAGGTTGG - Intergenic
976444017 4:85109855-85109877 TAGGACAACCCTAGCCAGAAAGG + Intergenic
980015066 4:127640347-127640369 TAAGAGACCCCCACACAGAAGGG - Intronic
986257257 5:6110696-6110718 GAGGTGAACTGCACCCAGGATGG - Intergenic
995960133 5:117829633-117829655 TAGGGAAACCCCACCCAGTGAGG + Intergenic
998544714 5:143016878-143016900 TAAAACAACCCCACCAAGGAGGG - Intronic
1001355897 5:171022508-171022530 CAGGGGAACCCCACCCAGTGAGG + Intronic
1004839122 6:19562456-19562478 TAGTTTAACCCAACCCAGGATGG - Intergenic
1005785059 6:29236527-29236549 AAGGAAAACCTTACCCAGGAAGG + Intergenic
1007399987 6:41598019-41598041 ATGGGGAACCCCACCCAGGGTGG - Intronic
1013930291 6:115522355-115522377 TTGGAAAACCCCTCCCAGGAAGG + Intergenic
1015525160 6:134168713-134168735 TAGGAGAATGCCACACAAGAGGG - Intergenic
1017864886 6:158434764-158434786 TAGGAGGACCACACTCAGCATGG - Intronic
1019468096 7:1201565-1201587 GAGGAGCACGCCAGCCAGGAGGG + Intergenic
1023986415 7:45099760-45099782 TGGGAGAAAGCCTCCCAGGATGG + Intergenic
1028474665 7:91240123-91240145 TTTGAGAACTCCACCCAGGCTGG + Intergenic
1029448878 7:100629528-100629550 AAGGAGCACACCATCCAGGAAGG - Intronic
1029600955 7:101563227-101563249 TCGGAGATCCCCACCCTGGCAGG - Intergenic
1032471191 7:132180556-132180578 TGGCAGAACCCCATCCTGGATGG - Intronic
1035398732 7:158551406-158551428 CATGAGAACCCCACCCCTGATGG - Intronic
1036631903 8:10521801-10521823 CAGGAGAAAGCCACCCAGCAGGG - Intergenic
1039215996 8:35272297-35272319 CAGGGGAACCCAACCAAGGACGG - Intronic
1045280204 8:100743433-100743455 CAGGAGGAACCCATCCAGGAAGG + Intergenic
1047327981 8:123858118-123858140 TAGGAGAACCCATCAGAGGAGGG - Intronic
1049622655 8:143605598-143605620 TAGGAGACCCTCATGCAGGAGGG + Exonic
1050107318 9:2178907-2178929 TAAGAGAACCCCACCCTGTAGGG + Intronic
1053861976 9:42396164-42396186 TAGGAGACTCCAACCCATGAGGG - Intergenic
1053943307 9:43278175-43278197 TAAGAGGGCCCCACACAGGAGGG + Intergenic
1054406897 9:64771265-64771287 TAAGAGGGCCCCACACAGGAGGG + Intergenic
1054440521 9:65256731-65256753 TAAGAGGGCCCCACACAGGAGGG + Intergenic
1054489886 9:65765193-65765215 TAAGAGGGCCCCACACAGGAGGG - Intergenic
1057024176 9:91723454-91723476 TAGGAGCACCCAAGCCAGGCAGG - Exonic
1057426220 9:94951905-94951927 TCCCAGAACCCCACCCAGCATGG + Intronic
1061886859 9:133595571-133595593 TAGGAGAAGCCAGCCAAGGAGGG - Intergenic
1061985393 9:134127455-134127477 TGGTTGAACACCACCCAGGAAGG + Intergenic
1062085588 9:134646402-134646424 GAGGAGGACCCCACGAAGGAGGG - Intronic
1203586427 Un_KI270747v1:8080-8102 TAAGAGGGCCCCACACAGGAGGG + Intergenic
1203617037 Un_KI270749v1:75117-75139 TAAGAGGGCCCCACACAGGAGGG - Intergenic
1185666298 X:1767970-1767992 TTGGAGACCCCCACATAGGATGG - Intergenic
1186859365 X:13656150-13656172 TAGGGGAAACACACGCAGGATGG - Intronic
1195254987 X:103081826-103081848 AAGGAGAACCCCTCTCGGGACGG + Intronic
1200057898 X:153470995-153471017 CAGGAGAACCCGACCAAGGCAGG - Intronic