ID: 1138505563

View in Genome Browser
Species Human (GRCh38)
Location 16:57476663-57476685
Sequence TTGGGTTCCCAGCTGGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 1, 2: 2, 3: 25, 4: 181}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138505563_1138505571 -3 Left 1138505563 16:57476663-57476685 CCCTGCTCCAGCTGGGAACCCAA 0: 1
1: 1
2: 2
3: 25
4: 181
Right 1138505571 16:57476683-57476705 CAAAGCTGTTTGAGGTAAAGGGG 0: 1
1: 0
2: 0
3: 11
4: 189
1138505563_1138505573 7 Left 1138505563 16:57476663-57476685 CCCTGCTCCAGCTGGGAACCCAA 0: 1
1: 1
2: 2
3: 25
4: 181
Right 1138505573 16:57476693-57476715 TGAGGTAAAGGGGTGGAGCTAGG 0: 1
1: 0
2: 0
3: 37
4: 332
1138505563_1138505570 -4 Left 1138505563 16:57476663-57476685 CCCTGCTCCAGCTGGGAACCCAA 0: 1
1: 1
2: 2
3: 25
4: 181
Right 1138505570 16:57476682-57476704 CCAAAGCTGTTTGAGGTAAAGGG 0: 1
1: 0
2: 2
3: 13
4: 163
1138505563_1138505568 -5 Left 1138505563 16:57476663-57476685 CCCTGCTCCAGCTGGGAACCCAA 0: 1
1: 1
2: 2
3: 25
4: 181
Right 1138505568 16:57476681-57476703 CCCAAAGCTGTTTGAGGTAAAGG 0: 1
1: 1
2: 0
3: 13
4: 155
1138505563_1138505572 0 Left 1138505563 16:57476663-57476685 CCCTGCTCCAGCTGGGAACCCAA 0: 1
1: 1
2: 2
3: 25
4: 181
Right 1138505572 16:57476686-57476708 AGCTGTTTGAGGTAAAGGGGTGG 0: 1
1: 0
2: 0
3: 16
4: 217
1138505563_1138505574 16 Left 1138505563 16:57476663-57476685 CCCTGCTCCAGCTGGGAACCCAA 0: 1
1: 1
2: 2
3: 25
4: 181
Right 1138505574 16:57476702-57476724 GGGGTGGAGCTAGGAATCTGAGG 0: 1
1: 0
2: 4
3: 27
4: 285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138505563 Original CRISPR TTGGGTTCCCAGCTGGAGCA GGG (reversed) Intronic
901423528 1:9166616-9166638 GGGGGCTCCCAGCTGGAGCGTGG - Intergenic
902361586 1:15945085-15945107 GAGGGTTCCCAGCTGGAGAACGG - Exonic
903369442 1:22825787-22825809 TTGGTTTCCCACCTGCAGCAGGG - Intronic
903546647 1:24128180-24128202 TTGCGTTCCCACCTGGGCCAAGG - Exonic
905793738 1:40803723-40803745 TGGGGTTCCCACTGGGAGCATGG + Intronic
907089849 1:51713027-51713049 TTGGGGTCCCAACTAGAACATGG + Intronic
907540787 1:55214621-55214643 TTCGGTTCCCAACTGGAGCCTGG + Intronic
909784417 1:79593228-79593250 TTGGTTGCACAGCTGGAGAAGGG - Intergenic
911620754 1:100064533-100064555 TTGGGGTCACAGGTGGAGCATGG - Intronic
914300866 1:146376365-146376387 TTCGGTGGCCAGCTGGAGCCTGG - Intergenic
918753055 1:188298017-188298039 TTGTGTTCTCACCTGGAGCTTGG + Intergenic
919381889 1:196870282-196870304 TTGGATTCTCAGCTAGAGTAAGG + Intronic
920078550 1:203354982-203355004 TTGTGTGCCCAGCTGGGACAGGG - Intergenic
920369298 1:205467804-205467826 TTGGAATCCCAGCCTGAGCACGG - Intergenic
920847555 1:209606722-209606744 TTGTCTTTCCAGCTGGACCAGGG + Intronic
920942824 1:210500104-210500126 TTGGGTTACCAACAGGGGCAAGG + Intronic
922796705 1:228343089-228343111 CTGGGTCCCCAGCTCCAGCACGG - Intronic
922797977 1:228350982-228351004 GTCGGCTCCCACCTGGAGCATGG + Intronic
1065317826 10:24481615-24481637 TTGGATTTCCAGCTGGCCCATGG - Intronic
1067180689 10:43983600-43983622 TTGGTTTCCCAGCAGCAGCGGGG + Intergenic
1067318871 10:45198763-45198785 GTGGGTCCCCAGCTGCAGGAGGG - Intergenic
1067319544 10:45205214-45205236 ATGGGTTCCCAGCTGCAGGAGGG - Intergenic
1067557087 10:47279889-47279911 ATGGGTTCAGAGCAGGAGCATGG + Intergenic
1068928454 10:62564279-62564301 CTCGGTTTCCAGCTGGAGCGGGG - Intronic
1070788695 10:79177049-79177071 CTCGGTTCCCAGCTGCAGCAGGG + Intronic
1071728740 10:88226410-88226432 TTTGAGTCCCAGCTGGAGCTGGG - Intergenic
1072887908 10:99296686-99296708 TTGGGTACCAAGCTGATGCAGGG - Intergenic
1075080625 10:119381264-119381286 ATGGGTTCTCAGCTGGAGGAAGG - Intronic
1075632928 10:124011958-124011980 TTGGGATCCCAGCTACTGCACGG - Intronic
1075814734 10:125256299-125256321 TAGGGTTCCCATCTGGGGCGTGG - Intergenic
1075981851 10:126747025-126747047 TTGGTTTTCCACCTGGAGCCAGG - Intergenic
1077234514 11:1473410-1473432 TGGGGTTCCCAGATGGTGTAGGG + Intronic
1077328231 11:1972821-1972843 TTGGGTCTGCAGCTGGCGCATGG - Intronic
1077806722 11:5597626-5597648 TAGGGCTCCCAGCTGGTGGACGG + Intronic
1079302531 11:19290951-19290973 TTGGGTTACTTGCTGGGGCAGGG - Intergenic
1080891594 11:36413268-36413290 TTGGGTTACCAGCTTGAGGCAGG + Intronic
1081088005 11:38824528-38824550 TTTGGTACCCAGCTGCAGCTTGG - Intergenic
1081775592 11:45674225-45674247 CTGGGGTCCCAGCTGGGGCAGGG - Intergenic
1083448739 11:62728187-62728209 TCGGTTTACCAGCAGGAGCAAGG - Intronic
1085122069 11:73973678-73973700 TTGGATGCCTAGCTGGGGCAGGG + Intergenic
1088477968 11:110263533-110263555 TTAAGTTGCCAGCTGGATCATGG - Intronic
1089114795 11:116086091-116086113 TTCTGGTACCAGCTGGAGCAGGG - Intergenic
1202811210 11_KI270721v1_random:28001-28023 TTGGGTCTGCAGCTGGCGCATGG - Intergenic
1094782976 12:33814329-33814351 TTGGGTTCAAAACTGGAGTAAGG + Intergenic
1097234956 12:57533092-57533114 GTGGGTTCCCAGCTAGAACCAGG - Intronic
1098519753 12:71421507-71421529 TGGGGATGCCAGCTGCAGCAGGG - Intronic
1099495273 12:83339416-83339438 TTGGGTTCCCTTCTGGCCCAGGG - Intergenic
1100788469 12:98104379-98104401 TTGGGTTCCTAGCTTTAGCCTGG + Intergenic
1100909209 12:99338778-99338800 GTGGGTTCCCTTCTGGTGCAGGG + Intronic
1105931446 13:25056539-25056561 TGGGCTCCCCAGCTGTAGCATGG + Intergenic
1106395971 13:29381111-29381133 GTAGGTTCCCAGCTGCAGAAAGG - Intronic
1107709797 13:43140525-43140547 TTGGGTACCTTGCTGGAGAATGG + Intergenic
1109635891 13:65115537-65115559 TTGGGCACCCATTTGGAGCAAGG - Intergenic
1109734746 13:66468066-66468088 TTAGATATCCAGCTGGAGCATGG - Intronic
1114889243 14:26896082-26896104 CTGGATATCCAGCTGGAGCAAGG + Intergenic
1115850003 14:37583780-37583802 ATGGCTTCCCAGCTGGAGGCCGG + Intergenic
1119133607 14:72196505-72196527 TTGGGTTCCCAGGAGGAACAGGG - Intronic
1119525217 14:75317467-75317489 TAGGGCTCCCAGGTGGAGCCAGG - Intergenic
1119556914 14:75560310-75560332 ATGGGGTCGGAGCTGGAGCAGGG + Intergenic
1122504508 14:102223040-102223062 TTGGGTGAGCAGCGGGAGCACGG - Intronic
1122519552 14:102333867-102333889 CTGGGTTCCCAGCTTGAGCCTGG - Intronic
1123990205 15:25677812-25677834 TGGGACTCCCAGCTGGAGCTGGG - Exonic
1128285827 15:66436261-66436283 TTGTCTCCCCAGCTGGAACAAGG + Intronic
1128688519 15:69705600-69705622 AGGGGCTCCCAGATGGAGCAAGG + Intergenic
1129360425 15:75020773-75020795 TTGGGTTCCAAGCTGAAGCCAGG - Exonic
1130709943 15:86270184-86270206 TTGGGTTGCCAGGTGCAGCAAGG + Intronic
1131264791 15:90909575-90909597 CTGGGTTCCCAACTCGGGCAGGG + Intronic
1131536538 15:93242039-93242061 AAGGCTTCCCAGGTGGAGCAGGG + Intergenic
1132396629 15:101479620-101479642 CTGGTTTCCCATCTGGAGGACGG + Intronic
1132758543 16:1497599-1497621 TGGGGGTGCCAGCTGCAGCACGG - Intronic
1133921133 16:10154192-10154214 TTGTGGGCCCAGATGGAGCATGG - Intronic
1133997880 16:10761991-10762013 TTGGGGTGCCAGCTGGAGGGTGG - Intronic
1137024407 16:35457972-35457994 CTGGGCTCCCAGCTGCACCATGG + Intergenic
1137947515 16:52748721-52748743 TTGGGTTGACAGCTGTAGGATGG + Intergenic
1138105652 16:54286024-54286046 TTGGTATCCCAGCTGGGGGAAGG + Exonic
1138505563 16:57476663-57476685 TTGGGTTCCCAGCTGGAGCAGGG - Intronic
1139738619 16:69015400-69015422 TTGGGTTCTCAGATGTAGCTGGG + Intronic
1142188339 16:88705550-88705572 TGGGGTTTCCAGCTGCACCAGGG - Intronic
1142439441 16:90085975-90085997 GTGGGTTCCCCACTGGGGCATGG + Intronic
1143111977 17:4558075-4558097 GTGGGCTGCCACCTGGAGCAGGG + Exonic
1145007017 17:19343847-19343869 CTGTGTTCCCAGCTGGTTCATGG - Exonic
1145280694 17:21464790-21464812 ATGATTTCCCAGCAGGAGCAAGG - Intergenic
1148221476 17:45865357-45865379 TTGGGTTCCCAGGCTGAACATGG - Intergenic
1149153197 17:53594384-53594406 ATGGGTTCCCTTCTGGACCAGGG + Intergenic
1149457829 17:56802601-56802623 TTGGGATCCCAGCAGGAGACTGG - Intronic
1149557701 17:57585875-57585897 TCGTGTGCGCAGCTGGAGCAAGG - Intronic
1149680385 17:58503015-58503037 ATGGGTTCCCAGCAGGAGGATGG - Intronic
1150174309 17:63034024-63034046 TTGGTTTCCCAGGTGAAGGACGG - Intronic
1150627091 17:66848720-66848742 TTGGGTCACCAGCTGGGGTAGGG - Intronic
1152502878 17:80724838-80724860 TTGCCTTTTCAGCTGGAGCACGG + Intronic
1152958129 18:57681-57703 GTGGGTTCCCCACTGGGGCATGG - Intronic
1157283487 18:46361221-46361243 TTGTTTTCCCATCTGGAGCTGGG - Intronic
1157401864 18:47395453-47395475 CTGTGTTCCCAGCAGGAGGAAGG + Intergenic
1157529403 18:48409027-48409049 TTGGGGCGCCGGCTGGAGCAGGG - Intronic
1157967761 18:52227602-52227624 TTGGGTTTCCTGCAGGAGCTGGG - Intergenic
1159038280 18:63298330-63298352 TTGGTTTCCCAGATGGCCCATGG - Intronic
1160929521 19:1563605-1563627 TTGGGGTCTCAGCAGGAGCAGGG + Intronic
1161194175 19:2977199-2977221 TTGGGGTCCCAGCGGGGGCGGGG - Intergenic
1162090823 19:8278816-8278838 TTGGCTCCCAAGCTGGAGTACGG - Intronic
1162093056 19:8293654-8293676 TTGGCTCCCAAGCTGGAGTACGG - Intronic
1162781171 19:13007654-13007676 TTGTGTCCCCAGATGGGGCAAGG + Intronic
1164488828 19:28687788-28687810 TTGGGTTCCCTGCGTGAGAATGG - Intergenic
1165493758 19:36140430-36140452 TGGGGTTCCCCGCTGGAACTGGG - Intronic
1165926747 19:39331167-39331189 TTGGGTTTCCTGCTGGTGTAGGG - Intronic
926170405 2:10549612-10549634 TTGGGGTACCAGCTGGAAGAAGG + Intergenic
927213339 2:20651735-20651757 TTGGGTCCCCAGCTGGAGCAGGG + Intergenic
927850189 2:26494041-26494063 ATGGGGTCCCATCTGGAGCCTGG + Intronic
928997353 2:37307114-37307136 TTGGATGCACAACTGGAGCAGGG - Intronic
938444393 2:131366434-131366456 TTGGGTCCCCTGGGGGAGCAGGG - Intergenic
938528988 2:132163712-132163734 ATGGGTCCCCAGCTGCAGGAGGG + Intronic
940460817 2:153960298-153960320 TTGGGTGCCAAGCTGATGCAGGG + Intronic
945681955 2:212924966-212924988 TAGAGTTCCCAGAGGGAGCATGG - Intergenic
946023994 2:216660833-216660855 GTGGGGTCTCAGCTGGAGGAGGG + Intronic
946939976 2:224760381-224760403 TTGAGTTCTCAGCCTGAGCAGGG - Intergenic
948392629 2:237624044-237624066 TTTGGATTACAGCTGGAGCAGGG - Intergenic
1168832522 20:854446-854468 TGGGGTGCCAAGCTGGAGCCAGG + Intronic
1169324644 20:4665269-4665291 TGGGGTTCCCAGCTGGCTCCTGG + Intergenic
1171767655 20:29298981-29299003 TTGGGTTCCCGGGGGGAGTATGG - Intergenic
1174975410 20:55327767-55327789 TTGGGTTCTCAGGTAGAGAAAGG - Intergenic
1175138413 20:56842203-56842225 TGGGGATGCCAGCTGCAGCAAGG + Intergenic
1175608243 20:60328889-60328911 TGGGGTTGCCAGATGTAGCAAGG + Intergenic
1175876077 20:62230832-62230854 TCGGGTTCCCAGCTGCAGCCAGG - Intergenic
1176148199 20:63574633-63574655 TTGGGGTCCCAGCAGCACCAGGG - Intergenic
1176447275 21:6831171-6831193 TTGGCTTCTCAGCTGCAGGAGGG - Intergenic
1176767520 21:13036204-13036226 ATGGGTCCCCAGCTGCAGGAGGG - Intergenic
1176825443 21:13696197-13696219 TTGGCTTCTCAGCTGCAGGAGGG - Intergenic
1179569523 21:42269807-42269829 TTGGGTGCCCAGCTGGGGACCGG + Intronic
1180229824 21:46420560-46420582 TTGGGCTCCGAGGTGAAGCATGG + Intronic
1181725857 22:24810490-24810512 TTTGGTTCCCAGAGCGAGCAGGG + Intronic
1181749003 22:24976132-24976154 CAGTGTTCCCAGCTGCAGCAGGG - Intronic
1182300339 22:29333493-29333515 TGGGCTTCTCAGCTGGAGCAGGG + Intronic
1182565811 22:31198268-31198290 ATGGGTTCCCAGCAATAGCATGG - Intronic
1182760416 22:32718101-32718123 TGTCTTTCCCAGCTGGAGCAGGG + Intronic
1183195451 22:36350876-36350898 TTGATTTCCCAGCGGGAGCTGGG - Intronic
1183541963 22:38434631-38434653 TGGGGGTCCCAGGTTGAGCAGGG - Intronic
950446600 3:13042372-13042394 TTTGGTCTCCAGCTGGACCACGG + Intronic
951223521 3:20094641-20094663 GTGGGTTTGCAGCTGGATCACGG + Intronic
953171630 3:40512425-40512447 CTGGTCTCCCAGCTGGAGCAAGG + Exonic
953440000 3:42908819-42908841 CTGATTTCCCAGCTGGAGCGAGG + Exonic
953443598 3:42941981-42942003 TTGGTCTCTCATCTGGAGCAAGG + Exonic
954063554 3:48088678-48088700 TGGGGTACCCAGCTGCCGCAGGG + Intronic
954442936 3:50531558-50531580 TGGGGTGTCCATCTGGAGCATGG + Intergenic
961806834 3:129495629-129495651 GTGGGCTCCAAGCTGGAGCTTGG - Intronic
962301316 3:134245611-134245633 TTGGGTTTCCTGCTGGAACTGGG - Intronic
965665294 3:171087398-171087420 TCGGGGTTCCAGCTGGAGAATGG + Exonic
966885886 3:184377996-184378018 ATGGGCTCCCAGCTGGGGGAGGG - Intronic
967091936 3:186142028-186142050 TTGGGTTTCCAGTTTGAGAAGGG + Intronic
967790041 3:193538929-193538951 TTGTGCCCCAAGCTGGAGCACGG + Intronic
968655263 4:1775821-1775843 TGGCCTGCCCAGCTGGAGCATGG - Intergenic
973756054 4:54074522-54074544 TTGAGTTCCCAGATGAAGCTGGG - Intronic
974432443 4:61816725-61816747 TGGGGATGCCAGCTGCAGCAGGG + Intronic
974630370 4:64480392-64480414 GCGGGTTCCCATCTGGTGCAAGG + Intergenic
978871624 4:113584943-113584965 TCTGGTTCCCAGCTTCAGCAGGG - Intronic
979203335 4:118005437-118005459 TTGTGTACCTAGCTGGAACAAGG - Intergenic
982831391 4:160065331-160065353 TTTGGTTCTCAGCTTGAACATGG + Intergenic
982943239 4:161585205-161585227 TGGGTTTCCCAGCTGGAGCATGG + Intronic
985054405 4:186023901-186023923 CTGGGTGCCCAGCTGGGCCAGGG - Intergenic
985553381 5:544321-544343 GTGGGTTCACAGGTGGAGCCTGG + Intergenic
985666690 5:1184735-1184757 TTGGGCCCCCAGCTGGAAGATGG + Intergenic
985875025 5:2587685-2587707 TGTGGTTCCCAGGTGAAGCATGG + Intergenic
987051319 5:14148876-14148898 CTGGGTCCCCAGCTGGAGCAAGG + Intronic
988776111 5:34479354-34479376 CTGGTTGCCCAGCTAGAGCAAGG + Intergenic
991323338 5:65401453-65401475 TTGTGTTCCCAGCAGCAGAAGGG - Intronic
991509489 5:67361021-67361043 TTGGCTTTCCACCTTGAGCAAGG + Intergenic
993860626 5:93132474-93132496 TTGTGTTCCCACATTGAGCAAGG - Intergenic
994252115 5:97548303-97548325 TTGGGTTCCTACCAGCAGCAAGG - Intergenic
996591949 5:125158150-125158172 TTGGGTTCCCAGCTGCCTCCTGG - Intergenic
997083305 5:130766149-130766171 TTGGGGAGGCAGCTGGAGCAAGG + Intergenic
997119173 5:131156634-131156656 TTGGGTTCCCACATGGTGAAAGG + Intergenic
998511692 5:142719058-142719080 ATGGGCTCCCAGATGGAGGAGGG + Intergenic
999368231 5:151036844-151036866 TTGGGAGCCCAGAAGGAGCAGGG - Exonic
999754961 5:154657430-154657452 TTGGGTCTCCAGCTGGAACAAGG - Intergenic
1000320112 5:160127755-160127777 TTGGGTCCCCAGCTTGCACATGG + Intergenic
1002026652 5:176400486-176400508 TTGGGTCCCCAGCTCTGGCAAGG - Intronic
1002168733 5:177363409-177363431 TTCGCTTCCCATCTGGAGCCCGG - Intronic
1002602549 5:180362219-180362241 GGGGGTGCCCAGCTGGAGAAAGG - Intergenic
1005452974 6:25992050-25992072 CGGTGTCCCCAGCTGGAGCAGGG + Intergenic
1007446093 6:41907277-41907299 TTTGGTTCCCAGGTGGAGTATGG - Exonic
1008940480 6:57040719-57040741 GTGGGTTCCCTTCTGGACCAGGG - Intergenic
1009360297 6:62803082-62803104 TTGTGTTCCCAGCCGGATTATGG + Intergenic
1016536841 6:145116508-145116530 TAGAGTTCACAGTTGGAGCAGGG - Intergenic
1017590675 6:155975269-155975291 TGGGATTCCCACCTGGAGAAGGG + Intergenic
1017648696 6:156562279-156562301 TTGGGTTTCCAGTTGGACCAGGG + Intergenic
1021320772 7:19208135-19208157 TTGGAGTCCCATATGGAGCAGGG - Intergenic
1022475251 7:30705783-30705805 AGGGGATCCCAGCTGGCGCAGGG + Intronic
1024887684 7:54163115-54163137 TTGGGTTCCCAGCAGGGGACAGG + Intergenic
1027467240 7:78531047-78531069 TTGAGTTCCCTGAGGGAGCAGGG - Intronic
1032436593 7:131905968-131905990 TTGAGTTCCCTGATGGAGCATGG - Intergenic
1034126377 7:148675358-148675380 GTGGGTTCCCCTCTGGCGCAGGG - Intergenic
1037701023 8:21273899-21273921 ATGGGTTTTCAGCTGGAGGAGGG + Intergenic
1040472115 8:47742466-47742488 TTGGGTGGCCATCTGGAGAATGG - Intergenic
1041142940 8:54842473-54842495 TGGGGTTTCCACCAGGAGCACGG + Intergenic
1042202444 8:66292168-66292190 TTGGCTTGGCAGCTGAAGCATGG + Intergenic
1047235583 8:123039475-123039497 CTGGGTTGCCAGCTGGCACAGGG - Intronic
1048339252 8:133526054-133526076 TGGGGATGCCAGCTGCAGCAGGG - Intronic
1049838151 8:144753751-144753773 TTGATCTCCCAGCTGGAGCAGGG - Exonic
1050489557 9:6173417-6173439 ATGGGTCCCCACCTGCAGCAAGG - Intergenic
1054952205 9:70865245-70865267 TTGGGTTCCCATGTGGACAAAGG + Intronic
1056238579 9:84620650-84620672 ATGGTTTCCCAGCTTGAGCAAGG + Intergenic
1059384428 9:113953180-113953202 TTCGGCTCCCAGGTGGAGCTTGG + Intronic
1061241394 9:129375627-129375649 TTGGGTTCTCAGCTACAGAATGG + Intergenic
1061745134 9:132733966-132733988 CAGGGTGCCCACCTGGAGCAGGG - Intronic
1203521915 Un_GL000213v1:53360-53382 TTGGCTTCTCAGCTGCAGGAGGG + Intergenic
1188479554 X:30623065-30623087 TTTGGTTCCCTGCTGGAGAAGGG - Intergenic
1192008380 X:67241504-67241526 TTGGGTTCCCCTCTGGCTCAGGG - Intergenic
1192725974 X:73752514-73752536 GTGGGTTCCCTTCTGGTGCAGGG + Intergenic
1195479117 X:105322437-105322459 TTGTGTTCCCATCTGGAGCTTGG + Intronic
1196798660 X:119522830-119522852 TTGGTTTCCCAGCTTCAGAATGG - Intergenic
1200052565 X:153442780-153442802 TCGGCTGCCCAGCTGGAGCCTGG + Intergenic
1201955909 Y:19622196-19622218 GTGGGTTCCCCGCTGGCTCAAGG - Intergenic