ID: 1138506317

View in Genome Browser
Species Human (GRCh38)
Location 16:57479990-57480012
Sequence GACCCAGGAAGGGAAGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 513
Summary {0: 1, 1: 1, 2: 1, 3: 53, 4: 457}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138506312_1138506317 -6 Left 1138506312 16:57479973-57479995 CCTACTGTGGAGGTGGGGACCCA 0: 1
1: 1
2: 1
3: 25
4: 297
Right 1138506317 16:57479990-57480012 GACCCAGGAAGGGAAGTGGCAGG 0: 1
1: 1
2: 1
3: 53
4: 457
1138506306_1138506317 16 Left 1138506306 16:57479951-57479973 CCTGGGAGGACTGGCTCTGGCTC 0: 1
1: 0
2: 1
3: 32
4: 265
Right 1138506317 16:57479990-57480012 GACCCAGGAAGGGAAGTGGCAGG 0: 1
1: 1
2: 1
3: 53
4: 457
1138506302_1138506317 22 Left 1138506302 16:57479945-57479967 CCCCTTCCTGGGAGGACTGGCTC 0: 1
1: 0
2: 2
3: 29
4: 250
Right 1138506317 16:57479990-57480012 GACCCAGGAAGGGAAGTGGCAGG 0: 1
1: 1
2: 1
3: 53
4: 457
1138506304_1138506317 20 Left 1138506304 16:57479947-57479969 CCTTCCTGGGAGGACTGGCTCTG 0: 1
1: 1
2: 3
3: 36
4: 266
Right 1138506317 16:57479990-57480012 GACCCAGGAAGGGAAGTGGCAGG 0: 1
1: 1
2: 1
3: 53
4: 457
1138506303_1138506317 21 Left 1138506303 16:57479946-57479968 CCCTTCCTGGGAGGACTGGCTCT 0: 1
1: 0
2: 5
3: 23
4: 228
Right 1138506317 16:57479990-57480012 GACCCAGGAAGGGAAGTGGCAGG 0: 1
1: 1
2: 1
3: 53
4: 457

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138506317 Original CRISPR GACCCAGGAAGGGAAGTGGC AGG Intronic
900266021 1:1757612-1757634 GAGCCAGGCAGGCAAGTGGCCGG - Intronic
900342887 1:2197095-2197117 GACCCAGGCAGGGAAGGAGATGG - Intronic
900792993 1:4691856-4691878 GGCTCAGGAGGGGAAGAGGCAGG - Intronic
901188032 1:7387527-7387549 GACCCTGGCAGGACAGTGGCTGG - Intronic
901458629 1:9378151-9378173 GACCCAGGAGGAGAAGCTGCTGG - Intergenic
901853813 1:12031638-12031660 GATCCAGGAGGGAATGTGGCTGG + Intronic
902161224 1:14531927-14531949 GACCAAGGTAGGGAAGGTGCTGG + Intergenic
902404773 1:16176601-16176623 GACACAGGAAGGGCAGATGCAGG - Intergenic
903003803 1:20285080-20285102 GAGCCAAGAGGGGAAGTGGCAGG + Intergenic
903005948 1:20298930-20298952 GGCACTGGAATGGAAGTGGCCGG + Intronic
903130945 1:21279263-21279285 GACCCAGGTGGAGAAGCGGCTGG - Exonic
903525115 1:23987312-23987334 GTCCCTGGTAGGGAGGTGGCGGG - Intergenic
904207358 1:28863699-28863721 GACCCAGAAAGGGCAGTGGTGGG + Intergenic
904454782 1:30641010-30641032 GGGACAGGAAGGGAAGTGGAGGG + Intergenic
905348870 1:37330700-37330722 GACCCAGAGAGGGAAGTGATGGG - Intergenic
905463301 1:38135091-38135113 GAGGCAGAAAGGGAAGTGGCAGG + Intergenic
905480042 1:38255515-38255537 GACACAGGAAGAGACCTGGCTGG + Intergenic
907893177 1:58656089-58656111 GACCCAGGAAGAGAAATGGGAGG + Exonic
908171669 1:61511273-61511295 GACCTCACAAGGGAAGTGGCTGG - Intergenic
908515018 1:64883602-64883624 TTTCCAGGAAGGGAAGGGGCAGG - Intronic
912158220 1:106948669-106948691 GAACCAAGGAGGGAAGAGGCTGG + Intergenic
912917101 1:113826370-113826392 GACAGAGGAAGGGAAGTGAAGGG + Intronic
915200074 1:154220836-154220858 GACGCAGGAAGGCAAGTGGGCGG + Exonic
915321478 1:155058685-155058707 GACCCAGGGAGAGAAGAGCCTGG - Intronic
915453120 1:156020675-156020697 GACCAAGAAAGGGATGTGACAGG - Intronic
915823970 1:159056246-159056268 CACCCAGGAAGAGGAGGGGCTGG + Intergenic
915926805 1:160028263-160028285 GAGCCAGCAAGGGAGGAGGCAGG - Exonic
916556382 1:165897451-165897473 GACCCAGCAAGGGCAGTGGGTGG + Intronic
916564926 1:165966669-165966691 GACCCAGGGAGGGAAGAGCTTGG - Intergenic
917459761 1:175219896-175219918 GACCTAGAAAGGGGAGGGGCAGG - Intergenic
918355391 1:183703025-183703047 GAAGCAGGAAGAGAACTGGCCGG - Intronic
919967490 1:202542631-202542653 GGCCAAGGGAGGGAATTGGCAGG + Intronic
920181497 1:204134691-204134713 GACCCTGGAAGAGATGTGGTGGG + Intronic
920378451 1:205522068-205522090 AAACCATGAAGGGAAGTGGAGGG + Intronic
920675314 1:208034216-208034238 GAACCAGGAAGGCACCTGGCTGG - Intronic
921054187 1:211531776-211531798 CACCCAGTCAGGGAAGAGGCTGG + Intergenic
921246324 1:213245525-213245547 TTCCCAGGAGGTGAAGTGGCAGG - Intronic
922339444 1:224643780-224643802 TACCCAGGAAGAGGAGGGGCCGG + Intronic
923003854 1:230029414-230029436 CACACAGGAAGGGGAGGGGCCGG + Intergenic
923061318 1:230476879-230476901 CACCCAGGAAGAGAAGGGGTCGG - Intergenic
923229997 1:231976607-231976629 ATCCCAGGAAAGTAAGTGGCTGG - Intronic
923349252 1:233087617-233087639 GTACCAGGAAAGGAAGTGACAGG - Intronic
923400686 1:233613729-233613751 GACCCAGGAAGGGAGGGAGCGGG + Intergenic
923677839 1:236095737-236095759 AACCCACTAAGGGAAGTGGCTGG - Intergenic
924083157 1:240420468-240420490 GACCCAGCTAGGGAAGTGCTAGG - Intronic
1063462028 10:6221181-6221203 GCACTAGGAAGGGAAGGGGCAGG + Intronic
1064147202 10:12834949-12834971 GCCCCGGGAAGGAGAGTGGCAGG - Exonic
1064271340 10:13869271-13869293 GACCCAGGCAGGTAAGAGGCTGG + Intronic
1064297345 10:14090324-14090346 GAAACAGGAAGAGAAGTGGGAGG + Intronic
1064334155 10:14423329-14423351 CACCCAGGAAGAGGAGGGGCTGG - Intronic
1064580698 10:16790109-16790131 GAGCCAGGAAGGGAATCAGCAGG + Intronic
1065202870 10:23331145-23331167 GAACCAGGAAGGGAAGGGAAGGG + Intronic
1066060641 10:31720895-31720917 CACCCAGGAGGAGAAGAGGCTGG + Intergenic
1068800217 10:61132100-61132122 GACCCAGGAATGGAAGTTTTGGG + Intergenic
1069944227 10:71974849-71974871 GACCCAGGCAGGGAAGGGAGTGG - Intronic
1069973973 10:72198073-72198095 GAACGAGGAAGGGAAGGGGAGGG + Intronic
1069979336 10:72241421-72241443 GATCCAGGAAAGCAACTGGCAGG + Intergenic
1070148716 10:73792505-73792527 GGCTCAGGAAGGAAAGTGGAAGG - Exonic
1070556560 10:77532382-77532404 AAGCCAGGAAGGGAAGAGGTTGG + Intronic
1070713340 10:78699603-78699625 GCCCCAGAGAGGGAGGTGGCTGG + Intergenic
1073462912 10:103676839-103676861 ACCCCAGGGAGGGAGGTGGCTGG - Intronic
1074762205 10:116675415-116675437 TCCCCTGGAAGGGAAGAGGCAGG + Exonic
1075580179 10:123611651-123611673 GACCCAGGAAAGGCTCTGGCTGG + Intergenic
1076193398 10:128498530-128498552 GACCCAGCAAAGGGAGTGGAAGG + Intergenic
1076537817 10:131193954-131193976 AACCCCAGAAGGGGAGTGGCTGG + Intronic
1076548469 10:131261734-131261756 CTCCCAGGTAGGGAAGAGGCAGG + Intronic
1076778684 10:132711857-132711879 GACCCAGAGAGGGAGGAGGCTGG + Intronic
1077021717 11:419993-420015 AACCCAGGAGGTGGAGTGGCTGG - Intronic
1077508391 11:2942738-2942760 GTCACAGGAAGGGCAGGGGCTGG + Intergenic
1078066744 11:8083618-8083640 GGCCCAGGAAAGGAATTGGAGGG - Intronic
1080588325 11:33700491-33700513 GACCCAGGCCGGGTGGTGGCGGG + Exonic
1080747739 11:35123823-35123845 AACTCAGGAAGGGATGTGGAAGG + Intergenic
1080844412 11:36014422-36014444 GCCCAAGGAATGGAAGCGGCTGG + Intronic
1081390624 11:42524680-42524702 GACCCAGGAGGGGAACTGCTGGG + Intergenic
1081646689 11:44795212-44795234 GTCCCAGGAAGAGAAGCAGCTGG - Intronic
1081989081 11:47327982-47328004 CACCCAGGGAGGGAGGTGACAGG - Intronic
1082870073 11:57936253-57936275 GGCACAGGAAGGGAAGTGCCTGG - Intergenic
1083587744 11:63872792-63872814 AAACCAGGGAGGGAAGCGGCGGG - Intronic
1083716127 11:64578045-64578067 GACCTGGGAAGGGAAGGGCCTGG - Intergenic
1083889631 11:65589470-65589492 GCCCCAGGAGGGGAATTGGGAGG + Intronic
1083904197 11:65659628-65659650 GACGCAGGAAGGGGAGAGGGTGG - Intronic
1083990473 11:66243292-66243314 GTGCCAGGAGGGAAAGTGGCTGG - Exonic
1084273400 11:68040455-68040477 GACCCAGGGGAGGAAGTGACTGG + Intronic
1084318359 11:68358906-68358928 GGCCCAGGCAGGGATGTGGCAGG + Intronic
1084478194 11:69400792-69400814 GCCACAGGAAGGGAAGGGTCAGG - Intergenic
1084499169 11:69524817-69524839 GACCGAGAAAGGAAAGTGACCGG + Intergenic
1084685774 11:70694279-70694301 ATCCCAGGGAGGGAATTGGCTGG + Intronic
1085122339 11:73975160-73975182 GGCCCAGTGAGGGAAGTGGGAGG - Intronic
1085234729 11:75005744-75005766 GAACCAGGAAGGGATGTAGTAGG - Exonic
1085253679 11:75159995-75160017 TACCCAGGAAGCTAAGTGGAGGG + Intronic
1085305186 11:75481780-75481802 TCCCCAGGAAGGGAGGAGGCGGG + Intronic
1086180840 11:83949796-83949818 GAGGCAGGAAGGTAAGTGGAAGG - Intronic
1086634541 11:89065628-89065650 GACCCAGGAGGGCAAGTGGTGGG - Intronic
1087472445 11:98593844-98593866 GACCCATGGAGGTAAGAGGCAGG - Intergenic
1087644437 11:100791270-100791292 GGGCCAGGCAGGGAAGTGACTGG + Intronic
1088543576 11:110937748-110937770 GACCCAGTGTGGGAAGAGGCTGG - Intergenic
1088696480 11:112370494-112370516 GACACAGGAAGGAAAGTGATGGG + Intergenic
1089609286 11:119660561-119660583 GCCACAGGAGGGGACGTGGCAGG + Intronic
1091006764 11:131960724-131960746 GACCCTGGAAGGGAACAGGATGG - Intronic
1091286917 11:134412740-134412762 CACCCCGGATGGGAGGTGGCCGG + Intergenic
1092002438 12:5043795-5043817 GACCCGGGAGGGGAAGCGGGAGG + Intergenic
1092791983 12:12078318-12078340 AACCGAGGAAGGGAAGGGTCAGG + Intronic
1093466678 12:19456618-19456640 GACCCACCAATGGAAGCGGCTGG - Intronic
1095557079 12:43520429-43520451 CAACCAAGAAGGGAAGTGGGAGG + Intronic
1096078341 12:48818451-48818473 GATCCAGGCAGGGAGGAGGCGGG - Intronic
1096517563 12:52165562-52165584 GCCCAAGGGAGGGAAGTGGAAGG - Intergenic
1096518914 12:52173306-52173328 CACCCAGAAAGGGAGGTGGAAGG - Intronic
1096675709 12:53224727-53224749 GGCCTGGGCAGGGAAGTGGCAGG - Intronic
1097194209 12:57234970-57234992 GAGCAAGGGAGGGGAGTGGCAGG + Exonic
1098024750 12:66189563-66189585 AACCCAGGAAAGGAGGGGGCCGG - Intronic
1098127475 12:67314958-67314980 GATACTGGAATGGAAGTGGCAGG + Exonic
1098610792 12:72454961-72454983 GATCCATGAAGAGAAATGGCAGG - Intronic
1099018882 12:77378997-77379019 GACTCAGGAAGTTAAGTGACTGG + Intergenic
1099973363 12:89523546-89523568 GACACAGGAATGGAAGTGTGGGG - Exonic
1100178339 12:92056520-92056542 GACCCTGGAAGGGCAGAGACAGG - Intronic
1100283992 12:93146774-93146796 AACCCAGGATGTGAAGGGGCAGG - Intergenic
1100947303 12:99800304-99800326 CACTCAGGAATGGAATTGGCCGG + Intronic
1101432457 12:104637900-104637922 GACACAGAAAGAGAAGTGCCGGG - Intronic
1101834315 12:108284638-108284660 TACCCAGGACAGGTAGTGGCAGG - Intergenic
1102430044 12:112875970-112875992 CAGCCAGGAAGTGAAGGGGCAGG - Intronic
1102759225 12:115370955-115370977 GGCCGAGGAAGGGAATTGCCGGG - Intergenic
1103351137 12:120284548-120284570 GACTCATGAAGGGGAGTGTCAGG + Intergenic
1103736577 12:123064580-123064602 CAGCCTGGCAGGGAAGTGGCGGG - Intronic
1103737770 12:123071252-123071274 GACCCAGAAAGAGCAGGGGCTGG - Intronic
1103779154 12:123388213-123388235 TAACCAGGAAGGGTAGTGGCTGG + Intronic
1104354828 12:128076066-128076088 GCACCTGGAAGGGAAGTGCCAGG + Intergenic
1104709984 12:130978967-130978989 GCCCAAGGCAGGGAAGTGGCGGG + Intronic
1104891512 12:132142472-132142494 GTCACAGGCAGGGAAGCGGCAGG - Intronic
1105402283 13:20106112-20106134 TACCCAAAAAGGGCAGTGGCGGG - Intergenic
1105882452 13:24616226-24616248 GACCAAGGATGGGAAGCAGCTGG + Intergenic
1106246269 13:27953384-27953406 GAACAGGGAAGGGAACTGGCAGG + Intergenic
1106400821 13:29428577-29428599 GAGCCAGGAAGGGAGGGGACAGG - Intronic
1107616582 13:42174371-42174393 GTCCCAGGAAGAGGAGTGACTGG - Intronic
1107901081 13:45014709-45014731 GACACAGGAAGAGAGGTGGGAGG + Intronic
1107958930 13:45542349-45542371 CACCCAGGAAGTGGAGAGGCTGG + Intronic
1108020174 13:46120225-46120247 AAACCAGGAAGGGAGTTGGCAGG + Intergenic
1108356564 13:49633734-49633756 GAACCAGGATGGGACGGGGCTGG + Exonic
1108470562 13:50762874-50762896 CATCCAGGAAGGGATGTTGCAGG + Intronic
1112548821 13:100400302-100400324 GATCCTGGAAAGGAACTGGCAGG - Intronic
1113956307 13:114101442-114101464 GGCCCAGCACGGGCAGTGGCTGG - Intronic
1115329069 14:32174521-32174543 GACCCAGAACTGTAAGTGGCTGG - Intergenic
1117252996 14:53953963-53953985 GACCCTGGGGAGGAAGTGGCGGG - Intronic
1117442896 14:55776865-55776887 GACCCAGTAAGAGAAGATGCAGG + Intergenic
1118589356 14:67389930-67389952 GGGCCAGGGAGGGATGTGGCAGG - Intronic
1118623306 14:67633901-67633923 GACCCAGGAAGAGAAGGGTCAGG - Intronic
1119434277 14:74587598-74587620 GACCCAGGAAGGCCAGGGTCTGG + Intronic
1119765955 14:77187717-77187739 GACAGAGGAAGGGAAGTGAGTGG + Intronic
1120070905 14:80100942-80100964 AACCCAGGAGGGGAAGAGGAAGG + Intergenic
1120991500 14:90381642-90381664 CACCCAGCAAGCAAAGTGGCCGG + Intergenic
1121014359 14:90539336-90539358 GGACCAGGAAGGGAGGAGGCTGG - Exonic
1121037389 14:90717774-90717796 AACCCGGGAAGGGAAAAGGCAGG + Intronic
1121433996 14:93906804-93906826 GGCACAGGGAGGGAAGGGGCAGG + Intergenic
1121536569 14:94695216-94695238 GGCCCAGGCAGGGAAGAGGGGGG - Intergenic
1121545238 14:94758388-94758410 GCCCCAGGGAGGGACTTGGCTGG - Intergenic
1121616381 14:95316455-95316477 GACACAGGAAGGTGAGTGGCAGG + Intronic
1122228500 14:100293192-100293214 GAGCCAGGAAGGAAGGTGTCAGG - Intronic
1122320012 14:100849541-100849563 GAGGCAGGAAGAGAAGTGTCAGG + Intergenic
1122541072 14:102497861-102497883 GTCCCAGGGAGGGAAGGGGCTGG + Intronic
1122551846 14:102554770-102554792 GTCCCAGAGAGGGAAGGGGCTGG - Intergenic
1123780425 15:23621369-23621391 GACTCTGGAAGGGAAGGGGAGGG + Intronic
1124259602 15:28176675-28176697 GACCGATGAAGGTGAGTGGCTGG - Exonic
1125976051 15:43952800-43952822 CACCCAGGAAGGGAAGTGAATGG + Intronic
1126503583 15:49377027-49377049 GAGGCTGGAAGGGTAGTGGCAGG - Intronic
1126580418 15:50237657-50237679 AACCCAGGAAGGGAGGCAGCTGG - Intergenic
1126809875 15:52391073-52391095 GACCCAGGAATGGAACTGCTGGG - Intronic
1127439070 15:58988034-58988056 GACCCTGGAAGAGAAGAGGGTGG + Exonic
1127464351 15:59229178-59229200 GACCCAGGAAGGGCAGGTGTTGG + Intronic
1127804833 15:62509789-62509811 GTTCCAGGCAGGGAAGTGGGAGG - Intronic
1127885487 15:63195982-63196004 GACCCAGAATGGGAAGCAGCAGG + Intronic
1128566695 15:68705484-68705506 GACCCAGGGAGGGAAGTGGCTGG + Intronic
1128760529 15:70213536-70213558 GAACCAAGATGGGATGTGGCCGG - Intergenic
1129112605 15:73346534-73346556 GACCCAGGAAAGCCAGTAGCAGG + Intronic
1129744517 15:78008533-78008555 GCCCCAGGAAGGGAGGAGGATGG - Intronic
1129878688 15:78993515-78993537 GACACAGAAAGGAGAGTGGCAGG + Intronic
1130096068 15:80857173-80857195 AACCCAGGAAGGGCAGAGACAGG - Intronic
1131289980 15:91099253-91099275 GCCCCAGCCAGGGAAGAGGCAGG + Intergenic
1132338243 15:101062524-101062546 GACCCAGGCTGGAAAGTGTCTGG - Intronic
1132750865 16:1457048-1457070 GACCCAAGGAGGGAAGCAGCGGG + Intronic
1132807802 16:1783086-1783108 GCCCCGGGAAGGGACGCGGCGGG - Intronic
1135014231 16:18910606-18910628 GACCAAGGCAGGGAGGTGGGTGG - Intronic
1135069272 16:19338077-19338099 CACCCAGGAAGGTATTTGGCAGG - Intergenic
1135307389 16:21378782-21378804 CATCCAGCTAGGGAAGTGGCTGG - Intergenic
1135493663 16:22932527-22932549 GACTCAGGGAGGGAAGTTGGAGG - Intergenic
1135553337 16:23415174-23415196 GTCCCAGGAAGGAGAGGGGCTGG + Intronic
1135815390 16:25627916-25627938 GACCATGGAAGGTAAGGGGCCGG - Intergenic
1136112745 16:28075070-28075092 GACCTAGGAAGGGGCTTGGCTGG + Intergenic
1136227086 16:28866483-28866505 GACTGAGGAAGGGAGGGGGCCGG - Exonic
1136331401 16:29579905-29579927 GACCAAGGCAGGGAGGTGGGTGG - Intergenic
1136549353 16:30974378-30974400 GACCCAGGTAGGCGAGTGGGGGG + Intronic
1137410110 16:48221172-48221194 GACACAGGAAGAGATGAGGCTGG + Intronic
1137546488 16:49408087-49408109 GGCGCAGGAAGGGAAGGGGAAGG - Intergenic
1137716587 16:50601927-50601949 GACCCAGGGATGGGAGAGGCTGG - Intronic
1138105392 16:54284953-54284975 GACTCAGGACCGGTAGTGGCCGG + Exonic
1138215618 16:55202505-55202527 GCCACAGGAGGGGAATTGGCAGG + Intergenic
1138270259 16:55691047-55691069 TGCCTAGGAAGGGATGTGGCTGG - Intronic
1138506317 16:57479990-57480012 GACCCAGGAAGGGAAGTGGCAGG + Intronic
1139672150 16:68499213-68499235 GACCTATGAAGGGAAGTCTCTGG - Intergenic
1139754842 16:69133881-69133903 GACACAGGAAGGGAAATTGTTGG + Intronic
1139926888 16:70493640-70493662 GACACGTGCAGGGAAGTGGCAGG + Intronic
1141951039 16:87339561-87339583 GTCCCAGGTAGGGCAGAGGCTGG - Intronic
1142133431 16:88441199-88441221 GACCCAGGGAGCGATGGGGCTGG + Intergenic
1142417931 16:89953308-89953330 GGCCCAGGAAGTTAAGTGGGAGG + Intronic
1143369910 17:6432981-6433003 GGACAAGGAAGGGAAGTGGGTGG + Intronic
1144084563 17:11797359-11797381 GACTGAGGATGGGAAGTGGGAGG - Intronic
1145004971 17:19332606-19332628 CACACAGGAAGGGAAGAGGAGGG - Intronic
1146060100 17:29600440-29600462 GACCCAGGTAGGGAAGGGGCTGG + Intronic
1147155280 17:38541631-38541653 GGCACAGGAAGGGAAGAGGCAGG + Intronic
1147261181 17:39210491-39210513 GACAGAGGAAGGAAAGGGGCAGG - Intergenic
1148113477 17:45161212-45161234 GACCCCAGAAGGGGAGAGGCTGG - Intronic
1148162900 17:45461755-45461777 GAACAACGAAGGGAAGGGGCAGG - Intronic
1148452717 17:47790328-47790350 GCCCCAGGGTGGGATGTGGCCGG - Intergenic
1148453955 17:47800963-47800985 GCCCCAGGATGGGATGTGGCCGG - Intergenic
1149292338 17:55229545-55229567 AACCCAGAAGGGGAAGAGGCTGG - Intergenic
1149314390 17:55424811-55424833 GAACAAGGAAGAGAAGTGGTTGG + Intergenic
1149652491 17:58284747-58284769 CCCCCAGGAAGGGGACTGGCGGG - Intergenic
1150325334 17:64252264-64252286 AACCCAGGAAGGGAAATGGGGGG - Intronic
1150394130 17:64808409-64808431 GAACAACGAAGGGAAGGGGCAGG - Intergenic
1151167051 17:72213088-72213110 AAGCCAGGAAGGGTAGTGGGTGG - Intergenic
1151355458 17:73555473-73555495 GGCCCAGGAAAGGAAGGGGCTGG + Intronic
1151439162 17:74117028-74117050 CACCCAGGAAGAGGAGTGGGAGG + Intergenic
1151571461 17:74927965-74927987 GACCCCAGAAGGGAAGTATCAGG + Intronic
1151748594 17:76024433-76024455 GGCTCGGGGAGGGAAGTGGCAGG - Intronic
1152299552 17:79487079-79487101 GACCGAGGGAGGGAAGAGGAGGG + Intronic
1152300622 17:79493478-79493500 CAGCCAGGCAGGGAGGTGGCAGG - Intronic
1152420038 17:80187740-80187762 CACCCAGGACGGGAAGAGGGCGG + Intronic
1152426369 17:80220636-80220658 GACCCGGGTAGGGACGCGGCGGG - Intronic
1152494457 17:80661132-80661154 GGACCAGGATTGGAAGTGGCAGG + Intronic
1152760909 17:82106580-82106602 GGCCCCGGAAGGAAAGTGACAGG + Intronic
1152913201 17:83017180-83017202 AGGCCAGGAAGGGCAGTGGCGGG + Intronic
1153070952 18:1103794-1103816 GACACAGGCAGGAAAGTGGCAGG - Intergenic
1155286448 18:24293698-24293720 GAGCCAGAAAGGGAACTGGGAGG + Intronic
1157626292 18:49053936-49053958 GACCCAGGATGGGAGGTGGGTGG + Intronic
1157898587 18:51491801-51491823 GCCCTAGGAAGGCAAGTTGCTGG + Intergenic
1160363142 18:78301281-78301303 GACCCTGGAAGAGAAGTTACAGG + Intergenic
1160849002 19:1180708-1180730 GAGGCAGGAGGGGAAGGGGCGGG - Intronic
1161219906 19:3113723-3113745 GACCCAGGGAGGGCAGCGGCAGG - Intronic
1161426907 19:4208701-4208723 GGCCCAGGAAGGGCATTGGTGGG - Intronic
1162524087 19:11197495-11197517 GACCCAGGGAAGGCAGCGGCCGG - Exonic
1162600630 19:11665600-11665622 GCCCCAGTAAGGGGAGTGGAGGG - Intergenic
1162870046 19:13579599-13579621 GACCCAGGAAGGGACTTGGGTGG + Intronic
1162935938 19:13981634-13981656 GTCCCACGAGAGGAAGTGGCTGG + Intronic
1162937058 19:13986553-13986575 AAGCCAGGAGGGGAAGTGGGGGG + Intronic
1163122614 19:15227126-15227148 GCCCCAGGAAGGGAGGAGGTGGG + Exonic
1163295046 19:16406361-16406383 GTGCCAGGAAGGGAAGATGCTGG + Intronic
1163364071 19:16866379-16866401 GGCCAAGGAAGAGGAGTGGCGGG + Exonic
1164559247 19:29277308-29277330 AGCCCAGGAAAGGAAGTGGTCGG + Intergenic
1164595211 19:29527457-29527479 AACCCAGGGAGGGAAGCAGCGGG + Intronic
1165100677 19:33436756-33436778 GGGCCAGGAAGGGAATTGGTTGG + Intronic
1165275439 19:34747067-34747089 AACACAGGAAGGGAGGGGGCTGG + Intergenic
1165724889 19:38105878-38105900 GTCCAAGGAAAGGAAGTGCCAGG + Intronic
1165859191 19:38898387-38898409 GACCCAGGCAGGGAAGGTGCAGG - Exonic
1165899702 19:39163347-39163369 GCCCCTGGAAGGGAGGGGGCTGG - Intronic
1165921114 19:39298303-39298325 GACCCAGGAAGAGAAGGACCAGG + Intronic
1166407162 19:42529287-42529309 GACCCAGGAAGGGACAGAGCAGG + Intronic
1166407897 19:42535119-42535141 AAACTAGGAAGGGTAGTGGCGGG - Intronic
1167052136 19:47085735-47085757 GACCCAGGAGGAGGAGCGGCAGG - Intronic
1167791731 19:51687807-51687829 GGCCCAGGAACGGATGGGGCAGG - Intergenic
1167894532 19:52570375-52570397 GTCCCAGGTACGGAAGTGCCGGG - Intronic
1167984016 19:53299825-53299847 GACCCACCAAGGGACATGGCGGG - Intergenic
1168243398 19:55098272-55098294 GGCCCGGAAAGGAAAGTGGCTGG + Intronic
1168283702 19:55320220-55320242 GACCCAGGGAGGGAAGTGAGGGG + Intronic
925008828 2:467248-467270 GTCCCAGGAAGAGAAGAAGCTGG - Intergenic
926092760 2:10061315-10061337 GAAACAGGAAGGGCAGTGGCCGG - Intronic
926830222 2:16953974-16953996 TTCCCAGGAAGAGTAGTGGCAGG - Intergenic
926982807 2:18589529-18589551 GACTGAGCAAGGGAAGTGACAGG - Exonic
927088620 2:19693814-19693836 GAGCCAGGAACGTAGGTGGCTGG + Intergenic
927256647 2:21045214-21045236 CACCCAGGAAGGCGAGTGGGAGG + Intergenic
927268538 2:21180871-21180893 GCCCCAGGTAGGGTAGTGCCAGG + Intergenic
928217441 2:29373723-29373745 GAACCAGGAAGGAAATTCGCTGG - Intronic
929418648 2:41768904-41768926 GCACCGGGAAGGAAAGTGGCTGG - Intergenic
929446537 2:42006110-42006132 GGCCCAGGAGGGGACATGGCAGG - Intergenic
929534230 2:42770451-42770473 GCCCCAGGAAAGCAAGAGGCAGG + Intronic
930308948 2:49713965-49713987 GACGGGGGAAGGGAAGTGGTAGG + Intergenic
930750367 2:54928559-54928581 GGCCCAGGAAGGGAGGTGTTGGG - Intronic
931251054 2:60530821-60530843 GACTCAGGAGGGGTAGTGGGAGG - Intronic
932236260 2:70123556-70123578 GAACCAGGCAGGGAAAGGGCAGG + Intergenic
932621221 2:73265786-73265808 GACCCAGGGAGGGTAGGGGCAGG + Intronic
934530215 2:95081379-95081401 TACCTAGGAAGGGAATTGTCAGG + Intergenic
935751638 2:106240195-106240217 AACCTAGGAAGGGAAGTGGGTGG + Intergenic
935912057 2:107907743-107907765 AACCTAGGAAGGGAAGTGGGTGG + Intergenic
937498515 2:122451004-122451026 AGCCCAGGAATGGAAGTGGGGGG + Intergenic
938125107 2:128665462-128665484 GACCCAGGAAGGGCAGGGACAGG - Intergenic
938238854 2:129727538-129727560 GGCCCAGGATGAGAAGGGGCAGG - Intergenic
938573304 2:132582232-132582254 GACACATGCAGGGAAGAGGCTGG + Intronic
938618315 2:133022430-133022452 CACCTAGGAAGGGAAGGTGCAGG + Intronic
940064009 2:149606666-149606688 TACCCAGGAAGTGAGGTTGCTGG + Intergenic
940285270 2:152027481-152027503 GAGTCAGGAGGGGAGGTGGCAGG - Intronic
941913776 2:170793951-170793973 GACCCAGGAAGAGAAGAGAGAGG - Intronic
944090489 2:195904434-195904456 GACAGAGGCAGGGAAATGGCAGG + Intronic
944828746 2:203511640-203511662 AACCCTGGAAGGGAAGAGGAAGG - Intronic
945943761 2:215974552-215974574 GACCAACCAAGGGAAGAGGCAGG + Intronic
946961377 2:224989157-224989179 AGCCCAGGAAGGAAAGTGGCTGG - Intronic
948499723 2:238383019-238383041 GAGACAGGCAGGGAGGTGGCTGG - Intronic
948858148 2:240740208-240740230 GACACAGGCAGGGTAGGGGCAGG + Intronic
948993139 2:241564666-241564688 GACCCAGGCAGGCACGGGGCAGG + Intronic
949048719 2:241885398-241885420 GCCCCAGGTGGGGAGGTGGCAGG + Intergenic
949063632 2:241975680-241975702 GACACAGGAAGGGAGGTTCCTGG + Intergenic
1168754239 20:305089-305111 GATACAGGAAGGGAAGTGCTGGG + Intergenic
1168761748 20:354342-354364 GAACCAGGAAGGTGAGGGGCTGG - Exonic
1169831323 20:9828547-9828569 GACCCAGGAAGTGAACTTTCTGG - Intronic
1170596725 20:17811181-17811203 GTCACAGGGAGGGAAGAGGCAGG + Intergenic
1170693519 20:18636768-18636790 GTCCCAAGAAGTGAAGAGGCTGG + Intronic
1172486786 20:35303346-35303368 GACGGAGAAAGGGAAGAGGCTGG - Exonic
1173396955 20:42688963-42688985 GATACAGGCTGGGAAGTGGCAGG + Intronic
1173816864 20:45995158-45995180 GTCTCAGTAAGGGAAGTGGTGGG + Intergenic
1174392481 20:50226541-50226563 GACCCAGGAAGGAGCTTGGCAGG - Intergenic
1174407175 20:50310079-50310101 GACCCCGGATGGGAAGAAGCTGG - Intergenic
1174671375 20:52310992-52311014 GACCCAGGAGGGAAAGAGGATGG + Intergenic
1175069945 20:56324743-56324765 GACCCAGGGAAGCAAGTGGTAGG + Intergenic
1175254040 20:57628135-57628157 GGGGCAGGAAGGGAAGTGGGGGG + Intergenic
1175939473 20:62531392-62531414 CTCCCAGGAAGGGGGGTGGCGGG - Intergenic
1175945376 20:62556070-62556092 GCCACAGGGAGGGAAGTAGCCGG + Intronic
1176048795 20:63105825-63105847 GAGTCAGGAGGGGATGTGGCAGG + Intergenic
1176088909 20:63310335-63310357 GAGCCAGGAAGGGGGGTGCCGGG - Intronic
1176195708 20:63835685-63835707 GGCTCAGGAAGGGAGGGGGCTGG - Intergenic
1176368145 21:6045926-6045948 GGCACAGCAAGGGAGGTGGCTGG - Intergenic
1178275587 21:31233892-31233914 GCCTGAGGAAGGGCAGTGGCAGG + Intronic
1178346782 21:31835637-31835659 GACCCCAGGTGGGAAGTGGCTGG + Intergenic
1178524165 21:33311590-33311612 GCCTCAGGAAGGGGAGAGGCAGG - Intergenic
1179435954 21:41362266-41362288 GGCTCTGGAGGGGAAGTGGCTGG + Intronic
1179755374 21:43492616-43492638 GGCACAGCAAGGGAGGTGGCTGG + Intergenic
1180152726 21:45959978-45960000 CACCCTGGAAGGGCAGGGGCTGG - Intergenic
1180710903 22:17838880-17838902 GACACAGGACGGGAAGTGCGTGG - Intronic
1180885630 22:19241206-19241228 GCCCCAAGAAGAGAAGGGGCTGG - Intronic
1181493787 22:23276680-23276702 GCCCCAGGAATGGCAGGGGCAGG - Intronic
1182034015 22:27183490-27183512 AGCCCAGGAAGGGATGTGGCAGG - Intergenic
1182299509 22:29329835-29329857 GACCCAGGAGGGGCAGTGTCTGG + Intronic
1182865118 22:33597730-33597752 AGCTCAGGAAGGGAAGCGGCAGG - Intronic
1183035324 22:35136791-35136813 AACCCAGGTAGGGAGGAGGCGGG - Intergenic
1183505687 22:38207639-38207661 CACCCAGGGAGTGCAGTGGCGGG + Intronic
1184029501 22:41883654-41883676 GACACAGGAAGGGAGGTGAGAGG - Intronic
1184175415 22:42786153-42786175 GCCCCAGGAAGGGTGGAGGCAGG - Intergenic
1185034192 22:48462787-48462809 TACCCAGGAAGGGAACTGCATGG + Intergenic
1185185597 22:49397911-49397933 GACGAAGAAAGGAAAGTGGCTGG + Intergenic
949592378 3:5507954-5507976 GACTCAGGAAGGGAAGAGGATGG + Intergenic
949702206 3:6771844-6771866 GACCCAGAAAAGGAAGTGACTGG + Intronic
950442581 3:13018642-13018664 GACGCAGGGAGGGGAGGGGCGGG + Intronic
951954732 3:28241728-28241750 CACGCAGGAAGGGGAGTGGAGGG - Exonic
952899772 3:38102324-38102346 CACCCAGCAGGGGAAGGGGCGGG - Intronic
953963255 3:47282788-47282810 GAACCAGGAAGCGGAGTGGCGGG + Exonic
954391721 3:50271106-50271128 GACCCAGGAAGGATAGAGGATGG + Exonic
954785446 3:53089179-53089201 GAATCAGGTTGGGAAGTGGCTGG + Exonic
957037810 3:75311284-75311306 GAACAAGTAAGGGAAGTGGGTGG + Intergenic
957549843 3:81689840-81689862 CACCCAGGAAGAGGAGGGGCCGG - Intronic
959238296 3:103753762-103753784 AAACTAGGAAGGGAAATGGCAGG + Intergenic
959683163 3:109118554-109118576 GACACAGGAAGGTAAGTGCTAGG - Intergenic
960173004 3:114485066-114485088 GACCCAGGAGGGGCAGAGTCAGG - Intronic
961109781 3:124274133-124274155 CACCCAGGAAGGGGTGTGTCGGG - Intronic
961351460 3:126307237-126307259 GACCCAGGAAGGGTGCTGGGTGG - Intergenic
961426362 3:126851639-126851661 GACCCATGGAGGGTAGAGGCGGG + Intronic
961643359 3:128379072-128379094 GATCCACAAAGGGCAGTGGCGGG - Intronic
962490146 3:135885663-135885685 GGCCCAGGGAAGGAGGTGGCTGG - Intergenic
962658668 3:137577336-137577358 TACCTAGGAATGGAAGTTGCTGG + Intergenic
962806582 3:138931695-138931717 GACCCTGGAAAAGAAGGGGCTGG + Intergenic
962909560 3:139835735-139835757 GCCCCAGGAAAGGAGGTGGCAGG + Intergenic
963425706 3:145120133-145120155 GATCCAGGAAGGGTAGTCGTGGG - Intergenic
963425848 3:145122063-145122085 AACCCAGGAAAGAAAGTGGAAGG + Intergenic
963562538 3:146883949-146883971 GACCCAGCAAAGGAAGTGACTGG + Intergenic
963906933 3:150780368-150780390 GAACCAGGATGGGGAGAGGCTGG - Intergenic
965318530 3:167222404-167222426 AAGCCAGGAAGGGTAGTGGAGGG + Intergenic
965515744 3:169619422-169619444 CACCCAGGAGGGGAAGGGCCAGG - Intronic
965740419 3:171868247-171868269 GACCCTGAAAAGGAAGTGGATGG - Intronic
966799618 3:183750441-183750463 TACCCAGAAATGGAATTGGCTGG + Intronic
968517500 4:1021100-1021122 GACCCAGGCAGGGAATGGGGTGG + Intronic
968783252 4:2599248-2599270 GACAGAGGAAGGAAAGTGGAAGG - Intronic
968983877 4:3865140-3865162 GGCCCAGGCAGGGAGGTGGGAGG - Intergenic
969240365 4:5893087-5893109 GGCCCAGGGAGGGGAGGGGCGGG + Intergenic
969242680 4:5911203-5911225 GGCACAGAAAGGGAAGAGGCCGG - Intronic
969538530 4:7771273-7771295 GACTCAGGAAGTGAGGTGGGAGG + Intronic
969701949 4:8772606-8772628 GGCCCGAGGAGGGAAGTGGCAGG - Intergenic
969720204 4:8889280-8889302 GGCGCAGGGAGGGAAATGGCAGG + Intergenic
970444313 4:16111127-16111149 GACTCAAGAAGGAAGGTGGCTGG - Intergenic
974069544 4:57110932-57110954 GTTCCAGAAAGGGAAGTGGTTGG - Intergenic
974165427 4:58195592-58195614 CACCCAGGAAGAGGAGGGGCTGG - Intergenic
976528917 4:86127643-86127665 GGGCCAGGCAGGGAAGTTGCAGG - Intronic
977278191 4:95005560-95005582 TAACCAGGAAGGGAAGTGGGAGG - Intronic
978828196 4:113049802-113049824 GACCCAAGAAGGTAAATCGCCGG + Exonic
979394832 4:120174974-120174996 GACACAGGAAGGGAGGAGGGTGG - Intergenic
980716996 4:136639901-136639923 GAAGCAGGAAGGGAAGTGCTGGG + Intergenic
982077277 4:151750255-151750277 GACCTAGGAAGGGGTGGGGCGGG - Intronic
982275774 4:153635931-153635953 GTCCCAGGAAGGTCAGTGGGTGG + Intronic
983516279 4:168660210-168660232 CACCCAAGAATGGAAGTGACTGG + Intronic
983827219 4:172278426-172278448 GTCCCAGTAAGGAAAATGGCAGG - Intronic
984606953 4:181796584-181796606 GCCCCAGGAAGGGGAGGGGTGGG + Intergenic
984632356 4:182074302-182074324 GTCCCAGGCAGGGTAGTGGGAGG + Intergenic
985198398 4:187458594-187458616 GACTCAGGAAGTGAGGTGGGAGG - Intergenic
985273952 4:188219539-188219561 AAGCCAGGAAGGGAAGTGCTGGG - Intergenic
985429800 4:189868184-189868206 TTCCCTGTAAGGGAAGTGGCTGG + Intergenic
985485438 5:146021-146043 GACCATGGAAGGGGAGTGGAAGG - Intronic
985543903 5:499825-499847 GACCCTGGACTGGGAGTGGCTGG - Intronic
985579933 5:691297-691319 GACCAAGGCCGGGAAGGGGCAGG - Intronic
985594780 5:783356-783378 GACCAAGGCCGGGAAGGGGCAGG - Intergenic
985828923 5:2213538-2213560 GGACCAGGAAGGGGAGGGGCCGG + Intergenic
986744626 5:10732682-10732704 TACCTAGGAAGGGAATTGCCAGG + Intronic
987530859 5:19117472-19117494 GACCCAGCAAAGGAAGTGTTAGG + Intergenic
987854034 5:23395133-23395155 GAGCTATGAGGGGAAGTGGCAGG - Intergenic
988337288 5:29922911-29922933 CCCACAGGAAGGAAAGTGGCTGG + Intergenic
991010869 5:61881859-61881881 GACCCAGGAGGGGTAGTACCTGG - Intergenic
991913883 5:71587347-71587369 GCCCCAGCCAGGGAAGCGGCAGG + Exonic
992554007 5:77885610-77885632 GACCTAGGAGGGGAATTGGGAGG - Intergenic
992673251 5:79080714-79080736 GACCTCGCCAGGGAAGTGGCTGG + Exonic
994255800 5:97594625-97594647 GTCCCAGGAGGGGGAGGGGCAGG + Intergenic
996439679 5:123475890-123475912 GACCCAGAAAGGGATATGGCAGG + Intergenic
997595254 5:135103103-135103125 GTCCCAGGGAGGGACTTGGCAGG + Intronic
997596419 5:135110187-135110209 GACCCTGAAAGGGATGGGGCTGG + Intronic
1000222964 5:159231983-159232005 GTACCAGGAAAGGAAGTGGAGGG + Intergenic
1000865089 5:166503741-166503763 GCCCCAGGAATGGAAGTTCCAGG + Intergenic
1001309147 5:170598324-170598346 GAACCAGGAAAGGAGGTGGCAGG + Intronic
1002207043 5:177570060-177570082 GACCAAGGAAGGCAAGTGCCTGG - Intergenic
1003371467 6:5531434-5531456 GACTCAGGAAGGAAAGGGGATGG + Intronic
1003851136 6:10223816-10223838 GACTAAAGAAGTGAAGTGGCAGG + Intergenic
1005819078 6:29582333-29582355 ACCCCAGGAATGGGAGTGGCTGG - Intronic
1005872220 6:29983108-29983130 GAGAGAGGAAGGGAAGAGGCTGG - Intergenic
1005959208 6:30684266-30684288 GAGCGAGGAAGGGTGGTGGCAGG + Intronic
1006295048 6:33166564-33166586 ACCCTAGGAAGGGTAGTGGCTGG + Exonic
1007107970 6:39296302-39296324 GGCACAGAAAGGGGAGTGGCTGG + Intergenic
1007729784 6:43938904-43938926 CACACAGGAGGGGAAGTGGCGGG - Intergenic
1008555751 6:52671482-52671504 GATCCAGGAAGGTAGGAGGCAGG - Intronic
1008660468 6:53662439-53662461 GACCCAAAAAGGGAAGGGACTGG - Intronic
1008937971 6:57013030-57013052 GACCCAGGATGGGGAATGGGAGG - Intronic
1009966019 6:70579235-70579257 CTTCCAGGAAGGGAAATGGCTGG + Intronic
1011069153 6:83361994-83362016 GACAAAGGAAGAGAAGGGGCTGG + Intronic
1011480141 6:87785728-87785750 GAGGCAGGAAGGGAAATTGCTGG - Intergenic
1013866078 6:114697848-114697870 GACCCTGGCAGGGAAGGGGAGGG - Intergenic
1015765256 6:136709536-136709558 GGCACAGAAATGGAAGTGGCAGG + Intronic
1016314499 6:142771317-142771339 GACCCAGGGAAGCAGGTGGCGGG - Exonic
1016934127 6:149436344-149436366 GACCCCTGAAGGCAAATGGCCGG - Intergenic
1017011442 6:150066374-150066396 GACCCTGCCAGGGAGGTGGCAGG + Intronic
1017339349 6:153302375-153302397 GACACAGGATGGGACGTGGCAGG + Intergenic
1018632926 6:165835821-165835843 GACCCAGGAAGGGCAAAGCCAGG + Intronic
1018894482 6:168004200-168004222 GGGCCAGGAAAGGAAGTGGGTGG + Intronic
1018900978 6:168051567-168051589 GGACCAGGAATGGAACTGGCCGG + Intergenic
1018947266 6:168356614-168356636 GACCCAGGACGGTACCTGGCAGG + Intergenic
1019319447 7:409013-409035 GACCCTGGAAGGGGTGTGGGAGG - Intergenic
1019419594 7:944883-944905 GACCCTGGGAGGGAAGAGCCCGG + Intronic
1019863906 7:3686943-3686965 TGCCCAGTAAGGGAAGTGGTTGG + Intronic
1020258184 7:6514337-6514359 GCTGCAGGCAGGGAAGTGGCAGG + Intronic
1023814136 7:43936587-43936609 CACCCAGGAGGGGAACTGGATGG - Intronic
1023984041 7:45085131-45085153 GACCCAGGTGGGGACCTGGCTGG - Exonic
1024216800 7:47255155-47255177 GGCCCAGGCAGGGATGTGGCAGG - Intergenic
1029376146 7:100177936-100177958 GCCCCCGGAAGGGCAGCGGCGGG + Intronic
1029733052 7:102450379-102450401 GGTCCAGGAAGGTAGGTGGCAGG - Exonic
1030636461 7:111954594-111954616 GAAGCAGGAAGAGAGGTGGCCGG + Intronic
1032180004 7:129667105-129667127 TACCCAGGAGGGGAATTGGAGGG + Intronic
1032511731 7:132478060-132478082 GACCTAGGAAGGGCCATGGCTGG - Intronic
1032833607 7:135653043-135653065 GCCGCAGGAAGGGAAGTAGCTGG - Intergenic
1033472544 7:141662869-141662891 GACACAGGAAAGGAAGCGGGGGG + Intronic
1034849763 7:154482754-154482776 GTGACAGGAAAGGAAGTGGCAGG + Intronic
1035010744 7:155713406-155713428 GACACAGGAGGGGGAGGGGCAGG + Intronic
1035074083 7:156166889-156166911 GAGCCAGGGAAGGAGGTGGCAGG - Intergenic
1035368156 7:158361754-158361776 GCCCCAGGAAGGTCAGTGCCTGG + Intronic
1036119780 8:6003275-6003297 GACCCAGTAAAGGACATGGCTGG - Intergenic
1036242647 8:7092610-7092632 CCCCCAGCAGGGGAAGTGGCGGG + Intergenic
1036683784 8:10894810-10894832 GAGCAAGGCAGGGAAGGGGCAGG - Intergenic
1036747742 8:11421990-11422012 GACCCAAGATGAGAAGTGGAGGG - Exonic
1037741466 8:21612411-21612433 CAGCCAGGCAGAGAAGTGGCTGG - Intergenic
1040079792 8:43274977-43274999 GACGGAGGAAGGGAAGGGGGAGG - Intergenic
1041318620 8:56590798-56590820 CACCCTAGAAGGGAAGAGGCTGG - Intergenic
1042803455 8:72745825-72745847 GACTCAGGAAGGGAGGGGACTGG - Intronic
1043311027 8:78859541-78859563 GGCCCAGGATGGGGTGTGGCGGG + Intergenic
1044646269 8:94446743-94446765 TACCCAAGATTGGAAGTGGCAGG + Intronic
1047183576 8:122612286-122612308 GAGCCAGGAAGACAAGGGGCTGG - Intergenic
1047614765 8:126555408-126555430 TATTCAGGAAGGGAAGTGGAAGG + Exonic
1048008963 8:130441513-130441535 GACCTAGGTGGGGAAATGGCAGG + Intronic
1048095246 8:131285025-131285047 AATCCAGGAAGGGAACAGGCAGG - Intergenic
1048381563 8:133870191-133870213 GACCCAGAGAGAGAAGTGGTGGG + Intergenic
1048864181 8:138747460-138747482 GACCCAGCAAGGGGCCTGGCAGG - Intronic
1049281834 8:141753395-141753417 GACCCTGGAAGCCAAGTGGGGGG - Intergenic
1049406858 8:142455464-142455486 CTCCCAGGAAGGCAAGTGGTTGG - Intronic
1049565209 8:143334664-143334686 GGTCCAGAAAGGGGAGTGGCAGG - Intronic
1050286449 9:4107389-4107411 GATCCAGGCATGGAAGTGACAGG - Intronic
1050342552 9:4654945-4654967 GACCAGGGAAGGGAAGTGCTCGG - Intronic
1050859498 9:10408647-10408669 GTCCCATGAAGAAAAGTGGCAGG + Intronic
1051759019 9:20439582-20439604 GCACCAGGAAGGGGAGTGGGGGG + Intronic
1052665265 9:31487403-31487425 GGCCCAGGAAGGGAACAGGGAGG + Intergenic
1052901152 9:33795873-33795895 GGCCCATGAAATGAAGTGGCAGG + Intronic
1055327876 9:75150822-75150844 GAAGCAGGAAGGAAAGTGGAAGG + Intergenic
1056277890 9:85011188-85011210 TACCCAGGAAGGGAAGGGAGCGG + Intronic
1056317313 9:85402468-85402490 GACTCAGGAGGGGAAATGGGTGG - Intergenic
1056439129 9:86602926-86602948 GACTCAGGAATGAAGGTGGCAGG + Intergenic
1056554412 9:87676888-87676910 GACACTGAAAGGGAGGTGGCAGG - Intronic
1056731103 9:89167405-89167427 GCCCAAGGAAGGGGAGAGGCGGG + Intronic
1057081316 9:92176590-92176612 GACGGAAAAAGGGAAGTGGCTGG - Intergenic
1057215642 9:93226971-93226993 GATCCCGGGAGGGGAGTGGCTGG + Intronic
1058786566 9:108393899-108393921 GACGCAGGCAGGGGACTGGCAGG + Intergenic
1059338940 9:113586542-113586564 AACCCAAGAAAGGAAGTGACCGG - Intronic
1059461456 9:114433220-114433242 GCCCGATGAAGGGAACTGGCAGG + Intronic
1060272709 9:122158307-122158329 GATCCAGTAAGGGAGGTGGTGGG - Intronic
1060406567 9:123375881-123375903 GCCCCAGGAAGGGGTGTGGCGGG - Intronic
1060588651 9:124802355-124802377 GACCTAGGAAGGGGAGGAGCAGG - Intronic
1061320089 9:129823388-129823410 GACCCCGGAAGCCAAGCGGCCGG - Intronic
1061837723 9:133340579-133340601 GAGCTAGGAAGTGAAGTGGCAGG - Exonic
1061866323 9:133493439-133493461 GACTCTGGAATGGAAGTGCCAGG - Intergenic
1061938712 9:133872632-133872654 GACCCGGGGAGAGAAGAGGCTGG + Intronic
1061950766 9:133934730-133934752 GACCCAGGAACGGGGGTGACAGG - Intronic
1062165594 9:135105809-135105831 GACCCTGGATGGGAAGTGGGTGG - Intronic
1062249986 9:135589052-135589074 GGCCCAGGCAGGGCCGTGGCAGG - Intergenic
1062715131 9:138006308-138006330 GACCCACCAAGTGGAGTGGCAGG + Intronic
1203791085 EBV:151894-151916 CACCCAGGAAGAGCAGCGGCAGG + Intergenic
1186353309 X:8762668-8762690 GAGACAGGTAGGCAAGTGGCGGG + Intergenic
1186409878 X:9337261-9337283 GACCAAGGAAGGCAGATGGCTGG + Intergenic
1186794583 X:13032096-13032118 GAGACAGGTAGGCAAGTGGCAGG + Intergenic
1189291294 X:39887739-39887761 GAGCCAGGATGGGGAGAGGCTGG + Intergenic
1189511462 X:41666417-41666439 GAGGGAGGAAGGGAGGTGGCTGG - Intronic
1190114276 X:47615994-47616016 GACCCAGGAAGGAATGAGGGTGG + Intronic
1190936711 X:55004394-55004416 GACACAGGAAGGGAGGTGAGTGG + Intronic
1191648589 X:63510604-63510626 GACCCATGAAGGGGATTTGCAGG - Intergenic
1192180404 X:68912412-68912434 GACCCAAGCAGGGATGGGGCCGG - Intergenic
1192569338 X:72190030-72190052 GAGGCAGGAAGGGAAGGGGAAGG - Intronic
1195168913 X:102247012-102247034 GCCCCAGGAGGGGGAGGGGCAGG + Intergenic
1195189944 X:102440074-102440096 GCCCCAGGAGGGGGAGGGGCAGG - Intronic
1202303089 Y:23438396-23438418 GGCCAAGGGAGGGAATTGGCAGG + Intergenic
1202567722 Y:26232198-26232220 GGCCAAGGGAGGGAATTGGCAGG - Intergenic