ID: 1138506326

View in Genome Browser
Species Human (GRCh38)
Location 16:57480046-57480068
Sequence CAGAGTTATCACAGTTGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 142}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138506326_1138506330 -10 Left 1138506326 16:57480046-57480068 CCCCATCAACTGTGATAACTCTG 0: 1
1: 0
2: 1
3: 13
4: 142
Right 1138506330 16:57480059-57480081 GATAACTCTGGTGCAAATTTAGG 0: 1
1: 0
2: 0
3: 12
4: 130
1138506326_1138506332 22 Left 1138506326 16:57480046-57480068 CCCCATCAACTGTGATAACTCTG 0: 1
1: 0
2: 1
3: 13
4: 142
Right 1138506332 16:57480091-57480113 CAAGAGCAAAAGCCCCTTCCTGG 0: 1
1: 0
2: 1
3: 22
4: 211
1138506326_1138506333 23 Left 1138506326 16:57480046-57480068 CCCCATCAACTGTGATAACTCTG 0: 1
1: 0
2: 1
3: 13
4: 142
Right 1138506333 16:57480092-57480114 AAGAGCAAAAGCCCCTTCCTGGG 0: 1
1: 0
2: 3
3: 20
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138506326 Original CRISPR CAGAGTTATCACAGTTGATG GGG (reversed) Intronic
902732619 1:18379363-18379385 CTGCCTTAACACAGTTGATGTGG + Intergenic
902835991 1:19047175-19047197 CAGGGATATCACAGTAGATGGGG - Intergenic
903485209 1:23684821-23684843 AAGAGATATCACAGCTGAAGGGG - Intergenic
904890756 1:33777799-33777821 GAGATTGATCACAGATGATGGGG - Intronic
914431963 1:147626709-147626731 CAGCGTTAGCAGAGGTGATGGGG - Intergenic
916614093 1:166421981-166422003 CAGAGTTCAAACAGTAGATGTGG - Intergenic
918263930 1:182822546-182822568 CAGAGTTATCACAGAATATGAGG + Intronic
920110398 1:203583282-203583304 GAGAGTTATCACACTGCATGAGG - Intergenic
920201075 1:204259955-204259977 CAGAGTTAACACAGCAGGTGTGG - Intronic
920314034 1:205065214-205065236 CAGGCTTATCAAAGTCGATGGGG - Exonic
922004834 1:221519706-221519728 CAGAGCTATCACAAGTGATTTGG - Intergenic
923940450 1:238817574-238817596 TAGACATATCATAGTTGATGAGG + Intergenic
1067420503 10:46141430-46141452 CAGAGTTGTCACATTAGATCGGG + Intergenic
1067425518 10:46208103-46208125 CAGAGTTGTCACATTAGATCGGG - Intergenic
1067505847 10:46847911-46847933 CAGAGTTGTCACATTAGATCGGG + Intergenic
1067970040 10:50959242-50959264 GAGACTTATCACAGATGAGGTGG + Intergenic
1068804624 10:61181366-61181388 GAAAGTTATTACAGATGATGAGG + Intergenic
1078276982 11:9858434-9858456 CAGAATTATAACAGTTCATAAGG + Intronic
1079394556 11:20050598-20050620 CAAAGTTTTCACTGTTGATGGGG - Intronic
1084157732 11:67323692-67323714 TAAAGTTATCACAGTAGCTGAGG - Intronic
1084479103 11:69407970-69407992 CATGATCATCACAGTTGATGTGG - Intergenic
1085190005 11:74611823-74611845 CTGTCTTTTCACAGTTGATGAGG - Intronic
1089724738 11:120466104-120466126 CAGATTTCTCACAGTTGTTGTGG + Intronic
1095305405 12:40633026-40633048 CAGGCTTATTACAGTTCATGAGG + Intergenic
1095959349 12:47824325-47824347 CAGAGTCAACAAAGGTGATGTGG + Intronic
1097220483 12:57447490-57447512 TAGAGTTTTTACAGGTGATGAGG + Intronic
1098480424 12:70951803-70951825 CAGAGTTCTCAGAGTTAATTTGG - Intergenic
1099076713 12:78118550-78118572 CAGAGTTATTTCAGGTAATGGGG + Intronic
1099692104 12:85968742-85968764 CAGAGTTATCATAATTGTTCTGG - Exonic
1101411189 12:104469856-104469878 CAGAGTTATCATAGAGGAAGGGG + Intronic
1101586506 12:106090049-106090071 CAGAGTTCTGCCAGTTGATTGGG + Intronic
1107760834 13:43676690-43676712 CACAGTGATCACAGTTACTGGGG + Intronic
1110590743 13:77255265-77255287 CAGAGTCATAACAGATGCTGGGG - Intronic
1110595166 13:77312722-77312744 CAGACCTATCACTGTTGATATGG + Intronic
1111954289 13:94740038-94740060 GAGAGCTATCACAGGTGATTAGG - Intergenic
1113348224 13:109502236-109502258 CAATGTAATCAGAGTTGATGAGG - Intergenic
1115043957 14:28966818-28966840 CACAGGTATCACATTAGATGTGG + Intergenic
1115640408 14:35332212-35332234 CAGAGTTAACACAGTGGTTTAGG + Intergenic
1117751876 14:58931896-58931918 CACAGTCATCTCAATTGATGTGG - Intergenic
1117790756 14:59339138-59339160 CAGAGTTTCCTCATTTGATGAGG - Intronic
1120030583 14:79636456-79636478 AAAAATTATCACAGTTTATGGGG - Intronic
1120246686 14:82014763-82014785 CACATTTATCACAGTTTCTGTGG + Intergenic
1122256867 14:100484790-100484812 CAGAGCTACAACAGCTGATGTGG - Intronic
1127867869 15:63046681-63046703 CAGATATATCACAGTTACTGGGG - Intronic
1131783809 15:95889523-95889545 CAGAGTTATCACACTTCTTAGGG + Intergenic
1132086648 15:98913757-98913779 CAGAGTATTCACTGATGATGAGG + Intronic
1137675762 16:50303160-50303182 CAGAGTTGTCACAATGGAGGAGG + Intronic
1138506326 16:57480046-57480068 CAGAGTTATCACAGTTGATGGGG - Intronic
1140548959 16:75842762-75842784 CAGAGATATCAGAGTTATTGTGG + Intergenic
1141280630 16:82627448-82627470 CAAAGTTACCCCACTTGATGTGG - Intronic
1141778366 16:86139645-86139667 CATAGTTATCACCGTCTATGGGG + Intergenic
1141788221 16:86215875-86215897 GAGAGTTATCACAGATGATCCGG - Intergenic
1149170317 17:53801839-53801861 CAGAGGAATCACTGTTGAGGTGG - Intergenic
1151351713 17:73535849-73535871 CAGAGTGATCATTGTTCATGTGG + Intronic
1156298240 18:35811996-35812018 CACATTTGTTACAGTTGATGAGG + Intergenic
1157945430 18:51974304-51974326 CAGATTTCTCACTGTTGAAGTGG + Intergenic
1157965838 18:52207195-52207217 CAGAGTTATTACAGCTAATCAGG + Intergenic
1159276396 18:66227193-66227215 CAAAGATATCACACTTGATATGG + Intergenic
1159495149 18:69193217-69193239 AAGAGTTATAAAACTTGATGAGG - Intergenic
1161244473 19:3241690-3241712 CAGAGCTCTCACAGTTGAAATGG + Intronic
1164536315 19:29088664-29088686 CAGAGTTATGGGAGCTGATGGGG - Intergenic
1166916424 19:46198714-46198736 CATAGTTATCAGAATTGAAGGGG - Intergenic
1167056568 19:47114759-47114781 CAGATTTATCACTGTTGACACGG - Intronic
1168613600 19:57820246-57820268 CAGAGTTTTCAAAGTTAATTTGG + Intronic
925891400 2:8438003-8438025 GAGTGTTCTCACAGTTGTTGGGG - Intergenic
929489452 2:42383357-42383379 CAGAGTGCTCAGAGTGGATGTGG - Intronic
935489557 2:103699755-103699777 CAGAGTTATCAAAATACATGAGG + Intergenic
936630352 2:114195479-114195501 CAGATTTTTCACTGTTGAAGTGG - Intergenic
937589572 2:123596914-123596936 CACAGTTATTACAGATGGTGGGG - Intergenic
937675235 2:124583032-124583054 CACAGTTATAAAAGTTTATGTGG - Intronic
937899709 2:127010232-127010254 CATGGTCATCTCAGTTGATGCGG - Intergenic
939906319 2:147920461-147920483 TAGAGTTATCAAAGTTTCTGAGG + Intronic
940844625 2:158626186-158626208 CAGTCCCATCACAGTTGATGTGG + Intronic
942999638 2:182310011-182310033 CAGAGTTATCAGAGTAATTGAGG + Intronic
945977949 2:216285229-216285251 CAGAGTTAACAAAATGGATGTGG - Intronic
948735155 2:239998895-239998917 AAGATTTATCACAGTGAATGAGG - Intronic
1173474494 20:43349435-43349457 AAGAGTGATCAGAGGTGATGGGG - Intergenic
1174217156 20:48924972-48924994 CAGAGTAATTACAGCTGCTGTGG - Intronic
1175819257 20:61899844-61899866 CCTGGTTATCACAGTTGATGTGG + Intronic
1176884006 21:14232293-14232315 CATATTTCTCACAGTTGATATGG + Intergenic
1179030989 21:37719183-37719205 CAGAGTCATCACAGGGAATGGGG + Intronic
1179493551 21:41757023-41757045 CAGGGTTATCACAAGTGAGGAGG + Intronic
1183345698 22:37306465-37306487 CAGAGGTCTCATAGTTTATGAGG + Intronic
949697720 3:6718747-6718769 CAGATTTCTCACTGTTGAAGTGG + Intergenic
951221900 3:20077484-20077506 CAGAGTAAACACATTTCATGTGG - Intronic
956972874 3:74547263-74547285 TAGAATTATCCCAGTTGATATGG - Intergenic
957657382 3:83097975-83097997 CTGAGTAATCACAGTAGAGGTGG - Intergenic
957913893 3:86661114-86661136 CAGAGATCTCACAGATGAGGTGG - Intergenic
959349426 3:105242521-105242543 CAGAGTAATCACTGTTGCTCGGG - Intergenic
963002881 3:140699685-140699707 CAGAGTTATCAGAGGGCATGAGG - Intronic
964600128 3:158491118-158491140 CATAGTTTTCCCAGTTAATGTGG + Intronic
967196642 3:187032113-187032135 TAGATTTATCATAGGTGATGAGG - Intronic
967459645 3:189730693-189730715 CAGTTTGATCACAGTTGGTGAGG + Intronic
967939704 3:194756473-194756495 CAAAGATATCACAGTAGACGTGG - Intergenic
971366043 4:25977903-25977925 CAGACTTATCAAATTGGATGTGG - Intergenic
971742521 4:30538947-30538969 CAAAGTTAGGACAGCTGATGGGG + Intergenic
972480867 4:39494619-39494641 CAGGGTTATCTCAGTTTCTGTGG - Intergenic
979749789 4:124264656-124264678 CAGATTTTTCACTGTTGAAGTGG - Intergenic
980375133 4:131936394-131936416 AACAGTTATCCCACTTGATGGGG - Intergenic
980841696 4:138269077-138269099 CAGATTTTCCACAGTTGAAGAGG - Intergenic
981806917 4:148727434-148727456 CAGTTTTATTTCAGTTGATGTGG + Intergenic
982286502 4:153741489-153741511 CAGAGTTACTACATTTGATATGG + Intronic
984059382 4:174973387-174973409 CAGAGTTACCAAAGTTGGTAGGG - Intronic
984390183 4:179121153-179121175 ATGACTTATCACTGTTGATGTGG - Intergenic
986720007 5:10554231-10554253 GAGAGTGATCTCAGTTCATGGGG + Intergenic
987801315 5:22700350-22700372 CAGAGTTCTCATAGGTGATGAGG - Intronic
987940070 5:24522324-24522346 TTGAGTTATCACACTTAATGTGG - Intronic
988441375 5:31237513-31237535 CAGATTTATTACTGTTGGTGAGG - Intronic
990444971 5:55885960-55885982 CAGAGTTACTACAGCTGCTGGGG + Intronic
992673273 5:79080931-79080953 CAGAGTCTTCACATTTCATGAGG + Intronic
994365327 5:98909639-98909661 CAGAGTTAACAAATATGATGAGG - Intronic
994638431 5:102373741-102373763 CAGAATTAACACAGTCTATGAGG - Intronic
994827796 5:104737866-104737888 GAGAGTTATCACAGAAGATTGGG + Intergenic
995199876 5:109413953-109413975 CAGAGTTTTCAAAGTTCCTGTGG - Intergenic
997227615 5:132220946-132220968 CAGAGATGTCAGTGTTGATGTGG - Intronic
999123656 5:149229997-149230019 CAGAGCTATCACATTTAAGGGGG - Intronic
1006264419 6:32906422-32906444 CACAGTTAACACAGTTGTTGAGG + Intergenic
1007520336 6:42447046-42447068 CAGAGTTATCACTGTTATTTAGG + Intronic
1011577558 6:88819795-88819817 GAGAGTGATCACGTTTGATGTGG - Intronic
1012193629 6:96312426-96312448 CAGAGTTCTAACAGTTTATAGGG - Intergenic
1012519532 6:100104210-100104232 CAGGGAAATCACAGATGATGAGG - Intergenic
1014125414 6:117771477-117771499 CAGAGGTTTCAGAGTTGACGAGG + Intergenic
1014186246 6:118437428-118437450 CAGAGTTATCATACTGAATGGGG - Intergenic
1015928428 6:138333338-138333360 AAAAGATATCACAGTTGAAGGGG - Intronic
1017217701 6:151929444-151929466 CAGAGTTATTACATTTAAAGTGG + Intronic
1018444324 6:163841507-163841529 CAGAGTCATCACACTAGATGGGG - Intergenic
1021329524 7:19318479-19318501 CAGATCTATCACGGCTGATGCGG - Intergenic
1026634440 7:72069179-72069201 CAGAGTTCTGACAGTTGCAGTGG - Intronic
1031368173 7:120929256-120929278 CAGAGCAATAACAGTAGATGAGG + Intergenic
1033571358 7:142631964-142631986 CAGTGTGAACAGAGTTGATGCGG + Intergenic
1034685458 7:152967113-152967135 CAGAGTTTTAAGAGTTGCTGGGG - Intergenic
1034913557 7:155018190-155018212 CAGAGTTATCACAGTGAAGCAGG - Intergenic
1037570365 8:20152784-20152806 CAGAGATAGCACAGGAGATGAGG + Intronic
1040488471 8:47897019-47897041 CAGAATATTAACAGTTGATGAGG - Intronic
1040660939 8:49574457-49574479 CAGGGTTCTCACTGTTGGTGCGG + Intergenic
1042339139 8:67660739-67660761 CTGAGTAATTACAGTTGATGTGG + Intronic
1042641601 8:70941502-70941524 CAGAGTTAGCACATCTGAAGAGG + Intergenic
1045930279 8:107616369-107616391 CAGATTTAACACAGTTGATAGGG - Intergenic
1046634794 8:116662541-116662563 CAGAGATAACGCAGTTCATGTGG - Intronic
1055220430 9:73923554-73923576 CCCAGTTTTCACAGTTGAGGTGG - Intergenic
1056235669 9:84591518-84591540 CAGAGTTATCAGATTTGATGAGG + Intergenic
1058139093 9:101339252-101339274 CAGAGTTATCACCTGGGATGGGG + Intergenic
1060094643 9:120777147-120777169 CAGGGTTCTCAAAGTTGATCAGG + Intronic
1186641130 X:11457106-11457128 CAGACCTATCACAGTTTTTGGGG - Intronic
1187056033 X:15742213-15742235 CAGAGATGTCACAGTGGAGGTGG - Intronic
1190114166 X:47614840-47614862 CAGAGTTGTCCCAGTTGAAGCGG - Intronic
1194473787 X:94334054-94334076 GAGAATTATAACAGTTAATGTGG - Intergenic
1194920047 X:99753804-99753826 CAGAATGTTCACAGTTCATGTGG - Intergenic
1195875307 X:109534882-109534904 TAGAGTTATCAAAGTTTGTGTGG + Intergenic
1197675241 X:129322874-129322896 CAAGATGATCACAGTTGATGGGG - Intergenic
1198816308 X:140595247-140595269 CAGGGTAACCAAAGTTGATGAGG - Intergenic
1201517191 Y:14830680-14830702 TTGAGTTCTCACAGATGATGGGG - Intronic
1201578168 Y:15482783-15482805 CAGAATTATCACAGGTGCTGTGG + Intergenic
1201794434 Y:17879742-17879764 CACATTTTTCACAGTTCATGAGG + Exonic
1201807120 Y:18026243-18026265 CACATTTTTCACAGTTCATGAGG - Exonic
1202355811 Y:24047538-24047560 CACATTTTTCACAGTTCATGAGG + Exonic
1202514967 Y:25622571-25622593 CACATTTTTCACAGTTCATGAGG - Exonic