ID: 1138509975

View in Genome Browser
Species Human (GRCh38)
Location 16:57503102-57503124
Sequence CTGGGTAAGGTGAAGACGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138509966_1138509975 12 Left 1138509966 16:57503067-57503089 CCTGAAGGGCATCTGCACTGAGC No data
Right 1138509975 16:57503102-57503124 CTGGGTAAGGTGAAGACGGAAGG No data
1138509961_1138509975 30 Left 1138509961 16:57503049-57503071 CCACAAACTTGCGCATCCCCTGA No data
Right 1138509975 16:57503102-57503124 CTGGGTAAGGTGAAGACGGAAGG No data
1138509964_1138509975 14 Left 1138509964 16:57503065-57503087 CCCCTGAAGGGCATCTGCACTGA No data
Right 1138509975 16:57503102-57503124 CTGGGTAAGGTGAAGACGGAAGG No data
1138509965_1138509975 13 Left 1138509965 16:57503066-57503088 CCCTGAAGGGCATCTGCACTGAG No data
Right 1138509975 16:57503102-57503124 CTGGGTAAGGTGAAGACGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138509975 Original CRISPR CTGGGTAAGGTGAAGACGGA AGG Intergenic
No off target data available for this crispr