ID: 1138510949

View in Genome Browser
Species Human (GRCh38)
Location 16:57508172-57508194
Sequence CTGGACAAAATGGCCTTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138510941_1138510949 5 Left 1138510941 16:57508144-57508166 CCCCTAGGGGCTGCCTGGTAGAG No data
Right 1138510949 16:57508172-57508194 CTGGACAAAATGGCCTTGGCTGG No data
1138510942_1138510949 4 Left 1138510942 16:57508145-57508167 CCCTAGGGGCTGCCTGGTAGAGT No data
Right 1138510949 16:57508172-57508194 CTGGACAAAATGGCCTTGGCTGG No data
1138510943_1138510949 3 Left 1138510943 16:57508146-57508168 CCTAGGGGCTGCCTGGTAGAGTC No data
Right 1138510949 16:57508172-57508194 CTGGACAAAATGGCCTTGGCTGG No data
1138510946_1138510949 -8 Left 1138510946 16:57508157-57508179 CCTGGTAGAGTCAGGCTGGACAA No data
Right 1138510949 16:57508172-57508194 CTGGACAAAATGGCCTTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138510949 Original CRISPR CTGGACAAAATGGCCTTGGC TGG Intergenic
No off target data available for this crispr