ID: 1138512681

View in Genome Browser
Species Human (GRCh38)
Location 16:57517721-57517743
Sequence CATGGTCACCAGCAAGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 282}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138512681_1138512683 -8 Left 1138512681 16:57517721-57517743 CCCTCTTCTTGCTGGTGACCATG 0: 1
1: 0
2: 1
3: 33
4: 282
Right 1138512683 16:57517736-57517758 TGACCATGAAGCTGTGTGATTGG 0: 1
1: 0
2: 0
3: 17
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138512681 Original CRISPR CATGGTCACCAGCAAGAAGA GGG (reversed) Intronic
901371743 1:8804693-8804715 CATTCTCACCAGCAGGAAGGAGG - Intronic
902275576 1:15337121-15337143 CATGGCCACCAGGAGGAAGGGGG + Intronic
902960912 1:19962247-19962269 CATGGGCATCAGCAGGTAGAGGG + Intergenic
904491335 1:30861377-30861399 CCTGGACAACAGGAAGAAGAAGG - Intergenic
906026265 1:42676590-42676612 CAAGAACACCACCAAGAAGAAGG - Exonic
906029155 1:42703532-42703554 CATGAACACCAGCAAGAAATAGG - Intergenic
906101926 1:43269555-43269577 TGTGGTCCCCAGCAAGCAGACGG - Intronic
906538761 1:46568770-46568792 CACAGTGACCACCAAGAAGAAGG + Intronic
910260597 1:85290025-85290047 CAAGGTTATCATCAAGAAGATGG - Intergenic
911047233 1:93638673-93638695 CATGGTAAACAGCAGGAGGAAGG + Intronic
915232599 1:154456763-154456785 GATCGTCACCAGCAAGTAGATGG + Intronic
915534965 1:156529970-156529992 AATTGTCACCAGCCAGAGGAAGG - Intronic
916377616 1:164172747-164172769 CATGGTCTCAAACAAGAAAAGGG + Intergenic
916444593 1:164860608-164860630 CATGGACACCTGCTTGAAGAAGG - Intronic
917630162 1:176883709-176883731 TGTGGTCACCAGCAGGATGATGG - Intronic
918566834 1:185943809-185943831 GCTGGTCACCAGAAAGACGAAGG - Intronic
919951612 1:202369576-202369598 CATTGTCAGCACTAAGAAGAAGG - Intronic
920288021 1:204895527-204895549 CATGGTCATCAGCAAAAATCAGG - Intronic
920661052 1:207914618-207914640 CATGGACACCAGCCAGAAGGTGG + Intergenic
921039589 1:211416840-211416862 CAGGGTCCCCAGCAGGAAGGTGG - Intergenic
921639433 1:217534440-217534462 CATGCTCACTAATAAGAAGATGG - Intronic
922007199 1:221543477-221543499 AATGGTCAACAGCCAGAAGACGG + Intergenic
922067679 1:222159600-222159622 GGTGGTCACCACCAGGAAGAAGG - Intergenic
922772574 1:228194900-228194922 CATGGTGACCTTCAAGAAGATGG - Intergenic
923497596 1:234538821-234538843 CATGGGCACCAGGGAGAAGGAGG + Intergenic
924816987 1:247451338-247451360 CAGGGGCACCAACACGAAGAAGG + Exonic
1064346483 10:14537268-14537290 CATGGACACCAGCTCCAAGATGG - Intronic
1064970679 10:21063301-21063323 CATGATCACCATCAAGGACATGG + Intronic
1065620344 10:27574710-27574732 CATGATCTCCAGCAGGAAGATGG - Intergenic
1067289619 10:44931687-44931709 CCTGGTGACCAGCAGGTAGAAGG + Intronic
1071996705 10:91156312-91156334 CATCGTCAGCAGGCAGAAGATGG + Intergenic
1074275609 10:111999226-111999248 CATGGTCAGGAGGCAGAAGAAGG + Intergenic
1074599037 10:114895169-114895191 CATTGTCAGCAGGAAGAAAATGG - Intronic
1075316143 10:121455168-121455190 CAAGGCCACCAGGAAGGAGAAGG - Intergenic
1076930219 10:133527439-133527461 CATGGACACCAGCAGGAGGAAGG - Exonic
1077741369 11:4849134-4849156 CATGCCCACCAGCAAGAAGGTGG + Exonic
1079491940 11:20998699-20998721 AATGCTGACCAGCAGGAAGATGG - Intronic
1081801272 11:45860941-45860963 CTTGGTGACCAGCCAGCAGATGG + Exonic
1084767350 11:71321314-71321336 CAAGGACACCACCAAGAGGATGG - Intergenic
1084960033 11:72711625-72711647 AATGGCCACTGGCAAGAAGATGG + Intronic
1085258920 11:75193254-75193276 CAGGACCACCAGCAGGAAGATGG - Exonic
1085394935 11:76202467-76202489 CATGGGCACCAGCATGAGGTGGG - Intronic
1086995956 11:93355422-93355444 CATGGTAAGCAACAAGAAAATGG + Exonic
1088329232 11:108633178-108633200 CATGGTAACAAGAAAGAAGGTGG - Intergenic
1090402571 11:126458493-126458515 CTTGGGCACCAGCAGGAAGAGGG - Intronic
1091282343 11:134389335-134389357 GCTGGGCAGCAGCAAGAAGAGGG + Exonic
1096448157 12:51713533-51713555 CATTGCCACCGGCAGGAAGAGGG - Intronic
1100435076 12:94563754-94563776 TATGGCCAGCAGCATGAAGATGG + Intergenic
1100875159 12:98954038-98954060 CATTGTCACCACCTGGAAGATGG + Intronic
1101076862 12:101139285-101139307 CATGGGCACCAGCCAGACTATGG - Intergenic
1101677549 12:106932024-106932046 CATGGGCACCAGAAATGAGAAGG + Intergenic
1102943278 12:116962535-116962557 CATGGTTAGCAGGAAGCAGAAGG + Intronic
1103462677 12:121117515-121117537 CATGGTCAGCAGAATGAGGATGG + Intergenic
1103883509 12:124184361-124184383 CAGGGTCACCAGAAAGGAGAGGG - Intronic
1104512159 12:129390692-129390714 CAGAGTCACCAGCAAGAAGAAGG - Intronic
1104521230 12:129477168-129477190 CATTGTCACGACCAAGGAGACGG - Intronic
1105257817 13:18756363-18756385 CAAGGTCAGCATCAAGAAGATGG + Intergenic
1105259121 13:18765917-18765939 CTAGGTCAGCATCAAGAAGATGG + Intergenic
1105260477 13:18775672-18775694 CAAGGTCAGCATCAAGAAGATGG + Intergenic
1105261797 13:18785236-18785258 CTAGGTCAGCATCAAGAAGATGG + Intergenic
1105264154 13:18801825-18801847 CTAGGTCAGCATCAAGAAGATGG + Intergenic
1106962472 13:35014912-35014934 CAGGCTCATCTGCAAGAAGATGG + Intronic
1107773301 13:43811349-43811371 AATGGCCCCCAGCAAGCAGAAGG + Intergenic
1109892377 13:68632002-68632024 CAGAGTCCCCACCAAGAAGAAGG - Intergenic
1112092567 13:96097161-96097183 CAAGGTAACCATCAGGAAGAAGG - Intronic
1113765029 13:112875847-112875869 GATGGTCACCAGCAGCACGATGG - Exonic
1113882619 13:113636078-113636100 CGTCAACACCAGCAAGAAGACGG + Exonic
1114588611 14:23838080-23838102 CCTGGTCACCAGGAAGATCAAGG - Intergenic
1115534927 14:34363976-34363998 CATGGTTACCAGCAAACAGCTGG - Intronic
1117257619 14:53994946-53994968 TATGGTCACCAGCTAGTACATGG + Intergenic
1118241881 14:64068211-64068233 CATGATCACCAGCAAAATCAAGG + Intronic
1119566458 14:75633244-75633266 CAGGGTCATCAGGAAGAGGAGGG + Intronic
1120932574 14:89864362-89864384 CATGGGCATCAGCAAACAGATGG - Intronic
1122261083 14:100523448-100523470 CCTGGTCCTCAGAAAGAAGAAGG - Intronic
1122790669 14:104182960-104182982 CAGGCTCCCCAGCAAGAAGCAGG - Intergenic
1122837092 14:104435692-104435714 CCTGGTCACCAGCAGTGAGAAGG + Intergenic
1202834298 14_GL000009v2_random:66216-66238 CTAGGTCAGCATCAAGAAGATGG - Intergenic
1127394234 15:58530594-58530616 CATGATCACCATCAAGATGTAGG + Intronic
1128443034 15:67731259-67731281 CTGTGTCACCAGCAGGAAGAGGG - Intronic
1129389254 15:75212493-75212515 CATGGTCACCAGCAATGGGGAGG - Intergenic
1129644797 15:77420052-77420074 CGTGGTCACCAGGAAGGGGACGG - Exonic
1129948084 15:79559659-79559681 CATCAACACCAGCAAGAAGACGG - Intergenic
1131841061 15:96438221-96438243 CATGGTCAAAAGACAGAAGATGG - Intergenic
1132341741 15:101083133-101083155 TATGAGCACCAGTAAGAAGACGG + Intergenic
1134452566 16:14372523-14372545 CAGGGCCTCCAGCAAGAAGCAGG + Intergenic
1136233815 16:28902866-28902888 GATGGTCACCAGCACGGACAGGG - Exonic
1138512681 16:57517721-57517743 CATGGTCACCAGCAAGAAGAGGG - Intronic
1140214388 16:72995651-72995673 CATGGTGTGCAGCAAGAACACGG + Intronic
1140251166 16:73295679-73295701 GAGGGTCACCAGGAAAAAGAAGG + Intergenic
1141300249 16:82808552-82808574 CAAGGACATCACCAAGAAGAAGG + Intronic
1141328534 16:83085670-83085692 CAAGCTCTACAGCAAGAAGAAGG + Intronic
1142882164 17:2890167-2890189 CACGGTCACAAGCAAGAAAGGGG + Intronic
1142889145 17:2931757-2931779 CAGGCTGACCTGCAAGAAGAGGG - Intronic
1143393885 17:6576704-6576726 CAGGGCCAACAGCAAGAGGAAGG - Intergenic
1148000070 17:44382678-44382700 CATGGGCTTTAGCAAGAAGAGGG - Intronic
1150188759 17:63215454-63215476 AATGGTCACCAGAAAGACCAGGG + Intronic
1151370513 17:73644086-73644108 CATGGTGACCAGCCTGGAGAGGG + Exonic
1154424245 18:14259736-14259758 CTAGGTCAGCATCAAGAAGATGG - Intergenic
1154425540 18:14269123-14269145 CAGGGTCAGCATCTAGAAGATGG - Intergenic
1154428272 18:14288709-14288731 CAAGGTCAGCATCTAGAAGATGG - Intergenic
1154431915 18:14314818-14314840 CTAGGTCAGCATCAAGAAGATGG - Intergenic
1154433236 18:14324364-14324386 CAAGGTCAGCATCTAGAAGATGG - Intergenic
1155836072 18:30585730-30585752 CAAGGACACCACCAAGAGGACGG + Intergenic
1156625193 18:38900120-38900142 GATGGTCACCAGAGAGAAAATGG - Intergenic
1157111975 18:44829515-44829537 CCTGGTTTCCATCAAGAAGAAGG + Intronic
1158094393 18:53754454-53754476 AATGGTAACCAGCAAGAATATGG - Intergenic
1159327575 18:66943151-66943173 CAGGGTCATCAGCATGCAGATGG - Intergenic
1159879283 18:73843366-73843388 CATCGTCCCCAGCAAGCAGGGGG + Intergenic
1160034430 18:75287351-75287373 CAAGGTCAACATCAAGAAGGAGG + Exonic
1160202187 18:76805437-76805459 CCTCGTCACCAGCATGAAGTGGG - Intronic
1160607673 18:80064657-80064679 CACGGTGCCCAGCAAGAAGCAGG - Intronic
1161010199 19:1956145-1956167 GATGGTCACCACCCAGACGAGGG + Intronic
1161592782 19:5136303-5136325 CATGGTCACAGACAAGAAAATGG + Intronic
1162162795 19:8731250-8731272 CATGGTCACCATCCCCAAGATGG + Exonic
1162894914 19:13759395-13759417 CATGGTCACCATGTAGCAGATGG - Intronic
1163146235 19:15380531-15380553 CAAGCTCATCAGCAAGAAGCTGG - Exonic
1163708500 19:18831862-18831884 CCTGGTGCCCAGCAGGAAGACGG - Intergenic
1166161092 19:40953855-40953877 CAAGGGCACCAGCAAGGAGCTGG - Intergenic
1166823088 19:45592448-45592470 TAAGGTCACCAGTAAGGAGAAGG + Exonic
1166969834 19:46558934-46558956 CATCTTCACCACCAGGAAGAAGG + Intronic
1167208576 19:48118934-48118956 CAGGGTCACCAGCTAGTAGCCGG + Intronic
1167478188 19:49712962-49712984 CATGGTCATCAGCCTGGAGACGG - Exonic
1167749662 19:51372052-51372074 CATGGCCACCACCATGGAGATGG + Exonic
1167752052 19:51387375-51387397 CATGGCCACCACCAGGAGGATGG + Exonic
1168131193 19:54320411-54320433 CATGCTCACCAGGATGAGGATGG + Intergenic
1168179173 19:54648624-54648646 CATGCTCACCAGGACGAGGATGG - Intronic
1202638385 1_KI270706v1_random:61476-61498 CTAGGTCAGCATCAAGAAGATGG + Intergenic
926181925 2:10652278-10652300 CATGGGCACCAGAAACAGGAAGG + Intronic
928015299 2:27650597-27650619 CAGGGTCAAGAGCAAGAAGCTGG - Exonic
928105691 2:28469286-28469308 CATGGTCCCCAGCAAGCAGGAGG - Intronic
928287873 2:30009035-30009057 CCTGGTCCCCAGCAAGATGGAGG + Intergenic
928602862 2:32918581-32918603 CATGTTCACAAGCAATAATAAGG - Intergenic
928722848 2:34140658-34140680 CTTGGCCAACAGCATGAAGAGGG + Intergenic
928723368 2:34145050-34145072 TATAGTCACCAGGAAGAAGGTGG - Intergenic
934492414 2:94770692-94770714 CAAGGTCAGCATCATGAAGATGG + Intergenic
934492548 2:94771568-94771590 CAAGGTCAGCATCATGAAGATGG + Intergenic
934493838 2:94780960-94780982 CTAGGTCAGCATCAAGAAGATGG + Intergenic
934494296 2:94784094-94784116 CTAGGTCAGCATCAAGAAGATGG + Intergenic
934578370 2:95417673-95417695 CATGGTCAGGAGCATGATGAGGG + Intergenic
935536436 2:104300008-104300030 CAAGGGCAGCACCAAGAAGATGG + Intergenic
935815681 2:106843831-106843853 CCTGGTCTCCAGGAAGGAGAGGG + Exonic
936103181 2:109601214-109601236 GCTGGTCACCAGAAAGAACAAGG - Intronic
937630942 2:124100238-124100260 CAGGGACAGCACCAAGAAGATGG + Intronic
938188538 2:129254600-129254622 CATGGTCACTTGGAAGTAGAAGG - Intergenic
938279807 2:130055922-130055944 CGAGGTCAGCATCAAGAAGATGG + Intergenic
938330759 2:130446636-130446658 CGAGGTCAGCATCAAGAAGATGG + Intergenic
938359185 2:130674867-130674889 CGAGGTCAGCATCAAGAAGATGG - Intergenic
938435587 2:131281516-131281538 CGAGGTCAGCATCAAGAAGATGG - Intronic
939847900 2:147269793-147269815 CTTTGTCAGCAGCATGAAGACGG - Intergenic
940848868 2:158669820-158669842 CGAGGTCACCAGCAAAAACATGG + Exonic
941538246 2:166748686-166748708 CATGGTCTCCTGCTAGAAGAAGG - Intergenic
943386851 2:187211654-187211676 CTTTATCACCAGCAAGAAAATGG + Intergenic
944583291 2:201151929-201151951 CAAGGTCACAAGCTAGAACATGG - Intronic
945384475 2:209180447-209180469 CGAGGTCACCAGCAAAAACATGG + Intergenic
946600380 2:221353693-221353715 TATGGTCACCAGCAGAAAGCTGG - Intergenic
947461124 2:230305939-230305961 CAGGGTCACAAGCCAGGAGAGGG + Intronic
947753253 2:232543593-232543615 GATGGTCACCACCAGGAGGAAGG - Exonic
948844986 2:240678823-240678845 GACGGGCACCAGCAAAAAGAAGG + Intronic
948848874 2:240696056-240696078 GACGGGCACCAGCAAAAAGAAGG - Intronic
1168874411 20:1160917-1160939 CAAGGCCAACAGAAAGAAGATGG + Intronic
1169196863 20:3687947-3687969 CATGCCCTCCAGCCAGAAGAAGG - Exonic
1169546425 20:6655391-6655413 CAAGGTCCCCAGCAAGGAGCTGG - Intergenic
1171883622 20:30635808-30635830 CAAGGTCAGCATCAAGAAGATGG + Intergenic
1172390018 20:34559765-34559787 CTGGTTCACCAGCAGGAAGAAGG - Exonic
1173607676 20:44343298-44343320 CAAGGTCACCAGCAAGTTGGCGG + Intronic
1174765164 20:53246755-53246777 CTTGGTCATCAGCAAAAAAACGG - Intronic
1175101079 20:56579261-56579283 CCTGTTCATCAGCAGGAAGAAGG - Intergenic
1175580116 20:60092049-60092071 CATGCTCACCAACAGGAATAGGG - Intergenic
1176843323 21:13857887-13857909 CAAGGTCAGCATCATGAAGATGG + Intergenic
1176843811 21:13861392-13861414 CAAGGTCAGCATCAAGAAGATGG + Intergenic
1176845125 21:13870944-13870966 CTAGGTCAGCATCAAGAAGATGG + Intergenic
1176846004 21:13877222-13877244 CAAGGTCAGCATCATGAAGATGG + Intergenic
1176847853 21:13890501-13890523 CTAGGTCAGCATCAAGAAGATGG + Intergenic
1176849226 21:13900260-13900282 CTAGGTCAGCATCAAGAAGATGG + Intergenic
1177337370 21:19748564-19748586 CATAGTCTGCATCAAGAAGAAGG - Intergenic
1178564148 21:33667924-33667946 CAGGGGCTCCAGCAAGCAGATGG + Intronic
1179270482 21:39846857-39846879 CTTGGTCTCCAGCAAGCAGGAGG - Intergenic
1179292692 21:40032397-40032419 AAAGTTCACCAGCAAGCAGAAGG + Intronic
1179950656 21:44707258-44707280 CAAGGTCTCCACCAGGAAGATGG + Intronic
1180363580 22:11920412-11920434 CTAGGTCAGCATCAAGAAGATGG - Intergenic
1181107498 22:20583731-20583753 CATGGTCACCAGCAAGTCAGGGG - Intronic
1183686677 22:39365040-39365062 CCAGGTCACCAGCAAGCAGAGGG - Intronic
1183751438 22:39723260-39723282 CAAGGTCATCAGAAAGGAGAAGG - Intergenic
1184093100 22:42302543-42302565 CAAGGTCACCAGCCAGTGGAAGG + Intronic
1184516059 22:44963532-44963554 CATCATCCCCAGCAAGAAGTGGG + Intronic
1185015887 22:48342316-48342338 AGTCGACACCAGCAAGAAGAGGG - Intergenic
1185330593 22:50250552-50250574 CAGGGTCACCAGCAGGAGCAGGG + Intronic
949455200 3:4230735-4230757 GCTGGTCACCAGAAAGACGAAGG - Intronic
949987449 3:9552371-9552393 CATGGAGAGCAGCACGAAGAAGG + Exonic
950659210 3:14456276-14456298 CGCTGTGACCAGCAAGAAGAGGG + Intronic
950665935 3:14494981-14495003 CAGGGTCACCTGGAAGCAGAAGG + Exonic
951891998 3:27576102-27576124 CCTGGTCACCAGAAGGAACAAGG - Intergenic
952756628 3:36874552-36874574 CTTGGTAACAAGCAAGGAGAGGG + Intronic
953259632 3:41325013-41325035 CATCTACACCAGCAGGAAGATGG + Intronic
953395194 3:42563599-42563621 CAGGGTCTCCAGGAAGCAGAAGG + Exonic
953454134 3:43028888-43028910 GGTGGTGACCAGCAAGCAGAAGG - Intronic
954873846 3:53787725-53787747 CATGAGGACCAGCAGGAAGAGGG + Intronic
955457226 3:59136814-59136836 GATGGACAACAGCAAGAAAATGG + Intergenic
956401343 3:68883258-68883280 CCTGGTCAATAGCAAGAATACGG - Intronic
957737521 3:84221832-84221854 GCTGGTCACCAGAAAGAACAAGG - Intergenic
957749010 3:84388053-84388075 CATGCCCATCAGAAAGAAGAAGG + Intergenic
957772123 3:84707721-84707743 CATGGCCCCCAGCCAGGAGAGGG + Intergenic
958841588 3:99211184-99211206 CAAGGACACCACCAAGAGGATGG + Intergenic
960357632 3:116673220-116673242 AATTGTCACCAACAAGAAAAGGG - Intronic
961001481 3:123376986-123377008 GATGTGCCCCAGCAAGAAGAGGG + Intronic
961317877 3:126052768-126052790 CATGGTCAGGAGGAAGAAGAGGG - Intronic
962939623 3:140114063-140114085 CCTGAACTCCAGCAAGAAGATGG - Intronic
968846431 4:3044808-3044830 GCTGGTCACCAGAAAGAAGAAGG + Intergenic
970427986 4:15963094-15963116 CAAGGTCACCAGCAGGAGGCAGG + Exonic
970965134 4:21919386-21919408 GATGGTCACCCTCAAGGAGAGGG + Intronic
972098964 4:35388122-35388144 CATGGGCACCAGGAAGATGTAGG - Intergenic
972207649 4:36797627-36797649 GATGGTTACCATCAAAAAGATGG + Intergenic
972857228 4:43121361-43121383 CTTTGTCAGCAGCAAGAAAATGG - Intergenic
973367276 4:49218078-49218100 CAAGGTCAGCATCAAGAAGATGG + Intergenic
973368620 4:49227819-49227841 CTAGGTCAGCATCAAGAAGATGG + Intergenic
973392429 4:49567606-49567628 CTAGGTCAGCATCAAGAAGATGG - Intergenic
975442013 4:74421742-74421764 CATCGTCACTATGAAGAAGAAGG + Intergenic
975914057 4:79301692-79301714 CATGGGGACCAGCAAGCACAAGG + Intronic
977034614 4:91933973-91933995 CATGGGAACCATCAACAAGAGGG - Intergenic
977716041 4:100184957-100184979 CTTGGTCACCAGAAAGACCAAGG - Intergenic
978178141 4:105759580-105759602 CTGAGTCACCAGCAAAAAGAAGG + Intronic
978486296 4:109257882-109257904 AATGGTCACCAACATGGAGAAGG + Intronic
980464253 4:133152317-133152339 CATGGCCAGCAGGAAGATGAAGG - Exonic
981318595 4:143365614-143365636 CCTGGCCAGCAGCAAGAACATGG + Intronic
984505281 4:180609825-180609847 ACTGGTCACCAGAAAGAACAAGG - Intergenic
987263276 5:16225318-16225340 CATGGCCACTAGCAAGCGGAGGG + Intergenic
988805693 5:34738466-34738488 CAAGGTGCCCAGCAAGAAAAGGG - Intronic
989247139 5:39266860-39266882 CATGGTCACCAGCCTGAGAATGG + Intronic
990282968 5:54271175-54271197 CATGGTCTCCAGCTTGCAGATGG + Intronic
991332824 5:65510940-65510962 CAGAGTCACCAGCAGCAAGAGGG + Intergenic
991997471 5:72402257-72402279 CATGCTCACCTGCAAAAGGAGGG + Intergenic
993002270 5:82393058-82393080 CGTGGTCATCAGCAAGAGTATGG - Intergenic
993426978 5:87777457-87777479 CATGGTCACCAGCTATCAAATGG - Intergenic
997735098 5:136207486-136207508 CATCCTCACCAGCCAGAAGCTGG + Intergenic
998137848 5:139683793-139683815 CATGTTCATCAGCAGGAAGCTGG - Exonic
1000110800 5:158106454-158106476 CAGGGTCACCAGCTAGTAAATGG - Intergenic
1000991679 5:167917554-167917576 CAAGGTCACAAGCAAGCAGGTGG - Intronic
1002201335 5:177530378-177530400 CTTGGTGACCAGCAAGATGGTGG - Intronic
1002849449 6:980457-980479 CAAGGTCACCAGCAACTTGAGGG + Intergenic
1003111145 6:3253112-3253134 CCTGGTCATCAGCAGGAAGAGGG - Intronic
1004300306 6:14451731-14451753 CAAGGTAACCAGCAAGAAGTGGG - Intergenic
1007289294 6:40773128-40773150 CAAGGTCAACAGCAAGTTGAGGG + Intergenic
1007617396 6:43188254-43188276 CAAGGTCAAAAGGAAGAAGATGG - Intronic
1011003539 6:82618541-82618563 CATGATCCCAGGCAAGAAGATGG + Intergenic
1013160201 6:107536189-107536211 CATGCTATCCAGCAAGAAGCGGG - Intronic
1016050696 6:139527087-139527109 CTAGGTCACCAGCAAGAAATTGG - Intergenic
1019372656 7:671007-671029 CAGGCTCATCAGCCAGAAGATGG + Intronic
1019416898 7:932005-932027 CAGAGTCCCCAGCAAGAAGCCGG + Intronic
1019789848 7:3004114-3004136 CATGGTAACCAGCAGGAAGCTGG - Intronic
1020987613 7:15156141-15156163 CATGCGCACCAGCAAGGTGATGG + Intergenic
1023866037 7:44238883-44238905 CATGGTCACAAGCCAGCAGGTGG + Intronic
1024208337 7:47182747-47182769 CATGGTGCCCAGCATGATGATGG + Intergenic
1029681719 7:102116093-102116115 CGTGGGCATCGGCAAGAAGACGG + Intronic
1031016901 7:116585256-116585278 CATGGTCAGTAGCCAAAAGAAGG + Intergenic
1031349303 7:120709499-120709521 CTTGTTCACCAGCAAGCTGAAGG - Intronic
1031976179 7:128095022-128095044 CCTGTCCACCAGCAAGAGGAGGG - Intergenic
1033555946 7:142488668-142488690 CATGGTCACCAGGAAGAGACAGG - Intergenic
1033598780 7:142874623-142874645 CATGGTCACCAGCACCATGAAGG + Exonic
1033600188 7:142883788-142883810 CCTGATATCCAGCAAGAAGAAGG + Intronic
1033604358 7:142915013-142915035 CATGGTCACCAGCACCAGGGAGG + Exonic
1033715745 7:144000357-144000379 CATGTTCACCAGGAAGGTGATGG + Intergenic
1034289862 7:149921289-149921311 CATGGTGATTAGAAAGAAGATGG - Intergenic
1034561349 7:151881363-151881385 CATGGTGAAAAGCAAGGAGAAGG + Intergenic
1034817145 7:154182387-154182409 CATGGCAACCAGCATGAGGAGGG - Intronic
1035371946 7:158385753-158385775 CACAGTCTCCAGGAAGAAGATGG + Intronic
1035435185 7:158854347-158854369 TCTAGTCCCCAGCAAGAAGAGGG + Intergenic
1036238653 8:7064407-7064429 CCTGGTGACCTGCAGGAAGATGG + Intergenic
1037244662 8:16819302-16819324 CAGGGTTTCCAGCAACAAGAGGG - Intergenic
1038244134 8:25838486-25838508 GATAGTCACCAGAAAGAAAAAGG + Intergenic
1038422157 8:27440276-27440298 CTTGTTCTCCAGCCAGAAGAAGG - Exonic
1038654365 8:29435790-29435812 CATTTTCAGCAGGAAGAAGAAGG + Intergenic
1039356312 8:36820484-36820506 CACTGTCACCAGCAATAATATGG + Intronic
1040035209 8:42863314-42863336 CATGGGCAGAACCAAGAAGAGGG + Intronic
1040103688 8:43526737-43526759 CGAGGTCAGCATCAAGAAGATGG - Intergenic
1042492229 8:69412662-69412684 CAAGGTCAAGAGCAAGAATAAGG + Intergenic
1044240384 8:89881438-89881460 CATGGTCACCAGGGAAAAGTTGG + Intergenic
1044371790 8:91420526-91420548 CATGGTGACTAGCTTGAAGAAGG + Intergenic
1044602967 8:94024311-94024333 CAAGGTTACCAGGATGAAGAAGG + Intergenic
1045081407 8:98629734-98629756 CATGGTTCCCATCAAGAATACGG - Intronic
1045508252 8:102794072-102794094 CATGCTTCCCAGCCAGAAGAAGG + Intergenic
1047311290 8:123694543-123694565 TCTGGTCAACAGCAAGAAAATGG + Intronic
1048032581 8:130646555-130646577 CCTGGTCCATAGCAAGAAGATGG + Intergenic
1048980868 8:139702990-139703012 CATGGCCGCCAGCAAGGAGCCGG + Exonic
1051126619 9:13812468-13812490 CATGGTTACCAGTTAAAAGATGG + Intergenic
1051899566 9:22024516-22024538 CTTGGTCACCTGCAAGCAGGAGG + Intronic
1052877634 9:33579107-33579129 CAAGGTCAGCATCAAGAAGATGG - Intergenic
1052878080 9:33582161-33582183 CAAGGTCAGCATCAAGAAGATGG - Intergenic
1052878952 9:33588342-33588364 CAAGGTCAGCATCAAGAAGATGG - Intergenic
1052879825 9:33594531-33594553 CAAGGTCAGCATCAAAAAGATGG - Intergenic
1053196029 9:36119691-36119713 CATGGTCTCCAGAAGGAAAAGGG - Intronic
1053496155 9:38549698-38549720 CAAGGTCAGCATCAAAAAGATGG + Intronic
1053497024 9:38555877-38555899 CAAGGTCAGCATCAAGAAGATGG + Intronic
1053497903 9:38562048-38562070 CAAGGTCAGCATCAAGAAGATGG + Intronic
1053498354 9:38565101-38565123 CAAGGTCAGCATCAAGAAGATGG + Intronic
1053913274 9:42926447-42926469 CTAGGTCAGCATCAAGAAGATGG - Intergenic
1053914761 9:42937360-42937382 CCAGGTCACCATCATGAAGATGG - Intergenic
1054374955 9:64442496-64442518 CTAGGTCAGCATCAAGAAGATGG - Intergenic
1055564033 9:77549950-77549972 CATGTTCACCCCCAAGACGATGG - Intronic
1056722267 9:89082305-89082327 CCATGTCACCAGCAAGAAGCTGG - Intronic
1057161086 9:92888933-92888955 CAAGGTCAGCATCAAGAAGAAGG + Intergenic
1057161519 9:92892011-92892033 CAAGGTCAGCATCAAAAAGATGG + Intergenic
1057208636 9:93187657-93187679 CAAGGTCACCAGTGAGGAGATGG + Intronic
1057677371 9:97146537-97146559 CTAGGTCAGCATCAAGAAGAAGG + Intergenic
1057677818 9:97149588-97149610 CAAGGTCAGCATCAAGAAGATGG + Intergenic
1058626478 9:106938902-106938924 CATGCTCACCTGGAAGAGGATGG - Exonic
1062126263 9:134864616-134864638 CATGGTCCACAGGAAGGAGAGGG - Intergenic
1203774652 EBV:65969-65991 CAAGGTCACCAACAAGGAGGAGG + Intergenic
1203546469 Un_KI270743v1:132224-132246 CTAGGTCAGCATCAAGAAGATGG + Intergenic
1185659878 X:1719354-1719376 CAAGGCCACCAGCATGAAGGAGG - Intergenic
1187137060 X:16558260-16558282 CCTGGTCACCAGGTAGAGGAGGG - Intergenic
1188413430 X:29902283-29902305 GGTGGACACCAGCCAGAAGAGGG - Intronic
1189594565 X:42550035-42550057 CAAGGACAGCACCAAGAAGATGG + Intergenic
1192134655 X:68585899-68585921 CATGGGGAGCAGGAAGAAGACGG + Intergenic
1192304629 X:69945757-69945779 CATGGTCACAAGCAAGAGTCAGG + Intronic
1192989876 X:76439061-76439083 CAAGGTCACAAGCAAATAGAAGG - Intergenic
1195218416 X:102722591-102722613 GATGGTCACCAGAAAGACCAAGG - Intronic
1197168563 X:123406430-123406452 GATGGAAACCAGCAAGAATAAGG + Intronic