ID: 1138512768

View in Genome Browser
Species Human (GRCh38)
Location 16:57518241-57518263
Sequence GGCCGAAAACGCTGCGGAGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 43
Summary {0: 1, 1: 0, 2: 2, 3: 2, 4: 38}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138512768_1138512779 28 Left 1138512768 16:57518241-57518263 CCCACTCCGCAGCGTTTTCGGCC 0: 1
1: 0
2: 2
3: 2
4: 38
Right 1138512779 16:57518292-57518314 GGCAGAGTGAGGACTCCCAGCGG 0: 1
1: 0
2: 6
3: 38
4: 275
1138512768_1138512776 7 Left 1138512768 16:57518241-57518263 CCCACTCCGCAGCGTTTTCGGCC 0: 1
1: 0
2: 2
3: 2
4: 38
Right 1138512776 16:57518271-57518293 GCTCCATCTGCAGCAGGGCAGGG 0: 1
1: 0
2: 5
3: 35
4: 431
1138512768_1138512772 1 Left 1138512768 16:57518241-57518263 CCCACTCCGCAGCGTTTTCGGCC 0: 1
1: 0
2: 2
3: 2
4: 38
Right 1138512772 16:57518265-57518287 GCAGCCGCTCCATCTGCAGCAGG 0: 1
1: 0
2: 1
3: 27
4: 304
1138512768_1138512778 17 Left 1138512768 16:57518241-57518263 CCCACTCCGCAGCGTTTTCGGCC 0: 1
1: 0
2: 2
3: 2
4: 38
Right 1138512778 16:57518281-57518303 CAGCAGGGCAGGGCAGAGTGAGG 0: 2
1: 2
2: 10
3: 133
4: 979
1138512768_1138512775 6 Left 1138512768 16:57518241-57518263 CCCACTCCGCAGCGTTTTCGGCC 0: 1
1: 0
2: 2
3: 2
4: 38
Right 1138512775 16:57518270-57518292 CGCTCCATCTGCAGCAGGGCAGG 0: 1
1: 0
2: 1
3: 23
4: 212
1138512768_1138512773 2 Left 1138512768 16:57518241-57518263 CCCACTCCGCAGCGTTTTCGGCC 0: 1
1: 0
2: 2
3: 2
4: 38
Right 1138512773 16:57518266-57518288 CAGCCGCTCCATCTGCAGCAGGG 0: 1
1: 0
2: 1
3: 26
4: 333

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138512768 Original CRISPR GGCCGAAAACGCTGCGGAGT GGG (reversed) Exonic
906197156 1:43936343-43936365 GGCCGAGAAGGCTGCGGCGGCGG - Exonic
912576350 1:110675284-110675306 GGCCGAAAACCCTGGCGACTGGG - Intergenic
1074085176 10:110204356-110204378 GGCAGAAAAGGCTGGTGAGTGGG + Intergenic
1077886282 11:6390373-6390395 GGCTGTCAACGCTGCGGAGGCGG - Intergenic
1088457833 11:110050651-110050673 AACCGAAAACTCTGCTGAGTTGG - Intergenic
1089209678 11:116791687-116791709 GGCCGAAAACGCTGTGGAGAGGG + Exonic
1115306268 14:31937010-31937032 GGGAAAAAACTCTGCGGAGTGGG + Intergenic
1138512768 16:57518241-57518263 GGCCGAAAACGCTGCGGAGTGGG - Exonic
1139676706 16:68528944-68528966 GGCCTCAAACGCTGCAGAGAGGG + Intergenic
1142808947 17:2386401-2386423 GGCCCAGAAAGCTGCGGATTGGG - Exonic
1146842568 17:36166141-36166163 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146854880 17:36254100-36254122 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146865740 17:36334276-36334298 GGCTGAACACCCTGCGGAGCGGG + Exonic
1146870780 17:36377992-36378014 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146882088 17:36450220-36450242 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1147068610 17:37934888-37934910 GGCTGAACACCCTGCGGAGCGGG + Exonic
1147073664 17:37978616-37978638 GGCTGAACACCCTGCGGAGCGGG - Intronic
1147080132 17:38014425-38014447 GGCTGAACACCCTGCGGAGCGGG + Intronic
1147085185 17:38058154-38058176 GGCTGAACACCCTGCGGAGCGGG - Exonic
1147096081 17:38138385-38138407 GGCTGAACACCCTGCGGAGCGGG + Intergenic
1147101131 17:38182120-38182142 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1148647189 17:49225817-49225839 GGCTGAAAAGGCAGAGGAGTGGG + Intronic
1149845730 17:60008626-60008648 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1150084078 17:62265206-62265228 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1152745577 17:82037212-82037234 GGCCGAAATGGCTGCGAAGCAGG - Intronic
932595596 2:73091802-73091824 GGCCGCTCAGGCTGCGGAGTAGG - Intronic
935574057 2:104690784-104690806 GGCCAAAAACGCTGGGGAGGTGG - Intergenic
942098619 2:172556455-172556477 GGGCGGAAACGCTGAGGAGGAGG - Intronic
943907239 2:193515137-193515159 GGCAGAAAACGATGGGGAGCTGG + Intergenic
1178613609 21:34110160-34110182 GGCCTTAAAAGCTGCGTAGTTGG + Intronic
1183427282 22:37746559-37746581 GGCCGAAAGCGCTTCGGAGGTGG - Intronic
1184105390 22:42364715-42364737 GGGGGAAAACGCTGGGGAATTGG + Intergenic
961636856 3:128338687-128338709 GGCCGAAAAGGCTGTGGAGTTGG + Intronic
985668205 5:1192767-1192789 GGGAGAAAAGGCTGAGGAGTGGG + Intergenic
1001822318 5:174720163-174720185 GGCGGAAAACGGTGAGAAGTAGG + Intergenic
1002186157 5:177455712-177455734 GTCCGATTCCGCTGCGGAGTGGG - Exonic
1004512052 6:16291136-16291158 GGCTGAAAATGCTGCTGTGTCGG - Intronic
1005863118 6:29916563-29916585 GGCCTAAAATGCTGATGAGTTGG - Intergenic
1006456210 6:34133424-34133446 GGCCGTAAAGGCTGAGGAGCAGG + Exonic
1037419168 8:18683786-18683808 AGCAGAAAACTCTGAGGAGTTGG + Intronic
1058668616 9:107342223-107342245 TGCCGTAAATGCAGCGGAGTAGG + Intergenic
1187167968 X:16822503-16822525 GGCCGAAAACACAGCGTGGTTGG + Intronic
1191861209 X:65667816-65667838 GGCGGCAAAGGCAGCGGAGTTGG - Exonic