ID: 1138517068

View in Genome Browser
Species Human (GRCh38)
Location 16:57541972-57541994
Sequence CCTGAAGCCCAGAGAGGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138517068_1138517072 1 Left 1138517068 16:57541972-57541994 CCAGGTCCTCTCTGGGCTTCAGG No data
Right 1138517072 16:57541996-57542018 CCCTCATCTGTGAAATATGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138517068 Original CRISPR CCTGAAGCCCAGAGAGGACC TGG (reversed) Intergenic