ID: 1138517068 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 16:57541972-57541994 |
Sequence | CCTGAAGCCCAGAGAGGACC TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1138517068_1138517072 | 1 | Left | 1138517068 | 16:57541972-57541994 | CCAGGTCCTCTCTGGGCTTCAGG | No data | ||
Right | 1138517072 | 16:57541996-57542018 | CCCTCATCTGTGAAATATGACGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1138517068 | Original CRISPR | CCTGAAGCCCAGAGAGGACC TGG (reversed) | Intergenic | ||