ID: 1138517072

View in Genome Browser
Species Human (GRCh38)
Location 16:57541996-57542018
Sequence CCCTCATCTGTGAAATATGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138517061_1138517072 25 Left 1138517061 16:57541948-57541970 CCACTTGGCAACTCTGGGCCAGG No data
Right 1138517072 16:57541996-57542018 CCCTCATCTGTGAAATATGACGG No data
1138517066_1138517072 7 Left 1138517066 16:57541966-57541988 CCAGGCCCAGGTCCTCTCTGGGC No data
Right 1138517072 16:57541996-57542018 CCCTCATCTGTGAAATATGACGG No data
1138517070_1138517072 -5 Left 1138517070 16:57541978-57542000 CCTCTCTGGGCTTCAGGTCCCTC No data
Right 1138517072 16:57541996-57542018 CCCTCATCTGTGAAATATGACGG No data
1138517067_1138517072 2 Left 1138517067 16:57541971-57541993 CCCAGGTCCTCTCTGGGCTTCAG No data
Right 1138517072 16:57541996-57542018 CCCTCATCTGTGAAATATGACGG No data
1138517068_1138517072 1 Left 1138517068 16:57541972-57541994 CCAGGTCCTCTCTGGGCTTCAGG No data
Right 1138517072 16:57541996-57542018 CCCTCATCTGTGAAATATGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138517072 Original CRISPR CCCTCATCTGTGAAATATGA CGG Intergenic
No off target data available for this crispr