ID: 1138518582

View in Genome Browser
Species Human (GRCh38)
Location 16:57555763-57555785
Sequence AACCATATCAATAAGTAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 362
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 331}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138518582 Original CRISPR AACCATATCAATAAGTAAGA GGG (reversed) Intronic
900040352 1:456957-456979 AACAAAATGAATAAGTGAGAAGG - Intergenic
900061781 1:691928-691950 AACAAAATGAATAAGTGAGAAGG - Intergenic
904626367 1:31807031-31807053 CACAATATCATTAAGTTAGAAGG + Intronic
905603188 1:39271542-39271564 AACCATATCAACAAGTATTTGGG + Intronic
906835532 1:49079641-49079663 AACCATATCACTGGGTAAGTGGG + Intronic
908427679 1:64023803-64023825 AACCATATCAACATTTAATATGG - Intronic
909131431 1:71742050-71742072 AACTATATCAAGAAGTAATTAGG + Intronic
910202916 1:84718452-84718474 AACCATATACAGAAGTAAGGAGG - Intergenic
911118256 1:94268968-94268990 ATCCATATACATATGTAAGAAGG + Intronic
911895394 1:103427175-103427197 AACCACAACAATAAATAGGATGG + Intergenic
913018376 1:114762804-114762826 AACCATATCAATAATGAAAATGG - Intergenic
915923363 1:159995658-159995680 AACCATATCAAGAAGTAATCAGG + Intergenic
916030296 1:160871168-160871190 AACCATATCAGAATGTAAAATGG - Intergenic
916314300 1:163431089-163431111 AACCATATCAATAATTACATTGG - Intergenic
916546976 1:165815061-165815083 AACTATATCAAAAAGCAAGATGG + Intronic
917256333 1:173120597-173120619 AGCCATATCTCCAAGTAAGAGGG - Intergenic
917382340 1:174426934-174426956 AATCATAACAATATGTAATATGG + Intronic
918678279 1:187318012-187318034 ACCCATATCAATCAGAAACATGG - Intergenic
918844602 1:189593720-189593742 AACCATATCAATATGTTAAATGG - Intergenic
918908789 1:190537077-190537099 ACCTATATCATTAAGTATGAAGG - Intergenic
919156957 1:193777239-193777261 AACCATATCAATCAGGTATATGG + Intergenic
919586803 1:199449161-199449183 AACCATGTTATTCAGTAAGAAGG + Intergenic
920586021 1:207161820-207161842 AACCAAAGCAATTAGTAAAATGG + Intergenic
921028581 1:211314760-211314782 GACCATATTATTAAGTATGAGGG - Intronic
921231544 1:213077908-213077930 AATTATCTCAATAAGTAAAAGGG - Intronic
923276157 1:232398608-232398630 TACCATAGCAATAAGAAAGGAGG - Exonic
923432399 1:233935844-233935866 ATCCATACCAATGAGTAACAAGG - Intronic
923436550 1:233972870-233972892 CACCATGTCACTAAGTAACAAGG + Intronic
923794228 1:237137657-237137679 ATCCATTTGAATAAGTAGGAAGG + Intronic
923898909 1:238304232-238304254 AACCATATCAATAAGCACAGTGG + Intergenic
924409718 1:243791508-243791530 AACCAGAGCATTAAGTAAAATGG + Intronic
1063294005 10:4783107-4783129 ATCCATTTCAATAAGAAACAAGG - Intergenic
1064516701 10:16157234-16157256 AAACAAATCAATAAATAAGTAGG + Intergenic
1065640224 10:27774527-27774549 AACCATAGCAGTAACTTAGAAGG + Intergenic
1066416420 10:35225579-35225601 AACTATACTAATAAGTAAGCTGG - Intergenic
1068220576 10:54040169-54040191 AACCATCTCAATAGCAAAGATGG - Intronic
1068233944 10:54207854-54207876 GAACATATCACTAAATAAGAGGG - Intronic
1068342683 10:55728526-55728548 AAACAATTCAATTAGTAAGAAGG + Intergenic
1071134887 10:82442158-82442180 AAACATATCAAGTAGTCAGAAGG - Intronic
1071302754 10:84268969-84268991 AACCATCACCATAGGTAAGAGGG + Intergenic
1071314423 10:84380326-84380348 TTCCATATCAATAAGAAAAATGG - Intronic
1071926230 10:90412956-90412978 AACCATACCCTTAATTAAGAAGG + Intergenic
1072515011 10:96172398-96172420 AACCATAATAGTAAATAAGAAGG + Intronic
1073127771 10:101162602-101162624 AACCATCCCATCAAGTAAGATGG - Intergenic
1073741951 10:106417274-106417296 AACCATACCAAAAAGCAAGCAGG + Intergenic
1073801919 10:107050766-107050788 AACCATATATATACTTAAGAAGG - Intronic
1075588124 10:123671991-123672013 AATCATAATAATAAGCAAGAGGG + Intronic
1075965644 10:126609606-126609628 AACCACATGAAGAAGTAAGTTGG + Intronic
1076966572 11:92859-92881 AACAAAATGAATAAGTGAGAAGG - Intergenic
1078150464 11:8755306-8755328 CACCAAAGTAATAAGTAAGATGG - Intronic
1078684109 11:13510654-13510676 AACCATATCAATCACCAAGTGGG + Intergenic
1079141875 11:17816368-17816390 AAACATATCTATAAGCAAGCAGG + Intronic
1079503706 11:21131228-21131250 ATCTATAACAATAATTAAGAAGG + Intronic
1080114732 11:28609112-28609134 ACCCAAATCAATAGGTATGAGGG - Intergenic
1080522679 11:33081462-33081484 AACCATATCAATTATTATTAAGG - Intronic
1081466413 11:43322769-43322791 AATCTTATCAATAAGGAAGTGGG - Intronic
1081950010 11:47037241-47037263 AATGATATAAATAAATAAGAAGG + Intronic
1083016318 11:59457767-59457789 AACCATATCCATTAATAACACGG + Exonic
1086134129 11:83429981-83430003 AAACAGAGCAATAAGGAAGAAGG - Intergenic
1088268834 11:108012999-108013021 AGCCATATCATTAAGTTAAAGGG - Intronic
1088360234 11:108981673-108981695 AACCATATCAAACTGTATGAGGG - Intergenic
1090456540 11:126855141-126855163 AACCATATCAATAAGGTTGCAGG - Intronic
1090773555 11:129944015-129944037 AACATTATAAATAAATAAGAAGG + Intronic
1093150355 12:15613466-15613488 AACCATATCAAGAGTGAAGAGGG + Intergenic
1093238783 12:16642668-16642690 AACTATATCAATGACCAAGAGGG + Intergenic
1093541798 12:20296347-20296369 ATCCACATCAAAAAGTTAGAAGG - Intergenic
1095173953 12:39068641-39068663 AATGTTATCAATAAGTAAAATGG + Intergenic
1095269989 12:40206989-40207011 AACAATAACAAAAAGTAATATGG - Intronic
1097353764 12:58578110-58578132 AAATATATAAATAAATAAGACGG - Intronic
1098790212 12:74812992-74813014 AAAAATACCAATAAGAAAGATGG - Intergenic
1099172605 12:79382658-79382680 AACCACATCATTTAATAAGATGG - Intronic
1100707721 12:97219716-97219738 AACCAAATGAATAAGTGACACGG - Intergenic
1100895385 12:99176555-99176577 AACTATATCAATCAGTAAGCTGG - Intronic
1101090995 12:101285189-101285211 AACCTTATAAAGAAGTAATATGG - Intronic
1101449851 12:104766292-104766314 AACCATATCAATCTGTAAAAAGG - Intergenic
1101615603 12:106333985-106334007 AACCACAGGAATGAGTAAGATGG + Intronic
1102944397 12:116973171-116973193 AAACAGATCAATAAATAAAAAGG + Intronic
1107952837 13:45479936-45479958 AACCGTTTCAATACTTAAGAAGG - Intronic
1109389076 13:61670139-61670161 AACCATACCCTTAATTAAGAAGG - Intergenic
1111323078 13:86655909-86655931 AACCATATTCATAAGTACCAGGG + Intergenic
1111342606 13:86907382-86907404 AACCTTATAAATAAGTCAGAAGG - Intergenic
1113196738 13:107817104-107817126 AACCATATCAATAAATGAAGAGG + Intronic
1115004917 14:28469984-28470006 AATCATATAACTAAGAAAGATGG + Intergenic
1115773507 14:36690165-36690187 AACCATAATAATAAATAACAAGG + Intronic
1115863356 14:37713878-37713900 TAGTATATCAATAAGTTAGAGGG + Intronic
1116468468 14:45260425-45260447 AACCATATCACCAAGTACGAAGG - Intergenic
1116644752 14:47512489-47512511 TACCATTTCAGTAAGTAAAATGG - Intronic
1116843409 14:49842406-49842428 AACCTTTTCAATAAAAAAGAAGG + Intronic
1118592032 14:67409243-67409265 AACAAAATAAATAAGTAACAGGG + Intronic
1118703425 14:68458088-68458110 AACCAGAACAAAAAATAAGATGG + Intronic
1121372833 14:93375884-93375906 AACCATATCAATGAGTCATCGGG + Intronic
1121733379 14:96201942-96201964 ATAAATAGCAATAAGTAAGACGG + Intergenic
1121760047 14:96436988-96437010 ACTCATATCAATAATAAAGATGG + Intronic
1122462543 14:101907466-101907488 TACCATATTAATAAATAATATGG - Intronic
1124826464 15:33101109-33101131 AACAATAAAAATAAGTAAAAAGG + Intronic
1126255488 15:46620145-46620167 AAAAATATCAAAATGTAAGATGG - Intergenic
1127181832 15:56428489-56428511 AACCACTACAATAAGTAAAATGG - Intronic
1127737992 15:61863506-61863528 AATCATATCAAAAAGTTGGAAGG - Exonic
1128591727 15:68903958-68903980 AAACATATAAATAAATAAGGTGG - Intronic
1131450501 15:92535551-92535573 AACCGTATCAACAAGTCAGCGGG + Intergenic
1131924040 15:97362508-97362530 AACCATAACAATAATCATGAAGG - Intergenic
1132441557 15:101870664-101870686 AACAAAATGAATAAGTGAGAAGG + Intergenic
1134895124 16:17879350-17879372 GACCCTCTGAATAAGTAAGAAGG + Intergenic
1134897196 16:17898813-17898835 AACCATATCAAGAGATAAAAAGG + Intergenic
1135266983 16:21035515-21035537 AAATATATCAAAAAGTAAGATGG + Intronic
1137781202 16:51099151-51099173 AACCATATCAGTTAGTAAGGAGG - Intergenic
1138518582 16:57555763-57555785 AACCATATCAATAAGTAAGAGGG - Intronic
1138724727 16:59123534-59123556 AAGCATATAAATAAATAAAAGGG - Intergenic
1139363810 16:66420523-66420545 AAACATATGAATAAGTTACAGGG - Intergenic
1139937992 16:70584999-70585021 AACCTTAAAAATAATTAAGATGG - Intronic
1140262996 16:73396813-73396835 AACCATATCACTAAGCACCAGGG + Intergenic
1140302477 16:73771857-73771879 AACCATATCAATGAGAGAAAAGG - Intergenic
1140336879 16:74115687-74115709 AACAAAATCAATAAGCAAAAAGG + Intergenic
1140566016 16:76043580-76043602 AACCATATCAAGGACTAAGTAGG - Intergenic
1140923975 16:79565423-79565445 AACCATATCACTGAGTGAAAGGG - Intergenic
1142989268 17:3718678-3718700 AAAAGTATCAGTAAGTAAGAGGG + Intronic
1143047301 17:4092098-4092120 AATAATATAAATAAATAAGAAGG + Intronic
1147037640 17:37693678-37693700 AACCATATCACTAGGTATCAAGG - Intronic
1147415206 17:40284088-40284110 AACCATATTAATAACAATGATGG - Exonic
1147449611 17:40496005-40496027 CACCATGTCAATGAGAAAGAAGG - Exonic
1151905559 17:77046252-77046274 AACCATATTGATAATTAATAAGG - Intergenic
1153446436 18:5178187-5178209 ATGCATATCAATAAGCAGGAGGG - Intronic
1153568289 18:6442942-6442964 AACCATATCACTAGGGAAGAAGG - Intergenic
1153862359 18:9225942-9225964 AAACATATCAAAAAATAATATGG - Intronic
1154043829 18:10885426-10885448 AAACAAATCAATAAATAAAAAGG + Intronic
1155784810 18:29883260-29883282 AACCACATCCTTAATTAAGAAGG - Intergenic
1156796487 18:41052598-41052620 AACCATATCAATTGGTAATTTGG - Intergenic
1157694059 18:49706743-49706765 AAACATTTCAAGAGGTAAGATGG - Intergenic
1158310981 18:56158046-56158068 CACCATTTGAAAAAGTAAGAAGG + Intergenic
1159230057 18:65594919-65594941 TTCCATATCAATAGGTGAGAAGG - Intergenic
1159295904 18:66488136-66488158 AAACATATCACTTAGGAAGATGG + Intergenic
1159321595 18:66857825-66857847 AGGCATACCAATGAGTAAGAAGG + Intergenic
1159513065 18:69421551-69421573 ACCAATATCAATAGGTAAAATGG - Intronic
1159744150 18:72210640-72210662 AGCGATGTCAATAAATAAGATGG + Intergenic
1160320262 18:77884721-77884743 AACCATCTACATAAGTATGAAGG + Intergenic
1160643375 19:162482-162504 AACAAAATGAATAAGTGAGAAGG - Intergenic
1162290081 19:9772643-9772665 AACCATATCAATTATGAATATGG + Intronic
1163680846 19:18681528-18681550 AATCATATCAAGAAGGAAGATGG + Intergenic
1167195782 19:48027241-48027263 AACCACATCAATAGGTAACATGG - Intergenic
1167495339 19:49814695-49814717 AAAAATATCAATAGGCAAGAAGG - Intronic
925036524 2:691331-691353 AATTGAATCAATAAGTAAGATGG - Intergenic
925445917 2:3926726-3926748 AACCATATAAAGAAATGAGAAGG - Intergenic
926335316 2:11858382-11858404 AACCATGTCATGAGGTAAGATGG + Intergenic
927034530 2:19159918-19159940 AATCATTTCACTAAGAAAGAAGG + Intergenic
929321788 2:40552425-40552447 ACCCAAATAAATAAATAAGATGG - Intronic
930380812 2:50625287-50625309 AACCATAGCAATAAATATCACGG + Intronic
930634061 2:53786008-53786030 AACCAAATCAAAAAGCAGGAAGG - Intronic
931111376 2:59114924-59114946 AACCATATCAGACAGCAAGAGGG + Intergenic
932605247 2:73161077-73161099 GACAATCTCAATGAGTAAGAGGG + Intergenic
932630205 2:73335499-73335521 AACCATATCAATAATTACATTGG + Intergenic
932982504 2:76686881-76686903 AATCATATCAATTGGTTAGAAGG - Intergenic
933398036 2:81756061-81756083 AACCATATCACAAAATATGAAGG + Intergenic
933413663 2:81956533-81956555 AACCACAACATTAAGTAAAAAGG - Intergenic
933618893 2:84514129-84514151 AACCAGAGCAATAAATAACATGG - Intergenic
935364309 2:102272951-102272973 AACCCTATCAATAAGTGATAAGG - Intergenic
936717592 2:115206609-115206631 AACCAAATAAATGAGTAACATGG + Intronic
937632484 2:124118977-124118999 CACCATATCCACTAGTAAGATGG - Intronic
937663978 2:124463412-124463434 AACCAAAACAATAAGAAAAATGG + Intronic
939468158 2:142584925-142584947 AACCATATCAGACAGTAAAAGGG - Intergenic
940913883 2:159233548-159233570 AACCAAAACCATCAGTAAGAGGG - Intergenic
941399572 2:165014143-165014165 GTCCAGATCAATAAGTCAGATGG + Intergenic
942548249 2:177087622-177087644 AAACATTTCAATATTTAAGATGG + Intergenic
943292083 2:186086535-186086557 AACTATATTACTAATTAAGATGG - Intergenic
945123958 2:206488152-206488174 AACCATGTCAGTCAGCAAGAAGG - Intronic
945730105 2:213523034-213523056 AACCATATCAATTAGTAATTGGG - Intronic
1169168615 20:3445433-3445455 AACTATATTAATCAGTCAGAAGG + Intergenic
1170710989 20:18790744-18790766 AACTGTATCAAAAAATAAGATGG - Intergenic
1170895422 20:20408675-20408697 AATCATATCACCAAGAAAGAGGG - Intronic
1171399538 20:24863611-24863633 AACCATATCAAGCAGTGACAGGG - Intergenic
1173285368 20:41666678-41666700 AAAGCTATCAATAAGTATGAGGG - Intergenic
1173816340 20:45991440-45991462 TCCCATATCAAGAAGTAGGATGG + Intergenic
1174488001 20:50873275-50873297 AACCATTTCAAAAAGGAACAGGG + Intronic
1174852560 20:54008703-54008725 TACCATACCAAGAACTAAGAAGG + Intronic
1177563025 21:22781256-22781278 AACCAAAGTAAGAAGTAAGAAGG - Intergenic
1178736113 21:35153239-35153261 AACAACAGCAATAAGTTAGAAGG + Intronic
1179133326 21:38658721-38658743 TACCAGATACATAAGTAAGAAGG - Intronic
1182437437 22:30339764-30339786 AAACACATAAATAAATAAGATGG + Intronic
1182460647 22:30481381-30481403 AACCATATGAAGAAGGATGAAGG - Intergenic
1182842955 22:33406752-33406774 AACTATATCAATTATTAAGAGGG + Intronic
1183043417 22:35200656-35200678 AACCATATCACTTACTAAAATGG - Intergenic
949124241 3:426644-426666 AATCTTATCAATTTGTAAGATGG + Intergenic
950724738 3:14909421-14909443 AACCATATTCATAAAAAAGAAGG + Intronic
951054146 3:18127841-18127863 AACTATGTCAGAAAGTAAGATGG - Intronic
951100072 3:18677252-18677274 AAGCATATCTATAAGAAAGGAGG - Intergenic
951528431 3:23676394-23676416 AACTACATCACCAAGTAAGATGG - Intergenic
952462790 3:33547104-33547126 AACCATATCAATGACCAAGAGGG - Intronic
952689046 3:36182036-36182058 AACCATATCAAATAGCAATATGG + Intergenic
954505399 3:51066556-51066578 AACCATCTAATTAAGTGAGAGGG + Intronic
955005848 3:54967667-54967689 AACCATCTCAGGAAGTAAAATGG - Intronic
955792528 3:62603387-62603409 GAATATAACAATAAGTAAGATGG - Intronic
956302555 3:67788457-67788479 AACCATATCACTAACTGATAGGG - Intergenic
957334756 3:78812618-78812640 AATAATATAAATAAGTAAAATGG - Intronic
957720386 3:83988276-83988298 AACCATAAAAATAAATAATAAGG - Intergenic
958561161 3:95747890-95747912 AAACATTTCAATAAAGAAGACGG + Intergenic
959255698 3:104010061-104010083 GACAATATCAATAAGGAATAAGG - Intergenic
959347417 3:105216477-105216499 AACAATAATAATAAATAAGAGGG + Intergenic
959576157 3:107936359-107936381 AACAATGTAAACAAGTAAGAGGG + Intergenic
960329370 3:116339386-116339408 AACCAAAGCCATAAGAAAGAGGG + Intronic
960660563 3:120053527-120053549 AACCACATCAATGAGTTAGTGGG + Intronic
962607947 3:137048378-137048400 AACCATATAAATAAGTGTTAAGG + Intergenic
963356924 3:144220127-144220149 AATAATTTCAATAAGTCAGAAGG - Intergenic
963367339 3:144353014-144353036 TACCCCATCAATCAGTAAGAAGG - Intergenic
963423105 3:145087411-145087433 AACCATACCACTAAGTAAGATGG + Intergenic
963814527 3:149814258-149814280 TACAATATAAATAAGTAAGGTGG + Intronic
964302671 3:155306459-155306481 ATCCATATAAAAAAGTATGATGG - Intergenic
965069874 3:163906384-163906406 AACAATATAAGTAAGGAAGAAGG - Intergenic
965183345 3:165433382-165433404 AACCATATCACTAAGGAAGGAGG - Intergenic
965207918 3:165745470-165745492 AAAAATATAAATAAGTAACATGG + Intergenic
965320302 3:167245500-167245522 AACCATATCACCACTTAAGAAGG - Intronic
965689949 3:171345160-171345182 AATCATTTCAGTAAGTAAAAGGG - Intronic
966083450 3:176035938-176035960 AACAAAATCAATATGTTAGAGGG - Intergenic
966747613 3:183293004-183293026 AACTATATCAATAATGATGATGG + Intronic
970322341 4:14887084-14887106 AAACATATGAATATGCAAGAAGG + Intergenic
970461121 4:16275923-16275945 AACCATATCAACATGTTTGAGGG - Intergenic
970735261 4:19159244-19159266 CAGCATATCAATATGTAAGTGGG - Intergenic
970757835 4:19447898-19447920 AACCATATCACAAAGATAGAAGG + Intergenic
971263839 4:25081039-25081061 AACCATATCAATTACTAATTAGG - Intergenic
971673275 4:29592115-29592137 AAACATATAAATAAGAATGAGGG + Intergenic
971884506 4:32425896-32425918 AACCATATCAATAATAAAATAGG - Intergenic
971900469 4:32651323-32651345 AACCATATCAATTAATAATTGGG + Intergenic
972384689 4:38553615-38553637 AACCATATCAGTTGGTAAGATGG + Intergenic
972731714 4:41801378-41801400 AACCATATCAACAAGTAAGGTGG - Intergenic
973678471 4:53290066-53290088 AACCACATCAAAAATTAATAAGG + Intronic
973875008 4:55208749-55208771 AAACAGATCAATAAGACAGAAGG + Intergenic
976744244 4:88387831-88387853 CACCATGTCCATAATTAAGAAGG - Intronic
977340453 4:95750981-95751003 AAACATAACAATAAATAAGAGGG - Intergenic
977362902 4:96029112-96029134 AACCATATCAATGATTATTAGGG + Intergenic
977620663 4:99133387-99133409 AAGCACATCAAAAAGAAAGAGGG + Intronic
978085891 4:104653584-104653606 AACCATAGCAATAGCTAAGTGGG + Intergenic
978298687 4:107239717-107239739 AACCATCACAATGAGGAAGAGGG + Intronic
978639200 4:110848915-110848937 AACCATAACTATATATAAGAAGG + Intergenic
979546461 4:121945668-121945690 AACCATATCAATTAGCAGGTGGG - Intronic
979740075 4:124138798-124138820 AATCATATCAATAGGTAAAGAGG - Intergenic
979880235 4:125946989-125947011 CATGATATCAGTAAGTAAGATGG + Intergenic
980722647 4:136717848-136717870 AACCATACTCATAATTAAGAAGG + Intergenic
983309591 4:166041760-166041782 TACCATATGTAGAAGTAAGATGG - Intronic
983539568 4:168894730-168894752 AACAGTATCCATAAGGAAGATGG - Intronic
984477827 4:180259369-180259391 AATCATCTCAATAAGGAGGAGGG + Intergenic
984854569 4:184183707-184183729 ATGCATATCAATAAGTCACATGG + Intronic
986549910 5:8940993-8941015 AACCATATCAATGACCAAGGAGG + Intergenic
987475825 5:18391716-18391738 AACAATATCAATAATTACAAGGG + Intergenic
987496225 5:18648501-18648523 AACCATATCAATGACCAAGGGGG - Intergenic
988655317 5:33205164-33205186 AACCAAGTCAATATGGAAGAGGG + Intergenic
989701566 5:44271984-44272006 AAAGATAGCAATAAGTAAAAAGG + Intergenic
990102539 5:52210498-52210520 AACCAAAGCAGTAAGGAAGAAGG - Intergenic
990491601 5:56308395-56308417 AAGCATATCAAAAGGCAAGATGG - Intergenic
990548301 5:56845661-56845683 ACACAGATCAGTAAGTAAGAAGG - Intronic
992971385 5:82062501-82062523 AACCAAAACAGGAAGTAAGAAGG - Intronic
993172654 5:84439078-84439100 AGCCATATCCATAACTAAAAAGG - Intergenic
993198691 5:84783436-84783458 AACCATATCAATTGCAAAGAAGG + Intergenic
993267243 5:85741439-85741461 AACCATATCAATATGTAAACAGG + Intergenic
993595923 5:89855391-89855413 AACCATCTCAAAATGTTAGAGGG - Intergenic
994349817 5:98731959-98731981 CAGCATAAGAATAAGTAAGATGG - Intergenic
994386797 5:99142613-99142635 AACCATATCACTGGGTGAGATGG - Intergenic
994488377 5:100408952-100408974 AACAATATCAATGAATAAGAAGG + Intergenic
996168829 5:120263153-120263175 AACAATCTCAATGAGGAAGATGG + Intergenic
997034318 5:130169797-130169819 AAACATATGAATTAGAAAGAAGG + Intronic
997798475 5:136835208-136835230 AACCATATCAGCAACTTAGAAGG + Intergenic
998940940 5:147281063-147281085 AACCATATCCATAGGAAAGGAGG + Intronic
1000162058 5:158607574-158607596 AACAATAGCAATCAGTAAGTTGG - Intergenic
1000800358 5:165719048-165719070 AACCATATCACTATGTTATAGGG + Intergenic
1001534563 5:172489560-172489582 AACCATATCAGTCAGTATCAGGG + Intergenic
1002733495 5:181361988-181362010 AACAAAATGAATAAGTGAGAAGG + Intergenic
1002751046 6:112130-112152 AACAAAATGAATAAGTGAGAAGG - Intergenic
1003305611 6:4924617-4924639 AAGCATATCATTAAGTTGGATGG + Intronic
1003647746 6:7928264-7928286 AAACAGATCAATAAGACAGAAGG + Intronic
1008737758 6:54566715-54566737 CAACATATCAATAAGTTAAAAGG + Intergenic
1008808401 6:55460739-55460761 ATCCATATCTAAAAGTAAGGGGG + Intronic
1009889737 6:69666318-69666340 AACCATATCAATATCTAACATGG - Intergenic
1010063484 6:71652703-71652725 AACAATATAATTAAATAAGAAGG - Intergenic
1010379852 6:75211824-75211846 ATCGTTATCAATAAGTATGAAGG + Intergenic
1010832078 6:80543030-80543052 AACCATATCAGCAAGGAAGAGGG + Intergenic
1011439490 6:87372402-87372424 AACCATATCATTATGTTTGAGGG + Intronic
1011457835 6:87571048-87571070 AACCATATCAATATGGCATAGGG - Intronic
1011658445 6:89573472-89573494 ACCCAGATCAATCAGAAAGAAGG - Intronic
1011966899 6:93170980-93171002 AATTATATCATTAAGTAATATGG + Intergenic
1012301173 6:97590270-97590292 AACTATATGAATAAGGAGGAAGG - Intergenic
1012944730 6:105453132-105453154 AACCAAATCAAAAATTGAGAAGG - Intergenic
1013254203 6:108367883-108367905 AACCATTGCAATTAGTAACATGG + Intronic
1015128250 6:129778670-129778692 CACAATATTAATATGTAAGATGG - Intergenic
1017938502 6:159029099-159029121 TATCATATTAATAAGTTAGAGGG - Intergenic
1018511601 6:164529948-164529970 AACCATAGCAAGAAGAGAGAAGG + Intergenic
1019237745 6:170634310-170634332 AACAAAATGAATAAGTGAGAAGG + Intergenic
1019877984 7:3832252-3832274 AATCATCTCAATAAGTAAAATGG - Intronic
1020652557 7:10893209-10893231 AACCATATCAGTAGGTGACAGGG - Intergenic
1022190694 7:28014354-28014376 AACCATATCAACCCATAAGATGG - Intronic
1022354374 7:29598648-29598670 AACCATATCGAAAAGAAATAGGG - Intergenic
1022635348 7:32127712-32127734 AATCATATCAAAAATTAATAAGG + Intronic
1022949847 7:35327604-35327626 AAGAAAATCAATCAGTAAGATGG - Intergenic
1023782899 7:43674263-43674285 ACACATATAAATAACTAAGATGG + Intronic
1024001564 7:45193104-45193126 AACCATATCAACAATCAGGATGG + Intergenic
1024962078 7:54987428-54987450 AACAATATAAATAAGAAAAATGG + Intergenic
1028158784 7:87462651-87462673 ATCCAAATCATTAAATAAGATGG + Intronic
1030503791 7:110393917-110393939 TACCATATCAACAAGTTAAAGGG + Intergenic
1031885400 7:127240890-127240912 AACCATTTCTCTTAGTAAGAGGG - Intronic
1032648385 7:133851246-133851268 AAACACATAAATAAGCAAGATGG + Intronic
1033410054 7:141109173-141109195 AACCATATCAAGGAGTTAGTTGG + Intronic
1033627624 7:143126233-143126255 AACCAGAACAATGAGGAAGACGG - Intergenic
1033808791 7:144985338-144985360 AACCATCACAATAATTTAGAAGG - Intergenic
1035510023 8:172301-172323 AACAAAATGAATAAGTGAGAAGG - Intergenic
1036114772 8:5946621-5946643 AACCACATCAACAGGTGAGAGGG + Intergenic
1036407425 8:8467802-8467824 AAGCATTTCAATAAATAAAATGG + Intergenic
1036732429 8:11277546-11277568 AACCATATCAGTAACCAAGGTGG + Intergenic
1037294378 8:17385275-17385297 AACCATATCAAGTACCAAGAGGG - Intronic
1037458824 8:19088638-19088660 AACCATATCAATAATTTACTTGG + Intergenic
1039348479 8:36734346-36734368 GACCATTTCTATAAGTAAGTTGG + Intergenic
1039668001 8:39557633-39557655 AACTATATCAAGAGGTAAAATGG + Intergenic
1039723648 8:40191779-40191801 AAGCATATCAATAAAAAATATGG - Intergenic
1039731192 8:40280554-40280576 AACCATATCATTCAGTCATATGG - Intergenic
1040742787 8:50600463-50600485 AACCATACCAATCACAAAGAAGG - Intronic
1041298455 8:56386687-56386709 AAACACATCAAGAAGTAAAAAGG - Intergenic
1042657895 8:71120320-71120342 AACAATATCACCAAGTTAGAAGG + Intergenic
1043007938 8:74844047-74844069 AAAAATCTCAGTAAGTAAGAAGG - Exonic
1043555236 8:81422595-81422617 AACCATTTCAAAAGGAAAGAAGG + Intergenic
1044020014 8:87094489-87094511 AAAAATATCAAAAAGGAAGAAGG + Intronic
1044039387 8:87347515-87347537 AAACAAATCAATAACTTAGATGG + Intronic
1044100819 8:88135946-88135968 AACCATAGCAATAAATAAACAGG + Intronic
1044588915 8:93895002-93895024 AAACGTATCAATAAATTAGATGG + Intronic
1045640261 8:104242054-104242076 AACTATATCAAAAAGTAGGCTGG - Intronic
1046692253 8:117298979-117299001 AACTATATCAGTCAGCAAGATGG - Intergenic
1047865733 8:129022555-129022577 AACCATATCACTTAGTAAACTGG - Intergenic
1048403991 8:134099995-134100017 ACCCATATCAATAATGAAAAAGG + Intergenic
1048591968 8:135828709-135828731 AACCATATCAATCCACAAGAGGG - Intergenic
1049366572 8:142239975-142239997 ATACAGATCAAAAAGTAAGAAGG + Intronic
1049578153 8:143398962-143398984 AACCCTATAAATAAATAAGCTGG - Intergenic
1049841305 8:144774491-144774513 GACCACATCAGTAAGTCAGAGGG - Exonic
1050638241 9:7637056-7637078 AACCATGGCAAAAAGTAATAGGG - Intergenic
1052044253 9:23776044-23776066 AACCACATGGATAAGTAAGGGGG - Intronic
1052237587 9:26230697-26230719 AAGCATATCCTTAAGAAAGAGGG - Intergenic
1055069895 9:72155428-72155450 AACCATACCAATAGGTAAGGTGG + Intronic
1055136806 9:72839086-72839108 AACCAAAAGAATAAGTAAGCAGG + Intergenic
1055177081 9:73333384-73333406 AACCATTTCAATATATATGAAGG - Intergenic
1055370521 9:75593496-75593518 AACCATGTCAATGAGGAAAATGG - Intergenic
1057318785 9:93992502-93992524 CACCATATTAATAAGTAAAAGGG + Intergenic
1057541278 9:95973764-95973786 AACCATATCACTAGGTATTATGG + Intronic
1058213034 9:102197025-102197047 AACAATATCAGCAAGTAAGTGGG - Intergenic
1058494432 9:105540378-105540400 AACAATACCAATAAGGAAAAAGG - Intronic
1058573291 9:106371354-106371376 AACCATATCAGTAAGAGACATGG + Intergenic
1059775872 9:117474667-117474689 AACCATATCAACCTGTAAGCAGG + Intergenic
1059962893 9:119583888-119583910 AACCATATCAATAAATGTCAGGG - Intergenic
1062757952 9:138314607-138314629 AACAAAATGAATAAGTGAGAAGG + Intergenic
1187657731 X:21497244-21497266 AACTTTATCAATAAGAAAGGTGG + Intronic
1188344613 X:29048269-29048291 AACCATATTTATTAGTAGGATGG - Intronic
1188618356 X:32188178-32188200 AATAATAACAATATGTAAGAAGG - Intronic
1188644620 X:32550523-32550545 ACCCATATCAAAAAGTTAGAAGG + Intronic
1188913923 X:35887129-35887151 GACCATATCAAAATGTCAGAAGG - Intergenic
1189093549 X:38113589-38113611 AACCATATCCAAAAGTAGTAGGG - Intronic
1189866495 X:45335428-45335450 AACCATGGTAATAAGTGAGAAGG - Intergenic
1192863395 X:75103899-75103921 AATCATATCATCAACTAAGAGGG + Intronic
1194732047 X:97466106-97466128 AGCCAAATCAATAAGTAACCTGG - Intronic
1196493530 X:116296268-116296290 AACCACACCCAAAAGTAAGAAGG - Intergenic
1196605883 X:117656541-117656563 AGCCATATAGCTAAGTAAGAAGG - Intergenic
1197059909 X:122165397-122165419 AACCATATCACTGGGTAACATGG - Intergenic
1197824785 X:130577337-130577359 GACCATAACAATAAATAAGGTGG + Intergenic
1199403728 X:147430893-147430915 AACAAGGTCAATAAGGAAGAAGG + Intergenic
1199850096 X:151720055-151720077 AACCAAATGAATAAGAAAGCTGG - Intronic
1199938182 X:152598191-152598213 ATTAATATCATTAAGTAAGAGGG - Intergenic
1201245406 Y:11998399-11998421 AACCCCATCAAAAAGTGAGAAGG - Intergenic
1202341090 Y:23869556-23869578 AAACACATCCAAAAGTAAGATGG - Intergenic
1202341937 Y:23878760-23878782 ATTCATATCAAAAAGTAGGAAGG - Intergenic
1202528831 Y:25791325-25791347 ATTCATATCAAAAAGTAGGAAGG + Intergenic
1202529676 Y:25800530-25800552 AAACACATCCAAAAGTAAGATGG + Intergenic