ID: 1138520268

View in Genome Browser
Species Human (GRCh38)
Location 16:57567154-57567176
Sequence CGCTATAGGCAGAAGGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 147}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138520257_1138520268 14 Left 1138520257 16:57567117-57567139 CCAGTTCTGCCAGCCATGTGCTC 0: 1
1: 0
2: 0
3: 25
4: 232
Right 1138520268 16:57567154-57567176 CGCTATAGGCAGAAGGAGGGAGG 0: 1
1: 0
2: 0
3: 11
4: 147
1138520256_1138520268 15 Left 1138520256 16:57567116-57567138 CCCAGTTCTGCCAGCCATGTGCT 0: 1
1: 0
2: 5
3: 16
4: 238
Right 1138520268 16:57567154-57567176 CGCTATAGGCAGAAGGAGGGAGG 0: 1
1: 0
2: 0
3: 11
4: 147
1138520258_1138520268 5 Left 1138520258 16:57567126-57567148 CCAGCCATGTGCTCATCCCTGAC 0: 1
1: 0
2: 2
3: 32
4: 224
Right 1138520268 16:57567154-57567176 CGCTATAGGCAGAAGGAGGGAGG 0: 1
1: 0
2: 0
3: 11
4: 147
1138520259_1138520268 1 Left 1138520259 16:57567130-57567152 CCATGTGCTCATCCCTGACCCAA 0: 1
1: 1
2: 9
3: 43
4: 278
Right 1138520268 16:57567154-57567176 CGCTATAGGCAGAAGGAGGGAGG 0: 1
1: 0
2: 0
3: 11
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138520268 Original CRISPR CGCTATAGGCAGAAGGAGGG AGG Intronic
901094286 1:6665865-6665887 CGGTATTGGCAGATGGAGGTGGG - Intronic
904349196 1:29893975-29893997 TGCAAGAGGCAGATGGAGGGTGG - Intergenic
904385649 1:30140416-30140438 CGCTCTGGGCATGAGGAGGGAGG + Intergenic
904836323 1:33339579-33339601 CTCTAGAGGCAGAGGCAGGGAGG + Intronic
912838420 1:113017414-113017436 CTCTATAGGAAGGAGGAAGGGGG - Intergenic
912853451 1:113146869-113146891 AGCCATGGGCAGAGGGAGGGAGG - Intergenic
915200084 1:154220878-154220900 CGCGAGAGGGAAAAGGAGGGAGG + Exonic
915983404 1:160438271-160438293 TCCTCTGGGCAGAAGGAGGGAGG - Intergenic
915986506 1:160470833-160470855 TGCTCTAGGCAGAAGGAAAGAGG + Intergenic
916353083 1:163874358-163874380 CACTTTGGGCAGGAGGAGGGAGG + Intergenic
917587451 1:176442160-176442182 CGCTAAAGGCAGAATGTGGCTGG - Intergenic
918485400 1:185024104-185024126 CACAATAGGCAGAAAAAGGGTGG - Intergenic
921568312 1:216747880-216747902 CATTATAGGCAAAATGAGGGAGG - Intronic
922930358 1:229384194-229384216 CACTCTAGCCAGAAGGAAGGAGG - Intergenic
923674840 1:236071456-236071478 CGCCAGAGGCTGAGGGAGGGAGG - Intergenic
1063588371 10:7373267-7373289 CGCTCTTGGCAGAAAGAGGAAGG - Intronic
1066150797 10:32614746-32614768 TGCTAATGGCAGAAGGTGGGTGG - Intronic
1068743591 10:60502682-60502704 CCCTGTAGGAAGAAGGAGGGAGG + Intronic
1069586506 10:69607604-69607626 AGCTATAGGCAGGTGGTGGGGGG - Intergenic
1069848327 10:71388604-71388626 TGCTTTAGGCAGAAGGAAAGTGG - Intergenic
1070280369 10:75043979-75044001 CGCTATAGGCTGCAGAAGGCGGG - Exonic
1070333165 10:75431991-75432013 CGCTAAGGGCAGAAGGAAGTGGG - Intronic
1070605923 10:77898550-77898572 CTCTATTGGCAGGAGGAGGCAGG - Intronic
1070764267 10:79047517-79047539 TTCTATAGGCAGCAGAAGGGAGG - Intergenic
1072620376 10:97075402-97075424 CTCTGTAGGGAGGAGGAGGGAGG + Intronic
1073943993 10:108730019-108730041 AGGAATAGACAGAAGGAGGGAGG + Intergenic
1074880245 10:117651175-117651197 GGCTGGAGGCAGAAGGAAGGAGG - Intergenic
1078507354 11:11962198-11962220 GGCCATGGGCAGAGGGAGGGAGG - Intergenic
1083962307 11:66021184-66021206 AGCTGTGGGCAGAAGGAGTGGGG + Exonic
1084712725 11:70853900-70853922 CTTTATAAGAAGAAGGAGGGGGG - Intronic
1085477424 11:76796998-76797020 CGCAATGGGCAGAGGGTGGGTGG + Exonic
1088173028 11:107018543-107018565 GGATAAAGGGAGAAGGAGGGAGG - Intergenic
1089440361 11:118510904-118510926 CTCTCTAGGAAGAAGAAGGGAGG + Intronic
1090771061 11:129920318-129920340 CGACTTAGGCAGAAGGAGTGGGG - Intronic
1092752597 12:11732689-11732711 CTCTAGAGGCAGAAGGAGGACGG - Intronic
1095180751 12:39144779-39144801 CGGGAAAGGCAGTAGGAGGGAGG + Intergenic
1105069892 12:133227915-133227937 CCCTCTGGGCAGAGGGAGGGGGG + Exonic
1105570254 13:21595849-21595871 GCCTATAGGCTGAAGGAGAGTGG - Intronic
1106690950 13:32115781-32115803 CACTAGAGGGAGAAGGAGGCTGG - Intronic
1108729038 13:53213823-53213845 CGTCATAGGCAGAAGGAGGAAGG - Intergenic
1115472429 14:33782373-33782395 GGCTACAGGCAGAAGTAGAGTGG - Intronic
1121066212 14:90968299-90968321 CACAATAGGAAGAGGGAGGGAGG - Intronic
1123436351 15:20257323-20257345 CGCTATTGGCAGATGCAGGCTGG - Intergenic
1126181961 15:45794021-45794043 CCCTCTGTGCAGAAGGAGGGAGG + Intergenic
1127688982 15:61376088-61376110 TGGTGTAGGCAGAAGCAGGGTGG + Intergenic
1128216394 15:65937184-65937206 GGCTCTAGGCAGGAGGAGGCAGG - Intronic
1128682106 15:69659827-69659849 GCCTCTAGGCTGAAGGAGGGTGG - Intergenic
1129970849 15:79776634-79776656 TGGTAAAGGCAGAAGGATGGAGG + Intergenic
1131454825 15:92575400-92575422 AGCAATAGACAGAAGGAGGAAGG + Intergenic
1134043233 16:11083764-11083786 CGCCACAGGCAGCAGGAGGCTGG - Intronic
1134829981 16:17315099-17315121 GGGAAAAGGCAGAAGGAGGGAGG + Intronic
1137396484 16:48119074-48119096 GGCCATAGGAAGCAGGAGGGTGG - Intronic
1137884396 16:52086926-52086948 CACTAGAAGCAGAAGGAGGAGGG + Intergenic
1138520268 16:57567154-57567176 CGCTATAGGCAGAAGGAGGGAGG + Intronic
1139357710 16:66377241-66377263 TGCTCTAGGCAGGAGGAAGGCGG - Intronic
1142298598 16:89243103-89243125 TGCTATAGTCAACAGGAGGGAGG + Intergenic
1143096092 17:4479241-4479263 TGCTACAGAAAGAAGGAGGGAGG - Intronic
1143304973 17:5939329-5939351 TGCTGTTGGCAGAAGAAGGGAGG - Intronic
1147325144 17:39666439-39666461 CGCTCTAGGCAGAAGAAGCTGGG + Exonic
1147336154 17:39727897-39727919 GGCTGAAGGCAGGAGGAGGGTGG - Exonic
1147542553 17:41372837-41372859 GGCTTTGGGAAGAAGGAGGGAGG - Intronic
1147732742 17:42614165-42614187 AGCCAAAGGCAGAGGGAGGGTGG - Intronic
1147740000 17:42665994-42666016 AGCCAAAGGCAGAGGGAGGGTGG - Intronic
1148218432 17:45846536-45846558 GGCTCTAGGCAGAAGCAGGAGGG + Exonic
1148718266 17:49731293-49731315 CGAGATAGGCAGAAACAGGGTGG - Intronic
1152826530 17:82469473-82469495 CTCTATAAGCAAATGGAGGGAGG - Intronic
1153261121 18:3225484-3225506 CCCTATAAGCCAAAGGAGGGGGG + Intergenic
1155355110 18:24944271-24944293 GGCTTTAGGCAGAAGGAGGAGGG + Intergenic
1156991512 18:43414212-43414234 AGCTATAGACAGAAGGTGAGAGG - Intergenic
1158696521 18:59708845-59708867 CCCTATAAGAAGAAGGAAGGTGG - Intergenic
1159201230 18:65187692-65187714 TGCTAGAGGGAGAGGGAGGGAGG - Intergenic
1159723258 18:71919816-71919838 CTCTATAGTCATATGGAGGGGGG + Intergenic
1161628124 19:5338676-5338698 CGCGATTGGCAGGGGGAGGGGGG + Intronic
1163130877 19:15272225-15272247 TGCTGTAGCCAGAGGGAGGGAGG + Intronic
1164709585 19:30345861-30345883 AGCTGGAGGCAGAAGGAAGGAGG + Intronic
932235612 2:70118891-70118913 TGATGAAGGCAGAAGGAGGGAGG + Intergenic
932432654 2:71685174-71685196 CGCTGTGGGCAGAAGCAGAGTGG + Intronic
935426980 2:102929892-102929914 CGTTCTAGGCAGAAGGGGGGAGG - Intergenic
936927947 2:117757194-117757216 TGCCACAGGCAGAGGGAGGGAGG - Intergenic
938100181 2:128493128-128493150 CGCTCTGGGCAGGAGCAGGGTGG - Intergenic
938579632 2:132634450-132634472 TGTGATAGGCATAAGGAGGGAGG + Intronic
940492876 2:154387574-154387596 GGCTACAGGCATGAGGAGGGAGG - Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
943931406 2:193858275-193858297 TGCTATAGGGAGAGGGAGGCTGG - Intergenic
946405279 2:219489033-219489055 CCCTATAGGCAGTATGGGGGAGG - Exonic
1169965639 20:11214505-11214527 TGCTGTAGGAAGAAGGAAGGTGG + Intergenic
1170704509 20:18733176-18733198 CTCAGTGGGCAGAAGGAGGGTGG + Intronic
1179059656 21:37968119-37968141 AGCTATAGCCAGAAGTTGGGAGG + Intronic
1180581565 22:16844179-16844201 CTCTGTAGGCAGAGGGAGGAGGG + Intergenic
1183332759 22:37230172-37230194 CGCTAGTCACAGAAGGAGGGAGG + Intronic
1183565158 22:38609149-38609171 CATTACAGGCAGCAGGAGGGAGG + Intronic
1184571027 22:45325091-45325113 CGTCATAGGAAGAAGAAGGGAGG + Intronic
1185048235 22:48539896-48539918 GGGTACAGGCAGAAGGTGGGAGG + Intronic
1185309694 22:50147244-50147266 CGCTCTGTGCAGAAGCAGGGAGG + Intronic
1185309701 22:50147292-50147314 CGCTCTGTGCAGAAGCAGGGAGG + Intronic
1185309708 22:50147340-50147362 CGCTCTGTGCAGAAGCAGGGAGG + Intronic
1185309715 22:50147388-50147410 CGCTCTGTGCAGAAGCAGGGAGG + Intronic
1185309722 22:50147436-50147458 CGCTCTGTGCAGAAGCAGGGAGG + Intronic
1185309729 22:50147484-50147506 CGCTCTGTGCAGAAGCAGGGAGG + Intronic
1185309736 22:50147532-50147554 CGCTCTGTGCAGAAGCAGGGAGG + Intronic
1185309743 22:50147580-50147602 CGCTCTGTGCAGAAGCAGGGAGG + Intronic
949295064 3:2511715-2511737 AGCTGTAGGGAGAAAGAGGGGGG - Intronic
950897486 3:16466889-16466911 CGCTACAGACAAAGGGAGGGAGG + Intronic
952069289 3:29614297-29614319 CGCAAAAGGCTGAAGGAGGGTGG + Intronic
960481780 3:118200144-118200166 GGGTAGTGGCAGAAGGAGGGAGG - Intergenic
962835875 3:139187946-139187968 CTCTATTGGCTGAAGGTGGGAGG + Intronic
962836111 3:139190145-139190167 CTCTATTGGCTGAAGGTGGGAGG + Intronic
963580612 3:147122548-147122570 CTGTATATGCAGAAGGAGAGTGG - Intergenic
967058105 3:185847830-185847852 CCCTATAGGGTGAAGGAGTGAGG + Intergenic
969272059 4:6109710-6109732 CACTGTAGGATGAAGGAGGGTGG - Intronic
970760466 4:19480259-19480281 GTTAATAGGCAGAAGGAGGGAGG - Intergenic
972776097 4:42242020-42242042 AACAAAAGGCAGAAGGAGGGAGG + Intergenic
975145198 4:70959315-70959337 CGCTAGAGGCTGAGGGTGGGAGG - Intronic
975759426 4:77604340-77604362 TGCGATAGACAGAAGGAGGAAGG - Intronic
976116422 4:81733139-81733161 CCCAAAAGGCAGAAGGAGCGTGG + Intronic
976383012 4:84421644-84421666 CTCTTCAGACAGAAGGAGGGAGG - Intergenic
978157321 4:105504931-105504953 CTCTATATGCAGCAGGAAGGAGG - Intergenic
986253214 5:6080147-6080169 CACTCCAGGCAGAAGGAGGTGGG + Intergenic
991245147 5:64502667-64502689 GTCTCTAGGCAGAAGAAGGGAGG + Intergenic
991414559 5:66379141-66379163 CATTGTAGGCAGAAGGAGAGGGG + Intergenic
996330917 5:122327865-122327887 TGCTATAGTCAGAAGGAGAGAGG + Intronic
999692143 5:154157557-154157579 CCCTATAGGCAGAATGTGAGAGG + Intronic
1000767429 5:165309427-165309449 AGATAAAGCCAGAAGGAGGGAGG + Intergenic
1002660214 5:180786635-180786657 CGTTTTAGGAAGAAGGAGGAAGG - Intergenic
1003051695 6:2786409-2786431 CACTCCAGACAGAAGGAGGGAGG - Intronic
1004737167 6:18419206-18419228 AGCCATAGGCAGGAGGAGGAGGG - Intronic
1005596897 6:27388595-27388617 CGCTAGAGGCAAGAGGAAGGGGG - Intronic
1005989694 6:30895383-30895405 CGCTGTCGGGAGAAGGAGGAGGG - Exonic
1006426623 6:33967340-33967362 GGCTCTGGGTAGAAGGAGGGAGG - Intergenic
1006517494 6:34553042-34553064 AGCTAGAGGGAGAAGGAGGGGGG + Intronic
1011753543 6:90476680-90476702 CCCTAGAGGCAGGAGGGGGGTGG - Intergenic
1017281603 6:152631734-152631756 GGGTATAGGTAGAAGGAGGTGGG + Intronic
1018016003 6:159712893-159712915 TGCTATAGGAACAAGTAGGGGGG - Intronic
1018802834 6:167236663-167236685 CCCTTTAGTCAGGAGGAGGGAGG + Intergenic
1018807754 6:167274376-167274398 CCCTTTAGGCAGGAGGAGGGAGG - Intronic
1021675386 7:23075627-23075649 GGCTGTCTGCAGAAGGAGGGAGG + Intergenic
1022478470 7:30727432-30727454 CTCTGGAGGCAGGAGGAGGGAGG + Intronic
1022831853 7:34075645-34075667 CGTGATAGGCAGAGGGAGGGAGG - Intronic
1029730151 7:102433541-102433563 CGCGACCGGCGGAAGGAGGGAGG + Exonic
1029860326 7:103564541-103564563 CACTTGAGGCAGAAAGAGGGGGG + Intronic
1033595744 7:142856598-142856620 CACTCTAGGTAGAAGGAGGATGG + Intronic
1037747171 8:21655113-21655135 AGGTATAGGGAGAAGGATGGTGG - Intergenic
1037859204 8:22392788-22392810 CGCTGGAGCCAGGAGGAGGGAGG - Intronic
1039489466 8:37936694-37936716 TGGTACAGGCAGAAGAAGGGAGG - Intronic
1041343982 8:56876501-56876523 CGTGAGAGACAGAAGGAGGGAGG + Intergenic
1041369416 8:57143328-57143350 CGCAAGCCGCAGAAGGAGGGAGG - Intergenic
1052536880 9:29759293-29759315 AGCTACAGGCAGAAGGATAGTGG - Intergenic
1053001512 9:34579307-34579329 CGCATTAGGCGGAGGGAGGGAGG - Intronic
1053161388 9:35815506-35815528 CGCTTTGGCCAGGAGGAGGGCGG + Intronic
1058699260 9:107587496-107587518 CCCTATAGGCAGCTGTAGGGCGG - Intergenic
1058815979 9:108683374-108683396 CGCTAGAGGCAGAATGGGGGTGG - Intergenic
1059681043 9:116586632-116586654 CACTATAGGAAGGGGGAGGGAGG + Intronic
1060860810 9:126953413-126953435 TGAGAGAGGCAGAAGGAGGGTGG + Intronic
1061741260 9:132708174-132708196 TGCTAGAGGAAGAAGAAGGGAGG - Intergenic
1062070395 9:134552325-134552347 CGCTAGAGGGGGAACGAGGGAGG + Intergenic
1062316220 9:135968354-135968376 TTCTCTAGGCAGCAGGAGGGAGG + Intergenic
1187694479 X:21905034-21905056 CCCTCTAGGTAGAAGTAGGGAGG + Intergenic
1192097820 X:68231782-68231804 AGGTAGAGGTAGAAGGAGGGAGG + Intronic
1195803735 X:108738459-108738481 AGCTAGAGGCAGAACGAGTGTGG + Intergenic