ID: 1138521842

View in Genome Browser
Species Human (GRCh38)
Location 16:57575610-57575632
Sequence GAGGGTGGCAGGCCTGCTGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 558
Summary {0: 1, 1: 0, 2: 3, 3: 54, 4: 500}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138521831_1138521842 20 Left 1138521831 16:57575567-57575589 CCTCTCTGGCCGCCAGTAGCCTG 0: 1
1: 0
2: 0
3: 10
4: 150
Right 1138521842 16:57575610-57575632 GAGGGTGGCAGGCCTGCTGCTGG 0: 1
1: 0
2: 3
3: 54
4: 500
1138521835_1138521842 8 Left 1138521835 16:57575579-57575601 CCAGTAGCCTGAGGCTACGGCTC 0: 1
1: 0
2: 1
3: 5
4: 62
Right 1138521842 16:57575610-57575632 GAGGGTGGCAGGCCTGCTGCTGG 0: 1
1: 0
2: 3
3: 54
4: 500
1138521836_1138521842 1 Left 1138521836 16:57575586-57575608 CCTGAGGCTACGGCTCCTGCTAG 0: 1
1: 1
2: 0
3: 3
4: 101
Right 1138521842 16:57575610-57575632 GAGGGTGGCAGGCCTGCTGCTGG 0: 1
1: 0
2: 3
3: 54
4: 500
1138521830_1138521842 26 Left 1138521830 16:57575561-57575583 CCTCAGCCTCTCTGGCCGCCAGT 0: 1
1: 0
2: 2
3: 52
4: 458
Right 1138521842 16:57575610-57575632 GAGGGTGGCAGGCCTGCTGCTGG 0: 1
1: 0
2: 3
3: 54
4: 500
1138521833_1138521842 11 Left 1138521833 16:57575576-57575598 CCGCCAGTAGCCTGAGGCTACGG 0: 1
1: 0
2: 0
3: 8
4: 84
Right 1138521842 16:57575610-57575632 GAGGGTGGCAGGCCTGCTGCTGG 0: 1
1: 0
2: 3
3: 54
4: 500

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138521842 Original CRISPR GAGGGTGGCAGGCCTGCTGC TGG Exonic
900169476 1:1259609-1259631 GCGGGTGGCAGCCCCGCTTCTGG - Intronic
900215355 1:1478766-1478788 GAGGGAGGCCGCCCGGCTGCGGG + Intronic
900222616 1:1517433-1517455 GAGGGAGGCCGCCCGGCTGCGGG + Intronic
900348747 1:2224864-2224886 GAGGGTGGAAGGCCAGCAGGCGG + Intergenic
900495515 1:2974287-2974309 GAGGGTGGCAGTCCTGGGACAGG + Intergenic
900607523 1:3530506-3530528 GAGGGAGGCGGGCCTAGTGCAGG + Intronic
900660113 1:3777955-3777977 GGGGCTGGCAGGGCTGCTGGTGG - Intergenic
901404818 1:9038936-9038958 GAGGGTGGCAGGGCTCAGGCGGG + Intronic
901537010 1:9889085-9889107 GTGTGTGGCATGCCTGCTGGTGG - Intronic
901598552 1:10404343-10404365 CAGGGTGGCAGAACTGCTCCTGG - Intronic
901800730 1:11706558-11706580 GAGTCCTGCAGGCCTGCTGCAGG + Exonic
902241726 1:15094445-15094467 GTGGGGGGCAGGCCAGCTTCTGG - Intronic
902893638 1:19463590-19463612 CAGGGTGCCAGCCTTGCTGCTGG + Intronic
903154710 1:21435909-21435931 GAGGGTCTCGGGCCTGCTGTGGG + Intergenic
903422888 1:23231429-23231451 GTGGGTGGCAGGTCAGCTCCAGG + Intergenic
903551431 1:24159652-24159674 GAGAGTGGCAGAGCTGCTGTGGG + Intronic
904247201 1:29196161-29196183 GAGGGAGGCATGCCTGGAGCCGG - Intronic
904408788 1:30312338-30312360 GATGGGGGCAGGGCTGCTGGGGG + Intergenic
904818177 1:33221000-33221022 GAGGGTGGCAGGGCTCCTTGGGG + Intergenic
905825514 1:41023465-41023487 GGGGATGGCATGCCTGCTGTGGG - Intergenic
906211155 1:44012948-44012970 GAGGGTGTGAGGCCTGCTGGGGG + Intronic
906214455 1:44030758-44030780 TAGGGAGGCAGGCCGGCTGGAGG + Intronic
906274518 1:44506245-44506267 GAGGGTGGCAGGGTTGCTGGTGG + Intronic
907303285 1:53501254-53501276 GCAGGTGGCAGGCCAGCAGCAGG - Intergenic
907390154 1:54152889-54152911 GTGGGGGGCTTGCCTGCTGCTGG - Exonic
908255254 1:62298011-62298033 GAGGGTGGAATGGCTGATGCAGG + Intronic
911102550 1:94105887-94105909 GGGGGTGGCGGGGCTGGTGCTGG - Intronic
911153543 1:94618241-94618263 GAGGCAGGCAGCCCAGCTGCTGG - Intergenic
912494166 1:110080593-110080615 GAGGGAGGCAAGCCTGCTATAGG + Intergenic
912551194 1:110486510-110486532 GAGGGCTGCAGGCCTGCAGAGGG + Intergenic
912725260 1:112053652-112053674 CTGTGTGACAGGCCTGCTGCTGG - Intergenic
912834434 1:112983334-112983356 GAGGGAGGAAGGACTGCTGACGG + Intergenic
912836342 1:112999837-112999859 GAGGGTGGCAAGCCTGGGGAGGG - Intergenic
913250743 1:116910347-116910369 GAGGGTGCCCGGGCTGCTCCCGG + Intronic
913685967 1:121232291-121232313 GATGGAGGCAGGCCAGCTTCAGG - Intronic
914037819 1:144019894-144019916 GATGGAGGCAGGCCAGCTTCAGG - Intergenic
914151635 1:145048038-145048060 GATGGAGGCAGGCCAGCTTCAGG + Intronic
914754183 1:150553716-150553738 TAGGGGGGCAGGCCTGGTTCTGG - Exonic
915038510 1:152948587-152948609 GTGGGGGGCAGCACTGCTGCGGG - Intergenic
915285234 1:154848082-154848104 GAGGGGGGGAGGCCTCCTTCTGG - Intronic
915704937 1:157834697-157834719 GAGGGTGTCAGGCTGGCTGACGG - Exonic
918377954 1:183928097-183928119 CAGGGTGGCAGCCCTCATGCAGG + Exonic
918404333 1:184196421-184196443 GAGGGCTGCAGGCCTGATGGAGG + Intergenic
919480264 1:198079540-198079562 AAGGTTGGCAGGGGTGCTGCTGG - Intergenic
919785997 1:201259177-201259199 GAGGGAGGCAGGGCTGCAGTGGG + Intergenic
920473290 1:206250848-206250870 GATGGAGGCAGGCCAGCTTCAGG - Intronic
921023841 1:211259748-211259770 GAGGGGGGCAGGCGGGCTGGCGG - Intronic
921213506 1:212919004-212919026 GAGGGTTGCAGTCCTACTGTAGG + Intergenic
921389963 1:214606985-214607007 GAGGGGGACAGCCCTGCTGGTGG - Intronic
922279989 1:224114405-224114427 GAGGGAGGCAGGAGTTCTGCGGG - Intronic
922617282 1:226968665-226968687 CAGGGAGGTAGGGCTGCTGCAGG + Intronic
922648578 1:227317964-227317986 GGGGGTGGAAGGCGGGCTGCGGG + Exonic
922795743 1:228338606-228338628 GAGGCTGGGAGGGCAGCTGCGGG - Intronic
923280583 1:232439308-232439330 GATGGTGGCAGGCATGCAGGGGG + Exonic
923540703 1:234886175-234886197 GAGGATGGCTGGCCATCTGCAGG - Intergenic
924168877 1:241316192-241316214 GAGGGTGGCATGCCTGCAGAGGG - Intronic
1062909482 10:1203546-1203568 CTGGCTGTCAGGCCTGCTGCTGG + Intronic
1063665879 10:8060315-8060337 GAGGGAGGCAGGCTAGCTGGTGG + Intronic
1064006383 10:11702612-11702634 GTGGGTGGCAGGCAGGCAGCAGG - Intergenic
1065557509 10:26931439-26931461 GGGCGTGGCGGGGCTGCTGCTGG + Intergenic
1067235101 10:44440153-44440175 GAGGTAGGCAGGCCAGGTGCAGG + Intergenic
1067498020 10:46776117-46776139 GAAGCTGGCCAGCCTGCTGCGGG - Intergenic
1067596626 10:47564297-47564319 GAAGCTGGCCAGCCTGCTGCGGG + Intergenic
1067745540 10:48933052-48933074 GATGGAGACAGGCCAGCTGCAGG + Intronic
1067849426 10:49745324-49745346 GAGGTGGGCAGGCAGGCTGCAGG - Exonic
1067910724 10:50344063-50344085 GAAGGTGGCAGACTGGCTGCTGG - Exonic
1068434560 10:56973713-56973735 GAGGGTTCCAGCCCTGCAGCAGG + Intergenic
1069374572 10:67781046-67781068 TAGGGTGGAAGCCCTGGTGCTGG + Intergenic
1069658251 10:70106193-70106215 GAGGGTGGCAGTGCTGCTGCTGG - Intronic
1070139976 10:73731865-73731887 GAAGCTGGCCAGCCTGCTGCGGG + Intergenic
1070285378 10:75079614-75079636 GACGGGGCCAGGCCAGCTGCTGG - Intergenic
1070963320 10:80514464-80514486 GAGGGAGGCAGGCCTGGGGCAGG + Intronic
1071204615 10:83259777-83259799 GAGGGAGGCAGGGGTGCTACTGG - Intergenic
1071528862 10:86374107-86374129 CTGGGTGGCAGGCCTGCCGATGG - Intergenic
1072188961 10:93065425-93065447 GAGGCTGGCACTGCTGCTGCAGG + Intronic
1072519612 10:96219427-96219449 GAGGGTGGCATGCCTCCTGGGGG - Intronic
1072546726 10:96445761-96445783 GAGCGGGGCTGGCGTGCTGCTGG - Intronic
1073205867 10:101769043-101769065 GAGGGAGGGAGGGCTGCTGTGGG - Intergenic
1073304530 10:102492586-102492608 GAGGGAAGCAGGCATGTTGCTGG - Intronic
1074108320 10:110404921-110404943 GCGGGTGGCCAGCCTGCAGCAGG - Intergenic
1074128249 10:110548180-110548202 GAGGGGGGCAGTCCTGAGGCGGG - Intergenic
1074785796 10:116838317-116838339 AGGGGTTGCTGGCCTGCTGCTGG + Intergenic
1074819651 10:117168520-117168542 GAGAGAGCCGGGCCTGCTGCTGG - Intergenic
1075520911 10:123143062-123143084 GAGCGTGGGAGCCCTGCGGCTGG - Intergenic
1075717832 10:124567073-124567095 GAGGGGTGCAGGCCAGCTGAGGG + Intronic
1075719003 10:124574309-124574331 CAGGGGGGCGAGCCTGCTGCTGG - Intronic
1076174930 10:128361012-128361034 GAGCATGGTGGGCCTGCTGCAGG + Intergenic
1076358305 10:129868751-129868773 GAGGGCTGCAGGCCTGGTGGAGG + Intronic
1076732221 10:132444622-132444644 CGGGGTGGCAGGCCTGAGGCTGG - Intronic
1076753411 10:132555092-132555114 GTGGGTGGCATGGCTGCTGTGGG + Intronic
1076776270 10:132699781-132699803 CAGAGTGGCAGGGCTGCTTCGGG - Intronic
1076855958 10:133115742-133115764 GAGGGTTGGAGGCTTGCAGCCGG - Intronic
1077252220 11:1565763-1565785 GAAGCTGGCCAGCCTGCTGCGGG - Exonic
1077267089 11:1656305-1656327 GTGGGTGCCAGGCATGCTCCTGG - Intergenic
1077289190 11:1781047-1781069 GAGGGTGGCAGCTGTGATGCTGG + Intergenic
1077327726 11:1970945-1970967 GAGGGTGGCAGGGGTGGGGCAGG + Intronic
1077347758 11:2072000-2072022 GAGCGAGGCAGGGCTGATGCAGG - Intergenic
1077539430 11:3139595-3139617 GGGGGTGGCAGGCCTTCCCCTGG + Intronic
1077562634 11:3273544-3273566 GAGGCTGGCAGGAGTGCAGCAGG - Intergenic
1077568527 11:3319363-3319385 GAGGCTGGCAGGAGTGCAGCAGG - Intergenic
1079182303 11:18204508-18204530 GTGCATGGCAGCCCTGCTGCTGG - Intronic
1080021370 11:27563762-27563784 GAGGTGGGAAGGCCTTCTGCTGG + Intergenic
1081757527 11:45555206-45555228 GGGGATGGGAGCCCTGCTGCTGG - Intergenic
1081768268 11:45628081-45628103 GAGGGAGGCAGGCCTGACGTGGG - Intergenic
1081806475 11:45893660-45893682 GAGGGAGGCCGGCCTGCGGAGGG + Intronic
1082888516 11:58113418-58113440 GGGGGTGGGAGGACTGCTGCAGG + Intronic
1083292962 11:61699935-61699957 GAGGGTGGCAGGCAGGTGGCCGG + Intronic
1083328475 11:61885732-61885754 GAGTGTGGCAGGGCTGCTGAGGG + Intronic
1083759055 11:64805955-64805977 GAGGGTGGAAGTCCCACTGCTGG + Intronic
1083777563 11:64901772-64901794 TAGGGAGGCAGCCCTGATGCTGG - Intronic
1083888028 11:65582158-65582180 GAGGGGGCCAGGGCTGCTGCAGG + Exonic
1083961774 11:66018602-66018624 ATGGGTGGCACCCCTGCTGCTGG + Intronic
1084020293 11:66413326-66413348 GAGGGTGGCAGGCCAGGGACTGG + Intergenic
1084043332 11:66555244-66555266 GAGGGTGAAAGGTCAGCTGCAGG - Intronic
1084369046 11:68726140-68726162 CAGGGTAGAAGGTCTGCTGCAGG + Intronic
1084485967 11:69448514-69448536 GGGGGAGGCAGGACTTCTGCTGG + Intergenic
1084736551 11:71109083-71109105 GAGTGTGCCAGCCCTGCTTCTGG - Intronic
1085046966 11:73359325-73359347 GAGGGCGGCAGGCCGTCTGCAGG + Intronic
1085742746 11:79090924-79090946 GAGGGAGGCAGCCCTTCAGCAGG - Intronic
1085989476 11:81824411-81824433 GAGGGTGGAAGGCAGGCAGCAGG - Intergenic
1089194777 11:116687861-116687883 AAGGGGTTCAGGCCTGCTGCTGG - Intergenic
1089556946 11:119320236-119320258 GAGGGAGGGTGGCCTTCTGCGGG + Intronic
1089774601 11:120827442-120827464 CAGGCAGGCAGGCCTGCTGCTGG + Intronic
1090397571 11:126429363-126429385 GAGGGTGGCAGGGCAGGGGCAGG - Intronic
1090411530 11:126512969-126512991 GATGGTGGCAGGACTGGGGCAGG + Intronic
1090798874 11:130158619-130158641 GAGGGTGGCAGCCCAGAGGCAGG + Intergenic
1090950820 11:131471765-131471787 GAGGGTGGAAGAGCTGCTCCTGG + Intronic
1202810708 11_KI270721v1_random:26125-26147 GAGGGTGGCAGGGGTGGGGCAGG + Intergenic
1091408563 12:224207-224229 GAGGCTGGCAGGGCTGATCCTGG - Intronic
1091484433 12:870745-870767 GGGGGTGGCAGGATTGCTCCTGG + Intronic
1091487146 12:900513-900535 GAGGGTGGAGGGTCTGCTGGGGG - Exonic
1092078587 12:5693884-5693906 GAGGCTGGTAGGGCTGCTCCGGG - Intronic
1092229921 12:6770545-6770567 GAGGGTGGCAGCTCTGGTGCAGG - Exonic
1094101317 12:26767137-26767159 GAAGGAGGCCGGCCTGCTGCAGG - Intronic
1095641923 12:44495293-44495315 GATGCTGGCAGGCCAGCTGGTGG - Intergenic
1095812670 12:46387095-46387117 GGGAGGGGCAGGCATGCTGCGGG - Intergenic
1096424797 12:51492152-51492174 GTGGGTGGAAGGCCTGCATCTGG + Intronic
1096523743 12:52198620-52198642 AAGGCTGCCAGGCCTGCTTCTGG + Intergenic
1096573442 12:52538205-52538227 AAGTGTGGCAGCCCTGCTGGAGG + Intergenic
1096681087 12:53255685-53255707 CAGGGTGGAAGGGCTTCTGCAGG + Intergenic
1097041626 12:56159329-56159351 GAGATTGGCAGGCCTGCCGCAGG + Intronic
1101167592 12:102053389-102053411 GTGCATGGCAGGCTTGCTGCTGG - Intronic
1102291391 12:111703233-111703255 GAGGGTGGCAGGCCTGGAAAGGG - Intronic
1102514192 12:113435428-113435450 GGTGGTGGCTGGCCTGCTGGAGG + Exonic
1102783096 12:115582675-115582697 GAGGGAGGCTGGCCAGGTGCAGG + Intergenic
1103509848 12:121466968-121466990 GAGCGCGGCAGGCCCGCAGCCGG - Intronic
1103702954 12:122857095-122857117 GCGGGAGGCAGACCTGCTGGCGG + Exonic
1104446645 12:128839438-128839460 GAGGGAGGCAGGCCGACTCCAGG - Intergenic
1104984150 12:132587223-132587245 GAGGGTGGCAGTGCGGCTGGAGG + Intergenic
1104984185 12:132587379-132587401 GAGGGTGGCAGTGCAGCTGGAGG + Intergenic
1105886734 13:24649099-24649121 GGGGGTGGCAGGGCTGCTGGAGG - Intergenic
1105934934 13:25089980-25090002 GAAGCTGCCAGGCCTGGTGCAGG - Intergenic
1105986640 13:25573687-25573709 GGGAGTGGCAGCCCTGGTGCTGG + Intronic
1106481617 13:30141181-30141203 GTGGGTAGCAGGCCTCCTGCAGG - Intergenic
1107675843 13:42795865-42795887 GGGGCTGGGAGGCATGCTGCGGG + Intergenic
1108714853 13:53068963-53068985 GAGGGTGGAGGGACTGGTGCTGG + Intergenic
1113101739 13:106727535-106727557 CAGAGTAGCAGGCCAGCTGCTGG + Intergenic
1113466707 13:110518351-110518373 GAAGGTGGCAGGCCTGGGACTGG - Intergenic
1113510580 13:110851153-110851175 CAGGGTGCCAGTCCTGCTCCCGG - Intergenic
1113521997 13:110947794-110947816 GAGGGTGGGGGGCCTCCTGAAGG + Intergenic
1113562790 13:111296412-111296434 GAGAGTGGAATGCTTGCTGCAGG + Intronic
1113657662 13:112078434-112078456 GAGGGTGCCTGAGCTGCTGCGGG + Intergenic
1113705895 13:112432902-112432924 GAGGGTGGGGGGCCTCCTGAAGG - Intronic
1113892447 13:113743525-113743547 GAGGGTGGCAGAGCTGGAGCAGG + Intergenic
1114532322 14:23403685-23403707 GAGGGTGGCAGCCTCCCTGCTGG + Intronic
1119103620 14:71903631-71903653 GAGGGTGGGAGGCCTGGAGCTGG + Intergenic
1121255272 14:92526015-92526037 GGGGGTGGAGGGGCTGCTGCAGG + Intronic
1121317070 14:92968635-92968657 GGGGGTGTCTGGCCTGATGCTGG - Intronic
1121336915 14:93083243-93083265 CTGTGTGGCAGGCCTGCTGCTGG - Intronic
1121424562 14:93840387-93840409 GCAGGTGGCATGGCTGCTGCTGG - Intergenic
1121709618 14:96027839-96027861 GAAGCTGGCAGGCATGCAGCAGG + Intergenic
1121842347 14:97144797-97144819 GAGGATGGCAGACTTGATGCAGG + Intergenic
1122367002 14:101200286-101200308 GTTGCTGGGAGGCCTGCTGCAGG - Intergenic
1122388552 14:101365064-101365086 GAGGGTGAGGGGGCTGCTGCTGG + Intergenic
1122597434 14:102903126-102903148 GCGGGTGGCAGGCCTCATACAGG + Intronic
1122834087 14:104422686-104422708 AAGCGCGGCAGGCCCGCTGCCGG - Intergenic
1123042165 14:105494745-105494767 GAGGATGGAAGGCCAGCAGCAGG - Intronic
1123435287 15:20249734-20249756 GAGGGGTGCAGGCCTGCAGAGGG - Intergenic
1124614321 15:31230579-31230601 CAGGGAGCCATGCCTGCTGCTGG - Intergenic
1124626811 15:31312425-31312447 GCGAGGGGCAGCCCTGCTGCGGG + Intergenic
1124687158 15:31792410-31792432 GAGGGCGGCAGGACTGGAGCAGG - Intronic
1125094661 15:35837510-35837532 GAGGGTGGAAATCCTGCTACTGG - Intergenic
1125464873 15:39941071-39941093 GAGGGTGCCAGGCCTGGAGAGGG - Intronic
1125736995 15:41933882-41933904 GAGGGCGTGAGGCCTGATGCTGG - Intronic
1125968287 15:43891711-43891733 GAGGGTGAGAGGCCTGGGGCTGG - Intronic
1126670859 15:51113853-51113875 GAGGGAGGCTGGACTGATGCTGG - Intergenic
1127279273 15:57475150-57475172 GAGGGTGGCCAACCTGCGGCAGG - Intronic
1128074572 15:64818221-64818243 GGAGGTGGCAGTCCTGCTACGGG - Intronic
1128693081 15:69740063-69740085 CAGGGTGCCAGGCCAGCTCCAGG - Intergenic
1129200259 15:73994500-73994522 CAGGGGGGCAGCCCTGCTCCCGG - Intronic
1129364220 15:75044430-75044452 GAGGTGGGCAGACCTCCTGCTGG + Exonic
1129451214 15:75652301-75652323 GAGGTGGCCAGGCCTGCTGGGGG + Intronic
1129521738 15:76190553-76190575 GAGGGAGGCGGGACAGCTGCTGG + Intronic
1129661393 15:77554858-77554880 GAGGGAGGAGGGGCTGCTGCTGG + Intergenic
1129732499 15:77940171-77940193 GAGGGAGGCGGGCCTGCAGAGGG - Intergenic
1129734649 15:77952754-77952776 GGGGGTGGCAGTGCTGCTGTAGG - Intergenic
1129840941 15:78743237-78743259 GGGGGTGGCAGTGCTGCTGTAGG + Intergenic
1130301267 15:82681054-82681076 AAGGGTGGAAGGCCGGCTGCCGG + Intronic
1130744610 15:86637679-86637701 GAGGGTGGCAGGGGTGGTGGTGG + Intronic
1131068704 15:89450488-89450510 GAGGGCTGCAAGCCTGCTCCAGG - Intergenic
1131132365 15:89908476-89908498 GAGGTTGGCGGGGCTGCAGCCGG - Intronic
1131492805 15:92877496-92877518 GAGGATGTCAGGCTTGCTGAGGG - Intergenic
1131781616 15:95865826-95865848 GCAGGTGCCAGGGCTGCTGCAGG - Intergenic
1131878189 15:96833666-96833688 AAAGGAGTCAGGCCTGCTGCAGG - Intergenic
1132554160 16:565338-565360 GAGAGGGGCCGGCATGCTGCAGG - Exonic
1132763602 16:1523529-1523551 GAGGGCGGTAGAGCTGCTGCTGG - Exonic
1133041834 16:3065051-3065073 CAGGGTGGAAGGCATCCTGCCGG - Intergenic
1133118357 16:3590975-3590997 GAGGGTGGCAGTCCGGTTTCTGG - Exonic
1133437296 16:5790720-5790742 GAGTGTGGAATGCCTGGTGCTGG + Intergenic
1133907743 16:10037414-10037436 GAGGGTGGCAGGGCTGCACACGG - Intronic
1136047359 16:27625003-27625025 GAGGGTGGCAGGGCAGCAGGAGG + Intronic
1136363879 16:29799535-29799557 GAGGTTCTCAGGCCTGCTGTGGG + Intronic
1136707383 16:32201404-32201426 GAGGGAGACAGCCCTGCTGGTGG + Intergenic
1136760530 16:32728013-32728035 GAGGGAGACAGCCCTGCTGGTGG - Intergenic
1136807573 16:33142373-33142395 GAGGGAGACAGCCCTGCTGGTGG + Intergenic
1137237266 16:46626171-46626193 GATGGTGGAGGGCCAGCTGCTGG + Intergenic
1137558510 16:49488563-49488585 GATGGTGCCAGGCATCCTGCAGG - Exonic
1138521842 16:57575610-57575632 GAGGGTGGCAGGCCTGCTGCTGG + Exonic
1139141213 16:64264774-64264796 GAAGGTGGCAGGACGGCTCCTGG + Intergenic
1139748708 16:69095327-69095349 CACCGTGGCAGGCCTGGTGCTGG + Intergenic
1139891027 16:70253450-70253472 GTGGGTGGCAGGCCTTCTGAGGG - Intronic
1140083967 16:71777478-71777500 GAGGGTGGCGGCTCTGGTGCAGG + Intronic
1141143120 16:81510158-81510180 GAGGGTGGCAGCCCCGCAGCAGG - Intronic
1141383971 16:83602373-83602395 AAAGGTGGCAGGCGTGTTGCTGG - Intronic
1141624408 16:85253716-85253738 GAGGGTGGCAAGAGTGCTCCCGG + Intergenic
1141705330 16:85661566-85661588 GTGGGAGGGAGGCCCGCTGCTGG - Exonic
1141721636 16:85759266-85759288 GTGGGGGGCAGCCCTCCTGCAGG + Intergenic
1141892189 16:86933808-86933830 GAGGGAGGGATTCCTGCTGCTGG + Intergenic
1142124534 16:88403595-88403617 GAGGGTGGCAGAGCAGCTGCTGG + Intergenic
1142199257 16:88753320-88753342 GGGGGTGGCAGGTGTGCTCCGGG - Intronic
1142221273 16:88856428-88856450 GTGGGTGGCCGGCGTGCTACCGG - Intronic
1142226270 16:88879130-88879152 GGGGATGGCGTGCCTGCTGCAGG + Intronic
1142271413 16:89091531-89091553 GAGGGTGGGGGCGCTGCTGCGGG + Intronic
1203062683 16_KI270728v1_random:988328-988350 GAGGGAGACAGCCCTGCTGGTGG - Intergenic
1142768085 17:2076852-2076874 AAGCATGGAAGGCCTGCTGCGGG - Intronic
1142854770 17:2723630-2723652 GGAGGTGACAGGCCTGCTGCTGG - Intergenic
1142984715 17:3688941-3688963 GAGGGAGGCAGCCCTGAGGCAGG - Intronic
1143252041 17:5530544-5530566 GATGGTGGCAGGGCCTCTGCTGG - Exonic
1143651396 17:8266048-8266070 CAGGGTGCCAGGCGTGCAGCAGG + Intronic
1143898656 17:10156780-10156802 AAGGGAGGGAGGCCTGCAGCAGG - Intronic
1144050796 17:11495695-11495717 CAGGGTGGCCGGCCTGTTTCAGG - Intronic
1144848077 17:18230384-18230406 GAGGGTGGCAGGTGGGCTGGGGG + Intronic
1145399116 17:22517044-22517066 GAGGGTGCCAGCCCAGCTCCTGG + Intergenic
1146004063 17:29149674-29149696 GAGAGCAGCAGGCCTGCTGTCGG - Intronic
1148215212 17:45830406-45830428 TGGGGTGGCAGGGCTGGTGCAGG + Exonic
1149500731 17:57150388-57150410 AAGGGGGGCAGTCCTGGTGCCGG + Intergenic
1151681980 17:75627133-75627155 GAGGGTGGTGGAGCTGCTGCTGG - Exonic
1152335570 17:79698672-79698694 GTGTGTGGCAGGCCTCCTCCAGG + Intergenic
1152762878 17:82118595-82118617 GGTGGAGGCAGGCCTGCTGCAGG + Intronic
1152821802 17:82441298-82441320 GAGGGGGGCAGGCATGGGGCGGG + Intronic
1152854348 17:82655712-82655734 GAGGGTGGCCAGCCTCGTGCAGG - Exonic
1153814993 18:8784076-8784098 GAGGGTGCAAGTCCTGGTGCCGG + Exonic
1154041362 18:10859401-10859423 GTGCGTGGCAGGCCAGCTGCAGG - Intronic
1155036727 18:22030732-22030754 GAGGGTGCCTGGCCTGCTGAGGG - Intergenic
1156454791 18:37286887-37286909 GAGGCCAGCAGGCCTTCTGCAGG - Intronic
1156474072 18:37394724-37394746 GGGTGTGGCAGGCCTCCTTCTGG - Intronic
1158392218 18:57052941-57052963 CTGGGTGACAGCCCTGCTGCAGG - Intergenic
1158526622 18:58220497-58220519 GAGGCTGGGAGGACTGCTGAAGG - Intronic
1160500595 18:79399743-79399765 GTGGGTGCCGGGCCTCCTGCAGG + Intronic
1160565785 18:79785996-79786018 GGGTGGGGCCGGCCTGCTGCTGG + Intergenic
1160702565 19:515000-515022 AAGGCTGTCAGCCCTGCTGCCGG - Intronic
1160723641 19:608280-608302 GAGGGAGGCAGGCCCGGTCCTGG + Intronic
1160778241 19:866543-866565 GAGGGGTGCAGGCCTGCGGCGGG - Intergenic
1160778258 19:866594-866616 GAGGGGTGCAGGCCCGCGGCGGG - Intergenic
1160778275 19:866645-866667 GAGGGGTGCAGGCCCGCGGCGGG - Intergenic
1160778292 19:866696-866718 GAGGGGTGCAGGCCCGCGGCGGG - Intergenic
1160778309 19:866747-866769 GAGGGGTGCAGGCCCGCGGCGGG - Intergenic
1160798583 19:956808-956830 GAGAGGGGCAGGACGGCTGCAGG + Intronic
1161195522 19:2984131-2984153 GAGAGTGGCAGGCGGGCTGTCGG - Intronic
1161204533 19:3034179-3034201 GAGGGTTGCAGGCCAGGTGTTGG - Intronic
1161566617 19:5006152-5006174 GAAGAGGGCAGGCCTGCAGCAGG - Intronic
1161894459 19:7069799-7069821 GAGGGACGCAGGCCCGCGGCTGG - Intronic
1162081525 19:8220654-8220676 GAGGCTGGCTGGCCTCTTGCAGG - Intronic
1162145246 19:8609326-8609348 GAGGGTGCCAGGCCTGGAGGAGG + Intronic
1162326793 19:10004214-10004236 GAGGTGGGCAGGACTGCTGGGGG - Intronic
1162799719 19:13103790-13103812 GGGGTTGGTAGTCCTGCTGCTGG - Intergenic
1163218558 19:15897993-15898015 GGGGGTGGCAGGCCTGGGGGGGG - Intronic
1163671754 19:18633448-18633470 GAGGGTGTGAGCCCTGCAGCTGG + Intergenic
1164563962 19:29312627-29312649 GGAGGTGGGAGGCCTTCTGCTGG + Intergenic
1164633404 19:29776139-29776161 CTTGGTGGCAGGCCTGCTGCTGG + Intergenic
1165128282 19:33616498-33616520 GAGGTGGGCAGGCCTGCAGGGGG - Intergenic
1165213834 19:34255012-34255034 GAGGGAGGGCGGCCTGCTGGCGG + Intronic
1165364940 19:35359553-35359575 GAGGGTGGCGGGGCTGTTGGCGG + Exonic
1165366759 19:35372022-35372044 GAGGGTGGCGGGGCTGGTGGCGG + Exonic
1166547168 19:43640327-43640349 GAGTGTGAGAGGCGTGCTGCGGG + Intergenic
1166631150 19:44409182-44409204 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632027 19:44415309-44415331 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632455 19:44418994-44419016 GAGGGTTGCAAGGATGCTGCTGG + Intronic
1166637024 19:44459399-44459421 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
1166766451 19:45254217-45254239 GAGGGAGCCAGGCCAGCTGGTGG + Intronic
1166857790 19:45791987-45792009 TGGGGTGGCAGGCATTCTGCAGG - Intronic
1167033325 19:46978096-46978118 GAGGGTGGCAGGCTTGAGCCTGG + Intronic
1167573733 19:50307130-50307152 GAGGGTGGCTGACCAGCTCCGGG + Exonic
1167674492 19:50875930-50875952 GAGGGTGGCTCACCTGCAGCTGG - Intronic
925309960 2:2875304-2875326 CAAGGTGGCAGGGCTGCTGGGGG - Intergenic
926216514 2:10908971-10908993 GAGGCTGGCAGGCCTGAGGCTGG - Intergenic
926277388 2:11414793-11414815 GAGAGGGCTAGGCCTGCTGCTGG + Intergenic
926754924 2:16226889-16226911 GAGAGGGGCAGGGCTGCTACAGG + Intergenic
926766788 2:16329177-16329199 GAGTGAGGAAGGCCTGGTGCAGG - Intergenic
926861787 2:17317572-17317594 GAGGGGGCAATGCCTGCTGCTGG + Intergenic
927765452 2:25803197-25803219 GAGGGTGGCAAGCCTGGAGAGGG + Intronic
927894846 2:26775136-26775158 GAGGGTTGAAGGGCTGCTGGGGG - Exonic
929187147 2:39107332-39107354 GAGCATGGCAGGCCTGTTCCCGG + Intronic
929799081 2:45084005-45084027 GAGGGTGGCATGGGTGCTGTTGG - Intergenic
930337858 2:50072768-50072790 GAGGTGGTCAGCCCTGCTGCAGG - Intronic
932187698 2:69713061-69713083 GAGAGTGGCAGAGCTGCTGTGGG + Intronic
932751417 2:74373964-74373986 GAGGCAGGCAGGCCTGCTAGAGG + Intronic
934990301 2:98915653-98915675 GAGGGTGGGCTGCCTGCTGGGGG + Intronic
936945901 2:117930480-117930502 GGAGGTGCCAGGCCTGGTGCTGG + Intronic
937284327 2:120740835-120740857 GAGGGCCCCAGGCCTCCTGCAGG + Intronic
937939780 2:127276026-127276048 GGAGGTGGCCTGCCTGCTGCCGG - Intronic
938077686 2:128348504-128348526 CAGGGAGGAAGGCCTGCTGGAGG - Intergenic
938115815 2:128602424-128602446 GAGGGTGGCATGCCTGTGTCAGG + Intergenic
938324638 2:130390456-130390478 GAGGCTGGCACGGTTGCTGCCGG - Intergenic
938540996 2:132283388-132283410 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
941099481 2:161280937-161280959 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
941903439 2:170698927-170698949 GAGGGTGGCTGACCTGCTGTGGG + Intergenic
942221165 2:173770395-173770417 GAGGGTGGCATGCCTGGAGATGG - Intergenic
944677993 2:202050043-202050065 GAGTGTGGGAGGTCTGCTGCTGG + Intergenic
945395151 2:209307461-209307483 GATGGTGGCAGGCAGGCTTCTGG - Intergenic
946176968 2:217928110-217928132 GAGGGAGGCAGGCCTCCTTCAGG + Intronic
946325344 2:218981972-218981994 GCGGCTGGCAGGCCTGCGCCAGG + Exonic
947551052 2:231047122-231047144 GAGTGTGGCAGGCCTCCAGCAGG - Exonic
947699118 2:232217757-232217779 GAGGGTGGCATGCCTGGGGAAGG - Intronic
947832816 2:233153773-233153795 GGAGATGCCAGGCCTGCTGCAGG + Intronic
948590734 2:239048000-239048022 GAGGGGGACGGGCCTGCCGCTGG + Intergenic
948602775 2:239116734-239116756 CAGGGTGGCAGGGAGGCTGCAGG - Intronic
948660315 2:239502756-239502778 AAGGGTGGCAGTGCTTCTGCAGG - Intergenic
948976419 2:241466390-241466412 GTGGGTGCCAGGCCCGCTGTGGG + Intronic
1170845261 20:19956837-19956859 GAAGCAGGCAGGACTGCTGCCGG + Intronic
1171869905 20:30516393-30516415 GAGGGTTGCAAGGGTGCTGCTGG - Intergenic
1172099158 20:32475186-32475208 CAGGGCGCCAGGCCTGCTGGGGG - Intronic
1172448331 20:35004576-35004598 GAGGGAGGCAGGGGTGCAGCAGG + Intronic
1172786602 20:37472916-37472938 GAAGGTGGCAGGGATGGTGCTGG + Intergenic
1172849019 20:37947284-37947306 GAGGATGCAAGGCCTGCTTCAGG - Intergenic
1172863709 20:38078193-38078215 GAGGGGGCCAGGCCAGCAGCTGG - Intronic
1173556630 20:43970876-43970898 GAGCATGGCAGGCCTCCTGGAGG + Intronic
1173672739 20:44809859-44809881 GAGGGTGGCAGGTCGGCTCCAGG + Intronic
1173960378 20:47066783-47066805 GATGGTGGCAGGTCTCCTGGAGG - Intronic
1174452934 20:50630907-50630929 GAAGGTGGCTGGCCTGCGGACGG - Intronic
1174654691 20:52161028-52161050 GAGGGTGGCATACCTGCAGATGG + Intronic
1175065432 20:56282414-56282436 GAGGGAGGCTGGCCTACTGAAGG - Intergenic
1175217304 20:57398374-57398396 CAGGGTGACAGGCCAGCTGCAGG + Intronic
1176032080 20:63017515-63017537 CATGGTGGCAGGGCTGGTGCAGG + Intergenic
1176220331 20:63966629-63966651 GATGGTGACCGGCCTGCTGATGG + Exonic
1176410210 21:6445702-6445724 GAGGCTGGGTGGGCTGCTGCGGG + Intergenic
1178334479 21:31731620-31731642 GGGGGTGCCGGGCCTGCTGCGGG - Intronic
1179289683 21:40007660-40007682 GAGGGTTGTTGGCGTGCTGCAGG + Intergenic
1179303524 21:40134295-40134317 GTGAGTGGCAGCCCTGGTGCTGG - Intronic
1179511458 21:41876784-41876806 GAGCCAGGCAGGCCTGCTGCTGG - Intronic
1179525082 21:41970891-41970913 GAGGGAGCCAGGGCTGCCGCTGG - Intergenic
1179617339 21:42590382-42590404 CAGGGTGGCAGGCCCAGTGCAGG - Intergenic
1179685703 21:43054024-43054046 GAGGCTGGGTGGGCTGCTGCGGG + Intronic
1179908073 21:44434410-44434432 GACGGTGGCAGGGATGCTGTCGG + Intronic
1180075112 21:45458114-45458136 GAGGGAGGGAGGGCTGCAGCGGG + Intronic
1180130196 21:45822182-45822204 GAAGCTGGCAGGACTCCTGCAGG + Intronic
1180154428 21:45971193-45971215 GAGGGTGGCAGAACTGGTGATGG - Intergenic
1180235757 21:46458666-46458688 GAGGGTGGCGGGCTTGAGGCGGG - Intergenic
1180385466 22:12174453-12174475 GATTGTGGCAGGGATGCTGCTGG - Intergenic
1180702538 22:17789465-17789487 GAGAGTGGCAGCTCTGCTGTTGG + Exonic
1181306734 22:21921363-21921385 GAGGTGGGCAGGGCTGCTCCAGG - Exonic
1181581480 22:23831323-23831345 GAGGGAGCCAGGACTGATGCCGG - Intronic
1181636464 22:24176981-24177003 GAGGCTGCCAGGCCTGCAACTGG + Intronic
1181762456 22:25067621-25067643 GAGGATGGCAGGCCAGGCGCAGG - Intronic
1181783156 22:25207381-25207403 GAGGGAGCCAGGCCTGGGGCGGG + Intergenic
1182320475 22:29475712-29475734 CAGGCAGGCAGACCTGCTGCAGG + Intergenic
1182451103 22:30422416-30422438 GAGGGGGCCAGGCCTGCTATAGG - Exonic
1182790807 22:32951289-32951311 GAGGAAGGCAGCCATGCTGCTGG - Intronic
1183188101 22:36304012-36304034 TAGGGTTCCAGGCCTGCTGCAGG - Exonic
1183736580 22:39648039-39648061 GAGGGAGACAGGCCTGCAGAGGG - Intronic
1184108678 22:42383059-42383081 GTCGGTGGCAGGGCAGCTGCAGG + Exonic
1184264337 22:43339048-43339070 GAGGCTGCCAGGGCTGCTGTAGG - Intronic
1184757235 22:46523926-46523948 GACAGTGGCAGCCGTGCTGCAGG - Intronic
1184889913 22:47373328-47373350 GAGGCTGGCACCCCTGCTGCTGG - Intergenic
1185331450 22:50253860-50253882 AAGGGTGGAGGCCCTGCTGCGGG + Intronic
1185335236 22:50268316-50268338 GAGGGAGGCCCGTCTGCTGCAGG - Intronic
1185389204 22:50549716-50549738 CAGGGAGGCAGCCCTGCTCCAGG - Exonic
950818486 3:15732341-15732363 CAGGGTGGCAGAACCGCTGCTGG + Intronic
950911933 3:16604706-16604728 GATGGCGGCGGGCCTGCTGAGGG - Exonic
950968930 3:17167378-17167400 GAGGGTCTGAGGCCTGCTGTAGG + Intronic
952338126 3:32422359-32422381 CTGGGTGCCAGGCCTCCTGCTGG + Intronic
952885431 3:38008763-38008785 GAGGGTGGCAGGAGGGCAGCAGG - Intronic
952901419 3:38114338-38114360 GCAGGTGGGAGACCTGCTGCCGG + Exonic
954425494 3:50440845-50440867 GAGTGGGGCTGGCCTGCTCCAGG + Intronic
954677079 3:52321970-52321992 GGGGGTGCCAGGGCTGCTACTGG + Intronic
954727356 3:52624586-52624608 GAAGGTGGCAGTGCTGGTGCAGG - Intronic
958007711 3:87833716-87833738 GAGGGTGGGAGGACTGCTTGAGG - Intergenic
958864682 3:99486523-99486545 GATAGGGGCTGGCCTGCTGCTGG - Intergenic
961456802 3:127028507-127028529 GAGGGTGGCTGCCCTGCTCTGGG + Intronic
961645300 3:128389589-128389611 GAGGCTGGCCGCCTTGCTGCAGG + Intronic
961717049 3:128864883-128864905 GACAGAGGCAGGCCTGCAGCAGG + Intergenic
961750385 3:129090863-129090885 GATGGTGGAGGGCCAGCTGCTGG + Exonic
961829427 3:129615893-129615915 GAGGGTGAGAGGCCAGCAGCAGG + Intergenic
962420720 3:135226315-135226337 GAGGAAGCCAGGCCAGCTGCTGG - Intronic
966212249 3:177465400-177465422 GAGGTTGGCAGGACTTGTGCTGG - Intergenic
966567187 3:181396498-181396520 GAGGTTGTCAGGCCTGTTACTGG + Intergenic
966853256 3:184177240-184177262 GGGGCTGGCAGGCTGGCTGCCGG - Intronic
966866471 3:184261333-184261355 GCGGGCGGCGGGCTTGCTGCCGG + Exonic
967245795 3:187485104-187485126 GATGGGGACAGGCATGCTGCAGG + Intergenic
967259400 3:187627117-187627139 GAAGGGGTCAGTCCTGCTGCAGG - Intergenic
968123449 3:196142192-196142214 GAGGGGCCCAGACCTGCTGCAGG - Intergenic
968613501 4:1567440-1567462 GCGGGGGACAGGGCTGCTGCAGG - Intergenic
968678814 4:1901778-1901800 CAGGGAGGCAGGCCATCTGCTGG - Intronic
969282471 4:6179985-6180007 GAGGATGTCAGGCATGCTGCTGG - Intronic
969302994 4:6308300-6308322 GAGAGCGCCAGTCCTGCTGCGGG - Intergenic
969325625 4:6442252-6442274 GGGGAGGCCAGGCCTGCTGCTGG - Intronic
969411279 4:7029967-7029989 CAGGGTGGCAGGAGTGCAGCGGG + Intronic
970167357 4:13253255-13253277 GAGGATGGCAGGCCAGCTGAGGG + Intergenic
973191002 4:47385976-47385998 GAGGGTGGCATGCCTGGAGAGGG - Intronic
973843682 4:54889206-54889228 GAAGGTTGCAGTCCTGCTGTTGG - Intergenic
976286169 4:83373354-83373376 GAAGGGTGCATGCCTGCTGCTGG - Intergenic
976369724 4:84273541-84273563 GAGGGTGGCAGGCGGGATGAGGG + Intergenic
977507254 4:97917327-97917349 GAGAGAGGCAGGACTGCGGCCGG - Intronic
978545901 4:109872685-109872707 GAGGGTGGTAGGAATGCTGTAGG + Intergenic
985281169 4:188286974-188286996 GAGGGAGGCAGTCCTCCTGTAGG + Intergenic
985672360 5:1213291-1213313 GAGGGGGCCAGGCCTGTTGGGGG - Intronic
985852714 5:2400404-2400426 GAGAGTAGCAGGGCTGCAGCAGG - Intergenic
985992922 5:3578194-3578216 GAGGGTGAGATGCTTGCTGCTGG - Intergenic
986089722 5:4492641-4492663 GCGTGTGTCAGCCCTGCTGCCGG - Intergenic
986125948 5:4882483-4882505 GAGGGAGGAAGTCCTGCTCCAGG - Intergenic
986447905 5:7838900-7838922 GAGGGTGGCTGCCCACCTGCAGG - Intronic
989212091 5:38866358-38866380 GTGGGTGGCAGCCCTGATGCTGG + Intronic
990088485 5:52009430-52009452 CTGGGTGGCTGGCCTGCTACTGG - Intronic
991587552 5:68215801-68215823 GAGGGCGGCAGGCTAGCTGTCGG + Exonic
997530442 5:134578487-134578509 GAGGTGGACAGGCCTGCTGAGGG - Exonic
997530587 5:134579105-134579127 CCGGGTGCCAGGCCTGATGCTGG + Exonic
998165810 5:139842910-139842932 GTGGTCGGCAGACCTGCTGCTGG - Exonic
998174652 5:139894359-139894381 GAAGGGGGCTGGCCTGCAGCTGG - Intronic
1001551259 5:172603746-172603768 GAGGGTGGCTGGGCTGATGGTGG + Intergenic
1001860212 5:175047774-175047796 GAGGGTGGCAGGACGGATGCAGG + Intergenic
1002186970 5:177459058-177459080 GATGATGGGAGGCCTGGTGCAGG + Intronic
1002327008 5:178416319-178416341 GAGGGAGGCAGGCCAGCTGCAGG - Intronic
1002466622 5:179411920-179411942 GAGGGTGGAAGGCCGGTTGTGGG - Intergenic
1002466695 5:179412083-179412105 GAGGGTGGAAGGCCGGTTGTGGG - Intergenic
1002466714 5:179412130-179412152 GAGGGTGGAAGGCCGGTTGTGGG - Intergenic
1002466945 5:179412659-179412681 GAGGGTGGAAGGCCGGTTGTGGG - Intergenic
1002548056 5:179965232-179965254 GAGGTAGCCAGGCCGGCTGCAGG - Intronic
1002661361 5:180792856-180792878 GAGGGTGGCCTGCCAGGTGCTGG + Exonic
1002718780 5:181245781-181245803 GAGGGTGGCAGAGCTGCCGGAGG + Intronic
1002922254 6:1581015-1581037 GAGGGAGTCAGGCCTGGGGCGGG + Intergenic
1003276957 6:4661396-4661418 GTGGGAGCCAGGGCTGCTGCTGG - Intergenic
1004565937 6:16797865-16797887 GAAGGTGGCAGAAGTGCTGCTGG - Intergenic
1004864231 6:19837687-19837709 GAGGGAGGCAGGCAAGCTCCGGG - Exonic
1006421128 6:33934935-33934957 GAAGGTGGCAGAGCTGCTGAAGG - Intergenic
1006423313 6:33948903-33948925 GAGTGTGGGGGGCCTGGTGCAGG + Intergenic
1006845670 6:37059777-37059799 GAGGGTGGCATGCCTGGAGGAGG + Intergenic
1007227946 6:40328026-40328048 GTGGGAGGCAGGGCTGCTGAGGG + Intergenic
1007369722 6:41418378-41418400 GAGGGTGGCAGGGGTGATGGTGG - Intergenic
1007661594 6:43490098-43490120 GAGGGAGGCAGCCAGGCTGCGGG - Intronic
1007722219 6:43891746-43891768 GAGGGTGGCAGGCATGGCGGAGG + Intergenic
1007784099 6:44270548-44270570 GAGGGTGGGAGGCAGGCTGGGGG - Exonic
1009685405 6:66949591-66949613 GAGGGGTGCAGGCCCACTGCTGG + Intergenic
1011360447 6:86518681-86518703 TAGGATGGCAGGCTTGCTGGGGG - Intergenic
1013178869 6:107701243-107701265 GTTGGTAGCAGCCCTGCTGCAGG + Intergenic
1013579390 6:111518163-111518185 GAGGGTGGGAGTGATGCTGCAGG - Intergenic
1014180098 6:118374870-118374892 GATGGTGGCAGGCCACTTGCTGG - Intergenic
1014932240 6:127348791-127348813 CACTGTGGCAGGCCTGGTGCTGG - Intergenic
1015525898 6:134175315-134175337 GAGGGTGGGAGTCCGGCCGCAGG - Intronic
1018225281 6:161622365-161622387 GAAAGGGGCAGGCCTGGTGCTGG - Intronic
1018730354 6:166645596-166645618 GAGCATGGCAGGGCTGCTCCAGG - Intronic
1018817289 6:167343096-167343118 GAGGTTGGCAAGCCTACTCCAGG + Intronic
1019137766 6:169922050-169922072 GAGGCTGGCACACATGCTGCTGG + Intergenic
1019452415 7:1106619-1106641 GAGGGTGACGGGCCTGGGGCAGG + Intronic
1019477188 7:1249639-1249661 GGGGGTGGGAGGGCTGCTGCTGG + Intergenic
1019497300 7:1346536-1346558 GAGGGTGGCATCCCTGCCGTGGG - Intergenic
1019578643 7:1749482-1749504 GAGAGTGTGAGGCCTGCTCCGGG + Intergenic
1019694536 7:2437925-2437947 GAGGCTGGCAGGGCTGCCGTAGG + Intergenic
1020337824 7:7076313-7076335 GAGAGTGGCAGGTCTGTTCCTGG - Intergenic
1022823703 7:33987224-33987246 GAGGGTGGCAGTGCTCCTGTGGG + Intronic
1023214671 7:37848877-37848899 GAGGCTAGCAGGCCTCCTGCTGG - Exonic
1023435313 7:40135271-40135293 GAGCGGGGCAGGCCGGCCGCAGG - Intronic
1023696960 7:42857315-42857337 GAGGGCGGCACAGCTGCTGCAGG + Intergenic
1023840884 7:44096909-44096931 CAGGGGGGCAGGCCTGCTGTGGG + Intergenic
1023892054 7:44400042-44400064 GTGGGTGGCTGCTCTGCTGCGGG - Intronic
1023919781 7:44619089-44619111 GAGGGTGGCATGCCTGGGGAGGG + Intronic
1023990648 7:45126372-45126394 GCGGGTGGCAGGCAGGCGGCAGG + Intergenic
1025079292 7:55968019-55968041 GAGGGTGGGAGGACTGCTTGAGG - Intronic
1025606247 7:63041907-63041929 TTGGGTGCCAGGCCTGGTGCTGG + Intergenic
1026031534 7:66798546-66798568 CAAGAGGGCAGGCCTGCTGCAGG + Intronic
1026033544 7:66815610-66815632 GAGGGGGGCAGGCAGGCTCCTGG + Intergenic
1026513810 7:71049616-71049638 GTGGGGGGCTGGCCTGGTGCTGG - Intergenic
1026988534 7:74569895-74569917 CAGGGTGGCAGGCAGGCTGGGGG + Intronic
1029253388 7:99252568-99252590 AAGGGTAGCAGCCCTCCTGCTGG + Intergenic
1029300114 7:99575670-99575692 GAGAGTGGCAGGTCTGTTCCTGG + Exonic
1030219205 7:107079540-107079562 GCGTGTGGCAGCCCTGCTTCAGG + Intronic
1030605325 7:111633547-111633569 GTGCATGGCAGCCCTGCTGCTGG + Intergenic
1031702773 7:124945401-124945423 CAGGGTGCCAGCCCTCCTGCAGG - Intergenic
1031982441 7:128136407-128136429 GAGGGTGGGATGTGTGCTGCGGG - Intergenic
1032011856 7:128352190-128352212 GGGGCTGGCCTGCCTGCTGCTGG - Exonic
1032669787 7:134072453-134072475 GAGGGTCTTAGGCCTGCTTCAGG + Intergenic
1033310743 7:140260114-140260136 GAAGGAGGCAGGGCTGCTACAGG + Intergenic
1033421684 7:141209704-141209726 GCTGGTGGAACGCCTGCTGCTGG + Intronic
1033842057 7:145386743-145386765 GAGGGAGGCAGGGTTGCTGTTGG + Intergenic
1034277090 7:149828793-149828815 GAGGGTGGTAGGGCTGCAGGGGG - Intergenic
1035263141 7:157674303-157674325 GAGGGTGGGGGGACTCCTGCTGG + Intronic
1035569629 8:663401-663423 GGGGGTGTCAGGCGGGCTGCTGG - Intronic
1035918558 8:3652191-3652213 GATGGTGGTAGGCCCGCTGAAGG - Intronic
1036184651 8:6613113-6613135 GAGGAAGGCAGGCCTGCAGCAGG + Intronic
1036913801 8:12785379-12785401 GTCTGTGGCAGCCCTGCTGCTGG + Intergenic
1037074821 8:14701730-14701752 GGAGGTGGCAGACCTGATGCTGG - Intronic
1037286947 8:17311543-17311565 CTCGGTGGCAAGCCTGCTGCTGG - Exonic
1037822025 8:22139679-22139701 GCGGGTGGCAGCCCTGCTCTTGG - Intronic
1039873886 8:41569108-41569130 GGGGGTGGCCAGCCTGCGGCCGG - Intergenic
1039895680 8:41715008-41715030 GCGGGTGGCAGAGCTGCTGCTGG - Exonic
1041143133 8:54843809-54843831 GAGGGAAGCAGGCCCGCTGTTGG + Intergenic
1043053336 8:75407880-75407902 GTGGGTGGGGGACCTGCTGCCGG + Intergenic
1043516625 8:81000861-81000883 GGAGTTGACAGGCCTGCTGCGGG - Intronic
1043984119 8:86673443-86673465 GAGGGTGGCAGGAGTGATGGTGG + Intronic
1044265483 8:90176556-90176578 GTGTGTGCCAGGCCTGGTGCTGG + Intergenic
1045524496 8:102930121-102930143 GGGTGTGGCATGGCTGCTGCTGG + Intronic
1047251044 8:123182406-123182428 GAGGCAGGCAGGCCTCCTTCAGG + Exonic
1047739716 8:127796736-127796758 GGCAGTGGCAGGCCTGCTGATGG + Intergenic
1048216784 8:132502884-132502906 GAGGGTCTTAGGCCTGCAGCAGG + Intergenic
1048805843 8:138240572-138240594 GAGTATGGCAGGCATGGTGCTGG + Intronic
1049151634 8:141038708-141038730 GAGAGTGGCAGGCCTCTTGGGGG + Intergenic
1049328968 8:142039599-142039621 AAGGGTGGCCAGCCTGGTGCGGG - Intergenic
1049348994 8:142154092-142154114 GAGGGTGAGCGGCCTGCTGTGGG - Intergenic
1049435231 8:142583421-142583443 GGGGGCAGCAGGCCTGCTCCTGG - Intergenic
1049435600 8:142584790-142584812 GCGGGTGACAGGCCTGCTCTGGG - Intergenic
1049789620 8:144466709-144466731 GAGGGGGGCAGGCAGCCTGCTGG - Intronic
1049847131 8:144808295-144808317 GAGGGTGGACAGCCGGCTGCAGG - Exonic
1051081546 9:13299968-13299990 CAAGGTGGGAGGACTGCTGCAGG + Intergenic
1052835786 9:33248929-33248951 GAGGGTGGCAGGATTGCTTCAGG + Intronic
1053123048 9:35560431-35560453 GAGGTGGGCAGGCCGGCTGGTGG + Exonic
1053547554 9:39039352-39039374 GAAGGTGTCAGGCAGGCTGCTGG - Intergenic
1055216800 9:73873285-73873307 GAGGGGTGCAGGTGTGCTGCAGG - Intergenic
1055773917 9:79747674-79747696 GAGGGTGGCAGGACCTCTGGAGG - Intergenic
1056167865 9:83956392-83956414 GAGGGTGGCAGAGCTGCTGCTGG - Exonic
1056601427 9:88050178-88050200 CAGGGTGGAAAGACTGCTGCAGG - Intergenic
1056760132 9:89408674-89408696 GGAGGAGGCAGGCCTGCGGCAGG + Intronic
1056960407 9:91117747-91117769 GAGGATGGCAGGATGGCTGCTGG - Intergenic
1056967553 9:91177811-91177833 GTGCCTGGCAGGCCTGCTGAGGG + Intergenic
1057025356 9:91730995-91731017 GAGGGGGGCACGCCTACTGCCGG - Exonic
1057825683 9:98370572-98370594 GCAGGTGGCCGGCCTGCTGCAGG + Intronic
1059382055 9:113934353-113934375 GTGGGTGGCAGACCTGAGGCTGG - Intronic
1060024826 9:120162173-120162195 CAGGGTGCCAGGGCTGCTGTGGG - Intergenic
1060224336 9:121782211-121782233 GAGGGTGGCAGGCAGGCTCCGGG - Intronic
1060881987 9:127123788-127123810 CAGGAGGACAGGCCTGCTGCCGG + Intronic
1061219015 9:129238093-129238115 CAGGGTGGCAGGCCTGCCGGGGG - Intergenic
1061275558 9:129568029-129568051 GAGGGTGGCAGGCTGGCTCTGGG + Intergenic
1061473207 9:130843882-130843904 GAGCCTGGCATGCCTGCTTCAGG + Intronic
1061498770 9:130990520-130990542 GAGGGGGACAGGCCTGGCGCAGG - Intergenic
1061859580 9:133460959-133460981 GAGGGAGGCAGGTCAGCTCCAGG + Intronic
1061909289 9:133714325-133714347 GAAGGTGGCAGGGCCACTGCAGG + Intronic
1061935658 9:133856324-133856346 GAGGGTGGCAGGGCTGGGCCAGG + Intronic
1062084267 9:134640916-134640938 GAGACTGGCGGGCCTCCTGCTGG + Intergenic
1062434647 9:136541560-136541582 GGGGGAGCCAGGCCTCCTGCAGG + Intronic
1062480448 9:136748465-136748487 GAGGATGGGCGGCCTGCTGCTGG - Exonic
1062549163 9:137078072-137078094 CAAGGTGGCCGTCCTGCTGCTGG + Exonic
1203549237 Un_KI270743v1:154335-154357 GATGGTGGCAAGGATGCTGCTGG + Intergenic
1186355347 X:8784139-8784161 GAGTCCTGCAGGCCTGCTGCGGG - Intergenic
1187399785 X:18949253-18949275 CAGGGTGGAAGGCCAGCTCCTGG - Intronic
1187981382 X:24761443-24761465 GAGGGTGGTGTGCCTTCTGCAGG + Intronic
1188790123 X:34398311-34398333 GAATATGGCAGGCCAGCTGCTGG + Intergenic
1189732123 X:44032469-44032491 GGGCCTGGCAGGCCTCCTGCTGG + Intergenic
1190280425 X:48925618-48925640 GAGGAGGGCAGCCATGCTGCTGG - Intronic
1200131964 X:153854664-153854686 GGGTGTGGCATGTCTGCTGCTGG + Intergenic
1200179011 X:154139147-154139169 GAGCGTGGCTGGCCTGCTCCAGG - Intergenic