ID: 1138526341

View in Genome Browser
Species Human (GRCh38)
Location 16:57609738-57609760
Sequence GACGCAGTGGTGCCTCCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138526341_1138526344 15 Left 1138526341 16:57609738-57609760 CCTCAGGGAGGCACCACTGCGTC No data
Right 1138526344 16:57609776-57609798 TAAAGCTATGCCTCCGAGTATGG No data
1138526341_1138526347 26 Left 1138526341 16:57609738-57609760 CCTCAGGGAGGCACCACTGCGTC No data
Right 1138526347 16:57609787-57609809 CTCCGAGTATGGCGTGCTTTGGG No data
1138526341_1138526346 25 Left 1138526341 16:57609738-57609760 CCTCAGGGAGGCACCACTGCGTC No data
Right 1138526346 16:57609786-57609808 CCTCCGAGTATGGCGTGCTTTGG No data
1138526341_1138526348 27 Left 1138526341 16:57609738-57609760 CCTCAGGGAGGCACCACTGCGTC No data
Right 1138526348 16:57609788-57609810 TCCGAGTATGGCGTGCTTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138526341 Original CRISPR GACGCAGTGGTGCCTCCCTG AGG (reversed) Intergenic
No off target data available for this crispr