ID: 1138526577

View in Genome Browser
Species Human (GRCh38)
Location 16:57611517-57611539
Sequence GCTCACATTCTGAAGTACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1565
Summary {0: 1, 1: 0, 2: 47, 3: 387, 4: 1130}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138526577_1138526579 21 Left 1138526577 16:57611517-57611539 CCTGAGTACTTCAGAATGTGAGC 0: 1
1: 0
2: 47
3: 387
4: 1130
Right 1138526579 16:57611561-57611583 ACAGAAGTAAGCAAGTTAATTGG 0: 1
1: 0
2: 1
3: 25
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138526577 Original CRISPR GCTCACATTCTGAAGTACTC AGG (reversed) Intronic
900536664 1:3182052-3182074 GCTCACATTCACACGCACTCTGG + Intronic
900688763 1:3966576-3966598 GGTCACATTCCGAAGTATTTGGG + Intergenic
900824348 1:4914064-4914086 GGTCACATTTTGAGGTACTGGGG + Intergenic
900926145 1:5707378-5707400 GATCACATTCTGAGGTCCTGGGG - Intergenic
901260529 1:7867318-7867340 AGTCACATTCTGAAATACTGGGG - Intergenic
901416218 1:9118631-9118653 ACTCACATTCTGAGGTTCTGGGG - Intronic
902543948 1:17174491-17174513 GGTCACATTCTGAGGTATTAGGG - Intergenic
902622421 1:17658261-17658283 GGTCATATTCTGAGGTACTGGGG + Intronic
902692928 1:18121571-18121593 GCTCATTCTCTAAAGTACTCTGG + Intronic
902834016 1:19035214-19035236 GCCCACATTCTGAGGTTCTGGGG - Intergenic
902981807 1:20128778-20128800 AGTCACATTCTGAAGTATTGGGG - Intergenic
903473620 1:23604731-23604753 GGTCACATTCTGAGGTACTACGG - Intronic
904637004 1:31889868-31889890 GGTCACATTCTGAGGTACTGGGG - Intergenic
904941793 1:34168842-34168864 GGTCACATCCTGAAGTACTAGGG + Intronic
905194529 1:36265063-36265085 GGTTACATTCTGAGGTACTAGGG + Intronic
905367496 1:37461580-37461602 GGTCACATTCTGAGGTACTGGGG - Intergenic
906200268 1:43955722-43955744 GATCACATTTTGAGGTACTGGGG + Intronic
906670889 1:47653826-47653848 GGTCACATTTTGAGGTACTTGGG + Intergenic
907563954 1:55417227-55417249 GGTCACATTCTGAGGTACTGGGG + Intergenic
907583330 1:55591815-55591837 GGGCACATTCTGAAGTACTGGGG + Intergenic
907612200 1:55882736-55882758 GGTCACATTCTGAAGTACTGTGG - Intergenic
907703579 1:56813607-56813629 GGTCACATTCTGAGGTGCTGGGG + Intronic
907782048 1:57575958-57575980 GCTTGCATTCTGAAGTACTAGGG - Intronic
907800243 1:57757707-57757729 GTTCACATTCTGAGGTACTGAGG + Intronic
908087966 1:60657006-60657028 AGTCACATTCTGAGGTACTAGGG + Intergenic
908168671 1:61483731-61483753 AGTCACATTCTGAGGTACTAGGG + Intergenic
908313991 1:62914854-62914876 GGTCACATTCTAAGGTACTGAGG - Intergenic
908326817 1:63031226-63031248 GATCACATTTGGAAGTACTCTGG - Intergenic
908467225 1:64408373-64408395 GGTCACATTCTGAGGTTCTGGGG + Intergenic
908536936 1:65086988-65087010 AGTCACATTCTGCAGTACTGGGG - Intergenic
908621318 1:65983450-65983472 GGTCACTTTCTGAGGTACTGGGG - Intronic
908846353 1:68328507-68328529 AGTCACATTCTGAGGTACTGGGG + Intergenic
909095389 1:71280717-71280739 GCTCACTTTTTAAAGTACTATGG - Intergenic
909456517 1:75855785-75855807 GATCACATTTTGAGGTACTGAGG + Intronic
909461241 1:75916907-75916929 CATCACATTCTGAGGTACTGAGG - Intergenic
909538395 1:76764235-76764257 GGTCACATTATGAGGTACTGGGG + Intergenic
909746419 1:79103613-79103635 GCTCAGATTCTTAATTTCTCTGG - Intergenic
909893535 1:81037242-81037264 AGTAACATTCTGAAGTACTGGGG - Intergenic
910095331 1:83515189-83515211 AGTCACATTCTGAGGTACTGAGG + Intergenic
910270851 1:85392400-85392422 GATCACATTCTGAGGTACTAGGG + Intronic
910282436 1:85516145-85516167 AGTCACATTCTGAGGTACTGGGG + Intronic
910436072 1:87207502-87207524 GGTCACATTCTAAGGTACTGGGG - Intergenic
910507697 1:87968811-87968833 GCTCACATTCTCATGTAAACAGG + Intergenic
910537351 1:88313677-88313699 GGCCACATTCTGAGGTACTGGGG - Intergenic
911303408 1:96204073-96204095 CGTCACATTCTGAAGTAGTTAGG + Intergenic
911372877 1:97015044-97015066 GGCCACACTCTGAAGTACTGGGG + Intergenic
911507045 1:98766192-98766214 GGTCACATTCTGAGGTATTGAGG + Intergenic
911507909 1:98776414-98776436 AGTCACATTCTGAGGTACTGAGG + Intergenic
911566174 1:99465610-99465632 GGTCACATTCTGAGGTACTGGGG - Intergenic
911607224 1:99920425-99920447 GTTCACATTCTGAGGTACTCGGG + Intronic
911730208 1:101284587-101284609 AGTCACATTCTGAAGTACTGGGG - Intergenic
911816659 1:102360819-102360841 GGTAACATTCTGAGGTACTGGGG + Intergenic
911833885 1:102590820-102590842 AGTCACATTCTGAGGTACTGTGG + Intergenic
912540897 1:110414556-110414578 GGTCACATTCTGAGGTACTGGGG - Intergenic
912554250 1:110504612-110504634 GATCACATTCTGAGGTACTGGGG - Intergenic
912860017 1:113205963-113205985 AGTCACATTCTGAGGTACTGGGG + Intergenic
913254373 1:116940506-116940528 GGTCACATTCTGGGGTACTGGGG + Intronic
913398328 1:118397632-118397654 GCACACTTTCTGCAGTACTTCGG + Intergenic
913468058 1:119163493-119163515 AGTCACATTCTGAGGTACTGGGG - Intergenic
913677654 1:121156946-121156968 GGTCACATTCTGAGGGACTGAGG - Intergenic
914029488 1:143944575-143944597 GGTCACATTCTGAGGGACTGAGG - Intronic
914159961 1:145123375-145123397 GGTCACATTCTGAGGGACTGAGG + Intergenic
914207655 1:145547745-145547767 AGTCACATTCTGAGGTACTGGGG - Intergenic
914340248 1:146754075-146754097 AGTCACATTCTGAGATACTCGGG + Intergenic
914949984 1:152104809-152104831 GATTACATTCTGAGGTACTGAGG + Intergenic
915155292 1:153870590-153870612 TTTCACATTTTGAAGTACTTTGG - Intronic
916023006 1:160810563-160810585 AGTCACATTCAGAGGTACTCGGG + Intronic
916303852 1:163306603-163306625 GGTCACATTCTGAAGTATTTGGG - Intronic
916589370 1:166175624-166175646 GGTCACATTCTGAGTTACTGGGG - Intergenic
916590419 1:166184726-166184748 GTTCACATTCTGAAGTACTGGGG + Intergenic
916607343 1:166356056-166356078 GCTCAAAATCTGGAGTAATCTGG + Intergenic
916644290 1:166767210-166767232 GGTCACATTCTGAGGTACTGTGG + Intergenic
916655305 1:166870179-166870201 AGTCATATTCTGAAGTACTAGGG - Intronic
917068180 1:171120635-171120657 AGTAACATTCTGAAGTACTAGGG + Intergenic
917124266 1:171671638-171671660 GGTCACATTCTGAGGTACTGGGG + Intergenic
917144228 1:171870885-171870907 TCTCAAATTCTGTCGTACTCTGG - Intronic
917640788 1:176981393-176981415 GGTAACATTTTGAAGTACTAGGG - Intronic
917730275 1:177868168-177868190 GGCCACATTCTGAGGTACTGGGG - Intergenic
917870598 1:179238533-179238555 GGTCACATTGTGAAGTATTAGGG - Intergenic
918060879 1:181060332-181060354 GGCCACATTCTGAGGTACTGGGG + Exonic
918073023 1:181147720-181147742 GCTCACATGCTGAAGTGCCCTGG - Intergenic
918157384 1:181862326-181862348 AGTCACATTCTGAGGTACTGGGG - Intergenic
918318021 1:183339399-183339421 GATCACATTTTTAAGTCCTCAGG + Intronic
918625201 1:186649503-186649525 AGTCACATTCTGAAGTTCTGGGG - Intergenic
918626240 1:186658954-186658976 GCTCATGCTCTGAACTACTCTGG + Intergenic
919007385 1:191915235-191915257 GCTCTCAATCTGAAGTACTGGGG - Intergenic
919155413 1:193758841-193758863 CTTCACATTCTGAAGTACTAGGG + Intergenic
919251635 1:195064241-195064263 GGTCACATTCTGAGGTACTAGGG - Intergenic
919348851 1:196422029-196422051 GTTCACATGCTGAGGTACTAAGG + Intronic
919692639 1:200541465-200541487 GATCACATTCTGAAGTACTGGGG - Intergenic
919997023 1:202761572-202761594 AGTCACATTCTGAGGTACTGAGG - Intronic
920007237 1:202842332-202842354 GGTCACATTCTGAGATACTGGGG + Intergenic
920236633 1:204511339-204511361 ATTCCCATTCTGAAGTACTGGGG - Intergenic
920464960 1:206175456-206175478 GGTCACATTCTGAGGGACTGAGG - Intergenic
920702042 1:208225249-208225271 GAACACATTCTGAGGTACTTAGG - Intronic
920740735 1:208579017-208579039 AGTCACATTCTGAGGTACTTAGG - Intergenic
920868388 1:209772419-209772441 GGTCACATTCTGGGGCACTCGGG + Intronic
920879427 1:209866130-209866152 AGTCACATTCTGAACTACTGGGG + Intergenic
921153222 1:212418099-212418121 GGTCACATTCTGAGGTACTGAGG - Intergenic
921265999 1:213421071-213421093 GGTCACATTTTGAGGTACTAGGG + Intergenic
921278848 1:213545652-213545674 GGTCTCATTCTGAGGTACTGGGG + Intergenic
921387739 1:214587867-214587889 GGTCACATTCTGAAGTACCTGGG + Intergenic
921388574 1:214596418-214596440 AGTCACATTCTGAAATACTGGGG - Intergenic
921716413 1:218421681-218421703 GATCACATTCCAAAGTACTGGGG - Intronic
921719098 1:218450646-218450668 GGTCATATTCTGAGGTACTAGGG + Intergenic
921733753 1:218603014-218603036 AGTCACATTCCGAAGTACTGGGG - Intergenic
922088878 1:222376791-222376813 GGTCACATTCTGAGGTACTGAGG + Intergenic
922110802 1:222553268-222553290 GGTCACATTCTGAGGTACTGGGG + Intergenic
922141348 1:222891010-222891032 GGTCACATTCTGAGGTACTGAGG + Intronic
922210374 1:223481634-223481656 GTTCACATTCTGAATTACTGGGG + Intergenic
922494354 1:226044329-226044351 CGTCACATTCTGAAGTGCTATGG + Intergenic
922951768 1:229563785-229563807 GGTCACATTCTGAGGTCCTGGGG - Intergenic
922953019 1:229575015-229575037 AGTCACATTCTGAAGTACTGGGG - Intergenic
923052475 1:230398498-230398520 GGTCACATTTTGAAGTACTAGGG + Intronic
923087261 1:230711114-230711136 GGTCACATTCTGAGGTCCTGGGG - Intronic
923189359 1:231605755-231605777 GGTCACATTCAGAAGCACTGGGG + Intronic
923215877 1:231847346-231847368 AGTCACATTCTGAAGTACCAGGG + Intronic
923254276 1:232207328-232207350 GTTCACATTCTCAAATGCTCTGG + Intergenic
923469896 1:234281121-234281143 AGTTACATTCTGAAGTACTGGGG - Intronic
923552846 1:234977993-234978015 GGTCACATTCTGAGGTCCTGGGG + Intergenic
923554575 1:234990629-234990651 GCTCACATTCACAGGTACTGGGG + Intergenic
923561324 1:235044043-235044065 ACTCACATTGTTAAGTACTGGGG - Intergenic
923952897 1:238980043-238980065 AGTCACATTCTGAAGTACTGGGG - Intergenic
924036844 1:239946326-239946348 GGTCACTTTCTGAAGTACTGGGG - Intergenic
924041897 1:239992113-239992135 GGTCACTTTCTGAAGTACTGGGG + Intergenic
924217664 1:241840654-241840676 GGTCACATTCTGAGGTATTGGGG + Intergenic
924275875 1:242386216-242386238 GGTCTCATTCTGAGGTACTTGGG + Intronic
924326396 1:242898665-242898687 AGTCACATTCTAAAGTACTCAGG + Intergenic
924388159 1:243520110-243520132 AGTCACATTCTGAGGTACTTGGG - Intronic
924669770 1:246111777-246111799 CCTCACATGGTGAAGTAGTCTGG - Intronic
924757074 1:246951245-246951267 GGTCACATTCTGAGATACTGGGG - Intronic
924815660 1:247439617-247439639 GGTCACAATCTGAAGTACTGGGG + Intronic
1062936296 10:1392890-1392912 GGTCACATTCTGAGGGACTGGGG - Intronic
1063042669 10:2359110-2359132 GGTCACATTCTGAAGTCCTGAGG - Intergenic
1063524426 10:6771843-6771865 GGTCACATTATGAAGTGCTGGGG - Intergenic
1063882940 10:10549775-10549797 CATCACATTCTGAGGTACTGAGG + Intergenic
1064199089 10:13269674-13269696 CATCACATTCTGAGGTACTAGGG - Intergenic
1064468105 10:15605769-15605791 GCTCACATTCTGGTGGACTGTGG - Exonic
1064676487 10:17765224-17765246 GGTCACATTCGGAGGTACTGGGG + Intronic
1064676675 10:17767085-17767107 GATCACATTCTGAAGTACTGGGG + Intronic
1065164518 10:22961034-22961056 GGTCACATTATGAGGTACTGGGG + Intronic
1065249813 10:23799239-23799261 GGTCACATTCTGAGGTCCTGGGG + Intronic
1065262280 10:23936401-23936423 GGTCACATTCACAAGTACTGGGG - Intronic
1065801019 10:29352458-29352480 CATCACATTCTGAGGTACTAGGG - Intergenic
1065812012 10:29450991-29451013 GGTCACATTCTGAGGTACTAGGG + Intergenic
1065847294 10:29756272-29756294 ACTCACATTGTGAAATACTGTGG + Intergenic
1065959772 10:30725166-30725188 GGTCACATTCTGCGGTACTAGGG - Intergenic
1066131427 10:32398010-32398032 GCTCACTTTCTAACATACTCAGG - Intergenic
1066160498 10:32722721-32722743 GATCACATTCTGAGATACTGAGG + Intronic
1067204433 10:44200961-44200983 GGTCACATTCTGAGCTACTAGGG - Intergenic
1067518120 10:46972789-46972811 GGTCACATTCTGAGGTACAAAGG - Intronic
1067644129 10:48079039-48079061 GGTCACATTCTGAGGTACAAAGG + Intergenic
1067735525 10:48847336-48847358 TGTCACATTCTGAGGTACTAGGG + Intronic
1067763348 10:49067433-49067455 AGTCACATTCTGAAGTACTGAGG - Intronic
1068342547 10:55726525-55726547 AGTCACATTCTGAGGTACTATGG - Intergenic
1068614594 10:59099286-59099308 GCTTAAATTCTGCAGTACTGTGG - Intergenic
1069396701 10:67997601-67997623 AGTCACATTCTGAGGTACTCAGG - Intronic
1069404312 10:68082051-68082073 AGTCACATTCTGAGGTACTGGGG + Intergenic
1069669951 10:70193968-70193990 CCTCACATTCTGAGGTGCTGGGG - Intergenic
1069696027 10:70386139-70386161 GGCCACATTCTGAGGTACTAGGG - Intergenic
1069980111 10:72246592-72246614 GGTCACATTCTGAGATACTGGGG + Intergenic
1070396633 10:76017014-76017036 GGTCACCTTCTGAGGTACTGGGG - Intronic
1070421590 10:76242716-76242738 GCTGACATTCTGAGGTACTGGGG + Intronic
1070872600 10:79770124-79770146 GGTCACATTCTGAGATACTGGGG + Intergenic
1071228053 10:83554540-83554562 AGTCACATTCTGAGGTACTGGGG + Intergenic
1071234135 10:83624765-83624787 AGGCACATTCTGAAGTACTGGGG - Intergenic
1071385650 10:85117679-85117701 TATCACATTCTGAAGTACTAGGG + Intergenic
1071506783 10:86237199-86237221 GTTCACATTCTGAGGTACTGGGG - Intronic
1071639522 10:87292273-87292295 GGTCACATTCTGAGATACTGGGG + Intergenic
1071655713 10:87445679-87445701 GGTCACATTCTGAGATACTGGGG - Intergenic
1071729193 10:88231150-88231172 AGTCACATTCTGAGGTACTGAGG - Intergenic
1071921541 10:90356238-90356260 ACTCACATTCTGAGGTACTGGGG - Intergenic
1071934037 10:90506915-90506937 ACTCACATTTTGAAGTACTGGGG - Intergenic
1071969725 10:90891453-90891475 GATTACATTCTGAGGTACTGAGG + Intronic
1072057306 10:91772729-91772751 GGTCACATTCTGAAGTACTGGGG + Intergenic
1072205939 10:93205361-93205383 GGTCACATTCTGAGGTACTGGGG + Intergenic
1072260513 10:93666019-93666041 AGTCACATTCTGAGGTACTGGGG + Intergenic
1072326918 10:94307791-94307813 AGTCACATTCTGAGGTACTGAGG + Intronic
1072991758 10:100202290-100202312 GGTCACATTCTGAGGTATTAGGG - Intronic
1073529726 10:104219968-104219990 GGTCACATTCTGAGGTGCTGGGG - Intronic
1073876761 10:107932493-107932515 GGTCACATTCTGAGGTACTGGGG + Intergenic
1073903648 10:108251562-108251584 GCTCTCATTCTGAATAACTGAGG + Intergenic
1074056434 10:109926328-109926350 GATCACATTCGAAAGTACTAGGG - Intergenic
1074107078 10:110396399-110396421 GGTCATATTCTGAAGTACTAGGG - Intergenic
1074227862 10:111505197-111505219 AGTCACATTCTGAAATACTGGGG + Intergenic
1074243641 10:111665519-111665541 CATCACATTCTTAAGTACTCAGG - Intergenic
1074501896 10:114033162-114033184 GGTCACATTTTGAAATACTAGGG - Intergenic
1074723553 10:116284877-116284899 GGTCACATTCTGAGCTACTGGGG + Intergenic
1074754470 10:116614218-116614240 GGTCATGTTCTGAAGTACTGGGG + Intergenic
1074886155 10:117695406-117695428 AGTCACATTCTGAAGTACTGGGG - Intergenic
1075022664 10:118963135-118963157 AGTCACATTCTGAGGTACTGGGG + Intergenic
1075073050 10:119331540-119331562 GCTCACTTTCTGAAGTTCTTTGG + Intronic
1075220773 10:120582523-120582545 GGTCACATTCTGAGGTCCTAGGG + Intronic
1075344841 10:121674386-121674408 GTTCACATTCTGAATTATTAGGG + Intergenic
1075957657 10:126537835-126537857 GATCACATTCTGAGGTACTGGGG - Intronic
1076193171 10:128497362-128497384 AGTCACATTCTGAGGTACTGGGG - Intergenic
1076811790 10:132890177-132890199 GGTCACATTCTGAAGGGGTCTGG + Intronic
1077247195 11:1545410-1545432 GGTCACATTCTGAGGTACTGGGG - Intergenic
1078005942 11:7532315-7532337 AGTCACATTCTGAGGTACTGGGG + Intronic
1078319236 11:10318836-10318858 AGTCACATTCTGAGGTACTGAGG - Intronic
1078428163 11:11267912-11267934 GATCACATTCTGAGGTACTGGGG - Intergenic
1078428528 11:11269996-11270018 GGTCACATTCTGAGGTACTGGGG - Intergenic
1078478666 11:11657090-11657112 GGTCACATTCTGAGGTATTGGGG - Intergenic
1078506370 11:11951325-11951347 GGTCACATTCTGAGGTACTAGGG + Intronic
1078709368 11:13776067-13776089 GGTCACATTCAGAAGTACTGGGG + Intergenic
1078773521 11:14373171-14373193 TTTCACATTTTGAAGTACTTTGG + Intergenic
1078801716 11:14651376-14651398 GATTACATTCTGAGGTACTGAGG + Intronic
1078907973 11:15705060-15705082 AGTCACATTCTAAAGTACTGGGG - Intergenic
1078942539 11:16023985-16024007 AGTCACATTCTGAGGTACTAGGG - Intronic
1079290177 11:19181021-19181043 CATCACATTCTGAGGTACTGGGG - Intergenic
1079366761 11:19816479-19816501 GCACACTTGCAGAAGTACTCAGG - Intronic
1079551954 11:21710770-21710792 AGTCACATTCTGAAGTACTCAGG + Intergenic
1079713518 11:23716692-23716714 GGTCACCTTCTGATCTACTCAGG - Intergenic
1079785788 11:24670451-24670473 ACTCACATTCTGAAGTCAACCGG - Intronic
1079817140 11:25076103-25076125 GATCACCTTCTGAAGTGCCCGGG - Intronic
1079820898 11:25126737-25126759 GGTTACATTCTGAGGTACTAGGG + Intergenic
1080014725 11:27492267-27492289 GGTCACATTCTGAGGTACTGGGG + Intergenic
1080847924 11:36042621-36042643 AGTCACATTCTGAAATACTGGGG - Intronic
1081245074 11:40755901-40755923 AGTCACATTCTGAAATACTGGGG - Intronic
1081331638 11:41808268-41808290 AGTCACATTCTGAAGTACTCGGG - Intergenic
1081381103 11:42416346-42416368 AGTCACATTCTGAGGTACTGGGG + Intergenic
1081461098 11:43273747-43273769 GGTCACATTCTGAGGTACTTGGG - Intergenic
1082207110 11:49450950-49450972 ACTCACATTCTGAGGTACTTGGG - Intergenic
1082230615 11:49761397-49761419 AGTCACATTCTGAGGTACTTGGG + Intergenic
1082570565 11:54732936-54732958 CTTCACATTCTGAAATACTGAGG - Intergenic
1082617903 11:55383986-55384008 GTTCACATTATGAAATACTCAGG - Intergenic
1082755552 11:57072497-57072519 GGTCATATTCTGAAGTACCGGGG + Intergenic
1082865511 11:57896638-57896660 GGTCACATTCTGAGGTACTGGGG + Intergenic
1082962401 11:58931367-58931389 GGTCACATTTTGAGGTACTAGGG + Intronic
1083055979 11:59820222-59820244 GGTTACATTCTGAAGTGCTAGGG + Intergenic
1083064999 11:59915246-59915268 GGTCATATTCTAAAGTACTAGGG + Intergenic
1083211619 11:61190957-61190979 AGTCACATTCTGAGGTACTGGGG + Intergenic
1083396223 11:62394443-62394465 ACTCACATGCTGAGGTACTGGGG + Intergenic
1083474714 11:62908585-62908607 GCCCACATTCCAAAGTACTTGGG + Intergenic
1083699944 11:64469603-64469625 GGTCACATTCTGAGGTACTGGGG - Intergenic
1084026280 11:66452154-66452176 AGTCACATTCTGAGGTACTGGGG + Intronic
1084330052 11:68424909-68424931 GCTCACATTCTGAGGTTCTGGGG + Intronic
1084469024 11:69344389-69344411 GGTCACACTCTGAGGTACTGGGG - Intronic
1084662339 11:70553433-70553455 AGTCACATTCTGAAGTACTGGGG + Intronic
1085452188 11:76641090-76641112 GGTCACATTCTGAGGTACTGAGG - Intergenic
1085752089 11:79170425-79170447 GGTCACATTCTAAGGTACTAGGG - Intronic
1085792653 11:79509245-79509267 GGTCACATTCTGAAGTACTGGGG - Intergenic
1086157776 11:83686872-83686894 GGTCACATTCTGAGGTACTGGGG - Intronic
1086323079 11:85670825-85670847 GGTCACATTCTAAGGTACTAGGG - Intronic
1086367461 11:86122084-86122106 GGTCACATTTTGAGGTACTAAGG + Intergenic
1086395139 11:86407804-86407826 GCTCAAGTACTCAAGTACTCAGG + Intronic
1086535162 11:87835516-87835538 GGTCACATTATGACGTACTAGGG - Intergenic
1086619437 11:88867576-88867598 AGTCACATTCTGAGGTACTTGGG - Intronic
1086648165 11:89250789-89250811 ACTCACATTCTGAGGTACTTGGG + Intronic
1086999536 11:93400579-93400601 GGTCACATTCTGAGGTACCGAGG + Intronic
1087120619 11:94570514-94570536 GATCACATTCTGAGGCACTGGGG + Intronic
1087312926 11:96570773-96570795 GGTCATATTCTGAGGTACTGTGG + Intergenic
1087557347 11:99738151-99738173 AGTCACATTCTGAGGTACTTGGG - Intronic
1087730459 11:101772746-101772768 AGTCACATTCTGAGGTACTGGGG - Intronic
1088258367 11:107922503-107922525 GGTCACATTCTGAGGTACTGGGG - Intronic
1088432955 11:109778581-109778603 GGTCACATTCTGAGGTACTGGGG + Intergenic
1088784822 11:113171817-113171839 GGTCACATTCTGAGGTACTAGGG - Intronic
1088816930 11:113427808-113427830 AGTCACATTCTGAGGTACTGGGG - Intronic
1089098185 11:115937303-115937325 AGTCACATTCTGAAGTACTGGGG - Intergenic
1089111938 11:116064039-116064061 GATCACATTCTGAAGGACTGGGG + Intergenic
1089136735 11:116255215-116255237 GGTCACATTCTGAAGTACAGGGG + Intergenic
1089165866 11:116476027-116476049 GATCACATTCTGAAGTACTGGGG - Intergenic
1089896460 11:121935148-121935170 GGTCACATTCTGATGTATTGGGG - Intergenic
1090011319 11:123048212-123048234 GGTCACATTCTGAGGTTCTGGGG - Intergenic
1090212746 11:124934383-124934405 GTTCACATTCTGAGGTACTTGGG - Intronic
1090363972 11:126191149-126191171 CGTCACATTCTGAGGTACTGGGG - Intergenic
1090543162 11:127731105-127731127 AGTCACATTCTGAGGTACTGTGG + Intergenic
1090721480 11:129478495-129478517 AGTCACATTCTGAGGTACTGGGG - Intergenic
1090822779 11:130359319-130359341 GGTCACATTCTGGGGTACTGAGG + Intergenic
1091141925 11:133242676-133242698 TGTCACATTCTGAGGTACTGAGG + Intronic
1091269923 11:134300873-134300895 AGTCACATTCTGCAGTACTGAGG + Intronic
1091854903 12:3731657-3731679 GGTCACATTCTGAGGTACTAGGG - Intronic
1092138847 12:6168709-6168731 GCTCACACTCTGGAGTAGACGGG + Intergenic
1092225780 12:6747543-6747565 GCTCAAATTCTCAACTACTGTGG + Intergenic
1092943027 12:13428092-13428114 GATCACATTCTGATGTACTGGGG - Intergenic
1093044092 12:14421661-14421683 GGTCACATTCTGAGGTACTGGGG + Intronic
1093143944 12:15542023-15542045 AGTCACATTCTGAGGTACTAAGG + Intronic
1093393518 12:18652134-18652156 GTTCACATTCTGAGGTACCTGGG - Intergenic
1093582990 12:20805678-20805700 GCTCACACTCAGTAGTACCCTGG - Intergenic
1093764556 12:22948078-22948100 TCTCACATTCTGAAGTAAGAGGG + Intergenic
1093953692 12:25193192-25193214 GATCAAATTCTGAAGTACTGGGG - Intronic
1094133121 12:27096290-27096312 GGTCACATTCTGAGGTTCTGGGG + Intergenic
1094295442 12:28899745-28899767 GGTCACATTCTGAGGTGCTGGGG + Intergenic
1094318723 12:29160890-29160912 GGTCACATTCTAAGGTACTGAGG + Intronic
1095401306 12:41817683-41817705 GGTCACATTCTGAAATACTGGGG - Intergenic
1095482579 12:42651366-42651388 AGTCACATTCTGAGGTACTGGGG - Intergenic
1095638247 12:44456620-44456642 GGTCGCATTCTGAGGTACTGGGG - Intergenic
1095693373 12:45116723-45116745 GGTCAAATTCTGAAGTACTGGGG + Intergenic
1095932873 12:47646718-47646740 AGTCACATTCTGAGGTACTGGGG + Intergenic
1096212912 12:49780107-49780129 GGTCACATTCTGAGATACTGGGG + Intergenic
1096505496 12:52089894-52089916 GGTCACATCCTGAAGTACTCAGG + Intergenic
1096924815 12:55132313-55132335 AGTCACATTCTGAAGTACTAGGG - Intergenic
1097206354 12:57324829-57324851 AGTCACATTCTGAGGTACTGAGG - Intronic
1097481868 12:60137357-60137379 AGTCACATTCTGAGGTACTGAGG + Intergenic
1097577560 12:61413716-61413738 GGTCACATTCTGAAGTGCTGGGG + Intergenic
1097708529 12:62893833-62893855 AGTCACATTCTGAGGTACTAGGG + Intronic
1098023458 12:66178595-66178617 GGTCACATTCAGAGGTACTCAGG + Intergenic
1098096761 12:66965048-66965070 AGTCACATTCTGAGGTACTGGGG + Intergenic
1098130891 12:67348710-67348732 GATCACATTCTGAGATACTGGGG + Intergenic
1098131823 12:67359075-67359097 GTTTACATTCTGAAGTAATGGGG + Intergenic
1098389256 12:69951832-69951854 AGTCACATTCTGAGGTACTGGGG + Intronic
1099099349 12:78418655-78418677 AGTTACATTCTGAAGTACTGAGG + Intergenic
1099520027 12:83649071-83649093 AATCACATTCTGAGGTACTAGGG + Intergenic
1100171374 12:91978520-91978542 GGTCACATTCTGAGATACTAGGG + Intergenic
1100218566 12:92479397-92479419 GGTCACATTCTGAGGTACTGAGG + Intergenic
1100295679 12:93258684-93258706 GCTCACATTCCCAGGTACTGGGG - Intergenic
1100303385 12:93328174-93328196 TGTCACACTCTGAAGTACTGGGG - Intergenic
1100379954 12:94052158-94052180 GGTCACCTTCTGAGGTACTGGGG + Intergenic
1100447105 12:94670979-94671001 AGTCACATTCTGAAGTACTAGGG + Intergenic
1100477396 12:94947064-94947086 GATCACATTTTGAGGTACTGGGG - Intronic
1101003111 12:100375929-100375951 ACTCATATTCTGAGGTACTGAGG - Intronic
1101016147 12:100502589-100502611 GGTCACATTCTGAGGTACTGGGG + Intronic
1101485832 12:105158492-105158514 GCTCACATTCTAAATTTTTCAGG - Intronic
1101539429 12:105651714-105651736 GGTCGTATTCTGAAGTACTGGGG + Intergenic
1102202888 12:111069822-111069844 ACACACATTCTGAAGTCCTGGGG + Intronic
1102282496 12:111629461-111629483 GGTCACATTGTGAGGTACTGTGG - Intergenic
1103144213 12:118580404-118580426 AGTCACATTCTGAAGTATTAGGG - Intergenic
1103196705 12:119049957-119049979 AATCACATTCTGAGGTACTGAGG + Intronic
1103227946 12:119304144-119304166 AGTCACATTTTGAAGTACTGTGG - Intergenic
1103229000 12:119312180-119312202 GCTCACGTTCTGAGTTACTGTGG - Intergenic
1103533104 12:121616132-121616154 GGTCACATTCTGAGGTACTGAGG + Intergenic
1103777160 12:123374675-123374697 GGTCGCATTCTGAGGTACTGGGG - Intergenic
1103978833 12:124722540-124722562 AGTCACATTCTGAGGTACTGGGG + Intergenic
1106084298 13:26526449-26526471 AGTCACATTCTGAGGTACTGGGG - Intergenic
1106110452 13:26772218-26772240 AGTCCCATTCTGAAGTACTGGGG - Intergenic
1106437858 13:29739762-29739784 GGTCACATTCTGAGGTCCTGGGG - Intergenic
1106490025 13:30212850-30212872 AGTCACATTCTGAAGTACTGGGG - Intronic
1106600717 13:31184229-31184251 TCTCACTTTCTGAAGTTCTTGGG + Intergenic
1106759801 13:32857535-32857557 AGTCACATTCTGAGGTACTGAGG - Intergenic
1106773987 13:32990911-32990933 GATCACATTCTGAGGTACTAAGG + Intergenic
1106882125 13:34143206-34143228 GGCCACATTCTGAAGTGCTGGGG - Intergenic
1106925899 13:34612844-34612866 AGTCACATTCTGAGGTACTGGGG + Intergenic
1107043694 13:35974222-35974244 AGTCACATTCTCAAGTACTCGGG - Intronic
1107107186 13:36657004-36657026 GGTCACATTCTGAGATACTAGGG + Intergenic
1107153514 13:37139943-37139965 CGCCACATTCTGAAGTACTGGGG + Intergenic
1107339845 13:39394342-39394364 AGTCACATTCTGAGGTACTGGGG + Intronic
1107340091 13:39396382-39396404 GTTCACATTCTGAGGTACTGGGG - Intronic
1107651859 13:42553002-42553024 GGTCACATTCTGGGGTACTGAGG + Intergenic
1107687653 13:42920162-42920184 GGTCACATTCTGAGGTGCTAGGG + Intronic
1107799380 13:44089968-44089990 GGTCACATTCTGTTGTACTGGGG + Intergenic
1107960254 13:45550928-45550950 GGTCACATTCTGAAGCACTGGGG + Intronic
1108203347 13:48063340-48063362 AGTCACATTCTGAAGTACTGAGG - Intronic
1108718706 13:53107947-53107969 AGTCACATTCTGAGGTACTGCGG + Intergenic
1108723421 13:53155514-53155536 GGTCACATTCTGAAGTACTTGGG + Intergenic
1109207326 13:59496981-59497003 GGTTACATTCTGAAGTACTAAGG - Intergenic
1109327384 13:60884824-60884846 GGTTACATTCTGAGGTACTGAGG + Intergenic
1109402447 13:61852931-61852953 GTTTACATTCTGAATTACGCGGG - Intergenic
1109411165 13:61971240-61971262 GGTCAGATTCTGAGGTACTGGGG + Intergenic
1109804490 13:67420840-67420862 GGTCACATTTTGAGGTACTAGGG - Intergenic
1110379603 13:74835278-74835300 GGTCACATCCTGAAGTAGTAGGG + Intergenic
1110494676 13:76153201-76153223 AGTCACATTCTGAAGTACTAGGG + Intergenic
1110508617 13:76321598-76321620 GGTCACATTCTAAGGTACTGGGG - Intergenic
1110687778 13:78395525-78395547 AGTCACATTCTGAGGTACTGGGG + Intergenic
1110925167 13:81141911-81141933 GATCACATTCTGAGGTATTGTGG - Intergenic
1111454450 13:88462047-88462069 AGTCACATTCTGAGGTACTGGGG + Intergenic
1111735414 13:92132735-92132757 AGTCACATTCTGAAGTATTGGGG + Intronic
1111841705 13:93457358-93457380 GGTCACATTCTGAGCTACTGTGG + Intronic
1111928738 13:94491477-94491499 GGTCACATTCTGGGTTACTCAGG + Intergenic
1111982392 13:95030499-95030521 AGTCACATTCTGATGTACTTGGG - Intronic
1112094736 13:96119969-96119991 GGTCACATTCTGAAGTACTAGGG - Intronic
1112315650 13:98360048-98360070 ACTCACATTCTGAGGAATTCAGG - Intronic
1112411077 13:99164135-99164157 AGTCACATTCTGAAGTACTGAGG - Intergenic
1112600173 13:100847506-100847528 AGTCACATTCTGAGGTACTGGGG + Intergenic
1112601375 13:100858831-100858853 AGTCACATTCTGAGGTACTAGGG - Intergenic
1112694928 13:101937305-101937327 AGTCACATTCTGAGGTACTAGGG - Intronic
1112766636 13:102752737-102752759 GGTCACATTCTGAGGTACTACGG - Intronic
1112775862 13:102843574-102843596 AGTCACATTCTGAGGTACTCAGG + Intronic
1112897636 13:104320191-104320213 GGTCACATTCTGAGGAACTGGGG + Intergenic
1112909951 13:104469400-104469422 GGTCATATTCTGGAGTACTGAGG + Intergenic
1112967743 13:105218772-105218794 GGTCACATCCTGAGGTACTGTGG + Intergenic
1113124032 13:106956570-106956592 GGTCACATTCTGAGGTACAGGGG + Intergenic
1113143811 13:107184885-107184907 GGTCCCATTCTGAGGTATTCGGG - Intronic
1113161717 13:107389288-107389310 GGTCACATTGTGAGGTACTGGGG - Intronic
1113223654 13:108134671-108134693 GGTCACATTTTGAAGTACTGAGG - Intergenic
1113411492 13:110094237-110094259 AGTCACATTCTGAGGTACTGGGG - Intergenic
1113474978 13:110574161-110574183 GTTCACACTCTGAAGTACGGTGG - Intergenic
1113576110 13:111396362-111396384 GGTCACACTCTAAAGTACTGGGG - Intergenic
1114305781 14:21421757-21421779 ACTCACATTCTGAGGTACTGGGG - Intronic
1114340047 14:21733738-21733760 GGTCACCTTCTGAAGTACTAGGG + Intergenic
1114441920 14:22755475-22755497 AGTCACATTCTCAAGTACTGGGG - Intergenic
1114514762 14:23291411-23291433 GGTTACATTCTGAAGTACTAGGG - Intronic
1114573474 14:23692324-23692346 CGTCACATTCTGAGGTACTTGGG + Intergenic
1114849898 14:26371383-26371405 GCGAACATTCTGAAGGTCTCTGG - Intergenic
1114863490 14:26557160-26557182 GGTCACATTCTGAGGTACTGGGG + Intronic
1115121135 14:29939825-29939847 CATCACATTCTGAGGTACTGGGG - Intronic
1115306519 14:31939167-31939189 AGTCACATTCTGAGGTACTGAGG - Intergenic
1115620816 14:35138285-35138307 AGTCACATTCTGAAATACTATGG + Intronic
1116004690 14:39279929-39279951 AGTCACATTCTGAGGTACTGGGG + Intronic
1116029881 14:39558187-39558209 GGTTACATTCTGAGGTACTGGGG + Intergenic
1116700310 14:48232681-48232703 AGTCACATTCTGAGGTACTGAGG - Intergenic
1116763363 14:49041404-49041426 GATCACATTCTGAGGTACTGAGG + Intergenic
1116806526 14:49499325-49499347 AGTCACATTCTGAGGTACTGAGG + Intergenic
1117664838 14:58045683-58045705 GGTCACATTCTGAGGGACTGAGG - Intronic
1117947960 14:61050470-61050492 GATCACATTATAAAGTACTAAGG - Intronic
1117953438 14:61104656-61104678 GGTCACATTCTGAGGGACTGGGG + Intergenic
1118032093 14:61827933-61827955 AGTCACATTCTGAAGTCCTGAGG - Intergenic
1118437987 14:65788996-65789018 GGTCACATTCTGAGGTACTGGGG - Intergenic
1118461031 14:65987275-65987297 GGTCACATTCTGAGGTACTACGG + Intronic
1118919263 14:70134870-70134892 GGTCACATTCTGAGGTACAAGGG - Intronic
1118965642 14:70581590-70581612 GGTCACATTCTAAGGTACTGGGG + Intronic
1118997756 14:70852696-70852718 AGTCACATTCTGAGGTACTGGGG - Intergenic
1119105036 14:71915758-71915780 AGTCACATTCTGAGGTACTAGGG - Intergenic
1119144742 14:72301907-72301929 GGTCACATTTTGAAGCACTGGGG + Intronic
1119646401 14:76351572-76351594 GGTCACATTCTCAGGTACTGGGG + Intronic
1120395575 14:83963030-83963052 GCGTCGATTCTGAAGTACTCTGG + Intergenic
1120425890 14:84347835-84347857 AGTCACATTCTGAGGTACTGGGG - Intergenic
1120715616 14:87837974-87837996 AGTCACATTCTGAGGTACTGAGG - Intronic
1120824826 14:88945631-88945653 GCTCACATTCTGAGGCGCTGGGG - Intergenic
1120841506 14:89089487-89089509 GGTCATATTCTGAGGTACTGAGG - Intergenic
1120876125 14:89377789-89377811 AGCCACATTCTGAGGTACTCGGG - Intronic
1120943184 14:89968873-89968895 GATCACATTCTGAGGTACTGAGG - Intronic
1121179688 14:91919545-91919567 AGTCACATTCTGAGGTACTGGGG - Intronic
1121327627 14:93030749-93030771 GGTCACGTTCTGAGGTACTAGGG - Intronic
1121512673 14:94523912-94523934 GATCACATTCTGAGGTGCTTGGG + Intergenic
1121577449 14:94999945-94999967 GGTCACATTCTGAGGTTCTGGGG - Intergenic
1121663831 14:95656692-95656714 GCTCACCTTCTGTATTAGTCAGG - Intergenic
1121827600 14:97023109-97023131 GGTCACATTCTGAGGTACTGGGG + Intergenic
1121900620 14:97690369-97690391 GGTCACATTTTGAGGTACTAGGG + Intergenic
1121904871 14:97730513-97730535 GGTTACATTGTGAGGTACTCAGG + Intergenic
1122432968 14:101667607-101667629 GGTCACATTCTGAGGCACTGGGG + Intergenic
1122646281 14:103196578-103196600 GGTCACATTCCGAGGTACTGAGG + Intergenic
1122761112 14:104027308-104027330 GCTCACACCTGGAAGTACTCTGG - Intronic
1122818576 14:104327890-104327912 GGTCACATTCTGAGGTACTGGGG + Intergenic
1122869402 14:104629252-104629274 GATTACATTCTGAGGTACTGGGG + Intergenic
1123430698 15:20213490-20213512 GGTCACATTCTGAGGTACTGGGG + Intergenic
1123674849 15:22700438-22700460 GGTCACATTCTAAAGTATTGGGG + Intergenic
1124177905 15:27443052-27443074 AGTCACATTCTGAAGTACTGGGG - Intronic
1124326863 15:28773418-28773440 GGTCACATTCTAAAGTATTGGGG + Intergenic
1125050729 15:35295389-35295411 ACTTTCATTTTGAAGTACTCAGG - Intronic
1125085659 15:35726238-35726260 AATCACATTCTGAAGTACTGTGG - Intergenic
1125267667 15:37901684-37901706 GGTCACACTCTGAGGTACTAGGG + Intergenic
1125408976 15:39384905-39384927 AGTCACATTCTGAGGTACTGGGG - Intergenic
1125969573 15:43900977-43900999 GGTCACATTCTGAGGTACTGAGG - Intronic
1126027819 15:44465053-44465075 GGTCACGTTCTGAAGTATTCAGG + Intronic
1126344133 15:47675264-47675286 GGTCACATTCTGAGGTCCTAGGG - Intronic
1127122284 15:55781873-55781895 GGTCACATTCTGAGTTACTGGGG + Intergenic
1127368065 15:58309897-58309919 GGTCACATGCTGAGGTACTGGGG - Intronic
1127382861 15:58444743-58444765 AGTCACATTCTGAGGTACTGAGG + Intronic
1127720414 15:61693714-61693736 GGTAACATTCTGATGTACTGGGG - Intergenic
1127911554 15:63420234-63420256 GTTCACATTCTGAGGTACTGGGG - Intergenic
1128598170 15:68972771-68972793 GGTCACATTCTGAGGCACTGGGG + Intronic
1128658981 15:69484043-69484065 GCTCACCTGCTGAACTACACTGG + Intergenic
1128660958 15:69500689-69500711 GATCACATTCTGGGGTACTGGGG + Intergenic
1129057452 15:72831117-72831139 GGTCACATTCTGAGGTCCTGGGG + Intergenic
1129415482 15:75375249-75375271 GGTCACATTCGGAAGTACTGGGG - Intronic
1129522523 15:76194856-76194878 GACCACATTCTGAGGTACTAGGG + Intronic
1130302399 15:82689689-82689711 GGTTACATTCTGAGGTACTAGGG - Intronic
1130303240 15:82696164-82696186 GGTAACATTCTGAGGTACTGGGG + Intronic
1130671714 15:85918719-85918741 GGTCACATTCTGAAGTACCAGGG + Intergenic
1130678223 15:85973317-85973339 GGTCACATTCTCAGGTACTGAGG - Intergenic
1130890540 15:88129847-88129869 AGTCACATTCTGAAGTACTAGGG - Intronic
1131040219 15:89257683-89257705 GGTCACATTCTGAAATACTGGGG + Intronic
1131275320 15:90975645-90975667 AGTCACATTCTGAGGTACTGGGG - Intronic
1131293230 15:91125227-91125249 GGTCACATTCTGAAGTTCTGGGG + Intronic
1131547903 15:93331114-93331136 GGTCACATTCTGAAGTACTGGGG + Intergenic
1131585668 15:93690250-93690272 AGTCACATTCTGAGGTACTGGGG - Intergenic
1131972031 15:97902987-97903009 GGTCACATTCTGAGGTACTGGGG + Intergenic
1132208935 15:100006131-100006153 GGTCACATTCTGAGATACTGGGG + Intronic
1132354869 15:101163684-101163706 GGTCACATTCTGAGGTACTGGGG - Intergenic
1132367153 15:101265929-101265951 AGTCACATTCTGGAGTACTGAGG - Intergenic
1133037884 16:3044949-3044971 AATCACATTCTGAGGTACTGGGG - Intergenic
1133204002 16:4222017-4222039 GGTCACATTCTGAGGTTCTGGGG + Intronic
1133451095 16:5904636-5904658 AGTCACATTCTGAGGTACTGAGG - Intergenic
1133542603 16:6770983-6771005 ACTCACATTCTGAGGTCCTGTGG - Intronic
1133846832 16:9462442-9462464 AGTCACATTCTGCAGTACTGGGG + Intergenic
1133907681 16:10036921-10036943 GGTCACATCCTGAGGTACTGAGG + Intronic
1134217532 16:12327620-12327642 AGTCACATTCTCAAGTACTGGGG + Intronic
1134357091 16:13492387-13492409 GCTCAGATTCTGAAGTAAAAAGG - Intergenic
1134415302 16:14038328-14038350 ACTCACATTCTGAAGTGCTATGG + Intergenic
1134744933 16:16580674-16580696 AATCAACTTCTGAAGTACTCTGG + Intergenic
1134759169 16:16698351-16698373 GGTCACATTCTGAGGTACTGGGG - Intergenic
1134771055 16:16809903-16809925 GGTTACATTCTGAGGTACTAAGG + Intergenic
1134859748 16:17550654-17550676 GGTCACATTTTGAAGTACTAGGG + Intergenic
1134986904 16:18660833-18660855 GGTCACATTCTGAGGTACTGGGG + Intergenic
1135000551 16:18773095-18773117 AATCAACTTCTGAAGTACTCTGG - Intergenic
1135080449 16:19429965-19429987 GGTCACATTCTGAAGTACTGCGG + Intronic
1135138407 16:19901635-19901657 GGTCACATTCTGAGGTACCAGGG - Intergenic
1135209223 16:20509919-20509941 GGTCACATTCTAAGGTATTCGGG + Intergenic
1135501106 16:22996555-22996577 GTTTACACTCTGAAGTACTGGGG + Intergenic
1135652601 16:24219108-24219130 GCCCACATTCTGATGTTCCCTGG + Exonic
1135798130 16:25465787-25465809 ACTCACATTCTGAGGTACTGGGG - Intergenic
1135820487 16:25680868-25680890 GGTCACATTCTGAGATACTGGGG + Intergenic
1135829477 16:25760774-25760796 AGTCACATTCTGAGGTACTGGGG + Intronic
1135946504 16:26869591-26869613 AGTCACATTCTGAGGTACTAGGG + Intergenic
1136102385 16:28005573-28005595 GGTCACATTCTGAGGTACTGGGG + Intronic
1136853942 16:33637725-33637747 GGTCACATTCTGAGGTACTGGGG - Intergenic
1137801626 16:51266910-51266932 GGTCACATTCTGAGATACTGGGG - Intergenic
1137927809 16:52557909-52557931 AGTCACATTCTGAGGTACTGGGG + Intergenic
1137931666 16:52594064-52594086 GCTCACATTCTTAATTATTAGGG - Intergenic
1138145940 16:54611961-54611983 AGTCACATTCTGAGGTACTAGGG - Intergenic
1138261446 16:55626234-55626256 GATCACATTTTGAGGTACTGGGG - Intergenic
1138526577 16:57611517-57611539 GCTCACATTCTGAAGTACTCAGG - Intronic
1138877175 16:60966228-60966250 AGTCACATTCTGGAGTACTGGGG - Intergenic
1138973052 16:62170161-62170183 GATCACATTCTGGACTGCTCAGG - Intergenic
1139994040 16:70963333-70963355 AGTCACATTCTGAGATACTCGGG - Intronic
1140024638 16:71274748-71274770 GGTCACATTCTGTGGTACTGGGG - Intergenic
1140176653 16:72667337-72667359 GGTTACTTTCTGAAGTACTAGGG + Intergenic
1141170956 16:81691387-81691409 AGTCACATTCTGAAGTACTGGGG + Intronic
1141337650 16:83172035-83172057 GGTCACACTCTGAATTACTGGGG - Intronic
1141596109 16:85097869-85097891 GGTCACATTCTGAAGTATGGGGG - Intergenic
1203115524 16_KI270728v1_random:1486169-1486191 GGTCACATTCTGAGGTACTGGGG - Intergenic
1143347852 17:6262942-6262964 GCTCACATTTTGAGGTACTGGGG - Intergenic
1143770012 17:9162550-9162572 GGTCACATTCTGAGGTACTGGGG + Intronic
1143843653 17:9755334-9755356 GATCACATTCTGAGGAACTAGGG + Intergenic
1143901145 17:10175843-10175865 AGTCACATTCTGAGGTACTAGGG + Intronic
1143924864 17:10360694-10360716 GGTCATATTCTGAGGTACTAGGG - Intronic
1143993055 17:10983134-10983156 AGTCACATTCTGAGGTACTGGGG + Intergenic
1144183137 17:12771292-12771314 GCTCACATTCTGAGGTGCTGAGG + Intergenic
1144368646 17:14569295-14569317 GATCACATTCTGAGGCACTAGGG + Intergenic
1144641194 17:16937879-16937901 GATCACATTCTCAAGCACTGGGG - Intronic
1145942254 17:28748722-28748744 GCTCAGCTTCTGATGTACTTAGG + Intronic
1146147714 17:30436061-30436083 GATCACATTTTGAGGTACTGAGG + Intronic
1146274006 17:31503370-31503392 AGTCACATTCTGAAGTACTAGGG + Intronic
1147000990 17:37361946-37361968 ACTCACATTCTGAGGTATTAGGG - Intronic
1148162654 17:45459905-45459927 GGTCACATTCTGAGGTACTGGGG - Intronic
1148969127 17:51464065-51464087 GGTCACATTCTAAAGTACTGGGG - Intergenic
1149088931 17:52753735-52753757 AGTCACATTCTGAGGTACTGAGG + Intergenic
1149355466 17:55834895-55834917 GGTCACATTCTGAGGTACCTGGG - Intronic
1149490230 17:57079213-57079235 GGTCACGTTCTGAGGTACTGGGG + Intergenic
1150318769 17:64192222-64192244 GGTCACATTCTGAGATACTGGGG - Intronic
1150393882 17:64806570-64806592 GGTCACATTCTGAGGTACTGGGG - Intergenic
1150469175 17:65421816-65421838 GGTCACATTCTGAGGTACTAGGG - Intergenic
1150574946 17:66422193-66422215 GGTCACATTCTGAGATACTGGGG + Intronic
1150650770 17:67008632-67008654 GGTCACATTCTGAAGTACTGGGG - Intronic
1150861486 17:68805540-68805562 GGTCAGATTCTGAGGTACTGAGG - Intergenic
1150949507 17:69786418-69786440 AGTCACATTCTGAAGTACAAAGG + Intergenic
1150950627 17:69799532-69799554 AGTCACATTCTGAGGTACTGAGG - Intergenic
1151117664 17:71756237-71756259 GGTTACATTCTGAGGTACTGGGG - Intergenic
1151410522 17:73924421-73924443 AGTCACATTCTGAGGTACTCGGG - Intergenic
1151871120 17:76837606-76837628 ACTCACATTCTGAAGTACAGGGG - Intergenic
1151903154 17:77030817-77030839 AGTCACATTCTGAAGTACTGGGG - Intergenic
1151993347 17:77592840-77592862 GCTCAGATCCTGGAGTACACTGG - Intergenic
1153183995 18:2466995-2467017 GATCACATTCTGAATTACAGCGG - Intergenic
1153512778 18:5873670-5873692 GATCACATTCTAAAGTCCTGGGG - Intergenic
1153599212 18:6762591-6762613 AGTCACATTCTGAGGTACTGGGG - Intronic
1153617012 18:6944481-6944503 AATCACATTCTGAGGTACTGGGG - Intronic
1153655754 18:7280716-7280738 AGTCACATTCTGAAATACTGGGG + Intergenic
1153885502 18:9461084-9461106 AGTCACATTCTGAGGTACTGGGG - Intergenic
1153930970 18:9879332-9879354 GGTCACATTCTGAGGTACTGGGG + Intergenic
1154168101 18:12030840-12030862 TATTGCATTCTGAAGTACTCCGG - Exonic
1155037294 18:22035514-22035536 AGTCACATTCTGAGGTACTGGGG + Intergenic
1155137463 18:23010136-23010158 GGTCACATAATGAAGTACTATGG - Intronic
1155318395 18:24594728-24594750 GGTCACATTCTGAGGTACTGGGG - Intergenic
1155437412 18:25827537-25827559 GGTCACATTCTGCAGTACAGGGG + Intergenic
1155528770 18:26744482-26744504 GGCCACATTCTGAGGTACTGGGG + Intergenic
1155586148 18:27367927-27367949 GCTCACATTGTCAGGTACTGAGG + Intergenic
1155618430 18:27747841-27747863 GTTCACATTTTGAGGTACTGGGG - Intergenic
1155737290 18:29239496-29239518 AGTCACATTCTGAAATACTAGGG - Intergenic
1155844619 18:30690063-30690085 GGTCACATTCTGAGGTACTGAGG + Intergenic
1155879870 18:31132032-31132054 GTTCACATTCTGAGTTACTGAGG - Intronic
1155938979 18:31784624-31784646 GGTCACATTCTGAGGTACTGGGG - Intergenic
1156260184 18:35439140-35439162 GGTCACACTCTGAGGTACTGGGG - Intergenic
1156410102 18:36819778-36819800 GGTCATATTCTGAGGTACTGGGG - Intronic
1156838299 18:41582040-41582062 GCTCACATTCTAAGGTACTAGGG - Intergenic
1156978539 18:43256933-43256955 AGTCACATTCTGAAGTACTAGGG - Intergenic
1157000906 18:43523384-43523406 GGTCACATTCTGAAGTACTGAGG + Intergenic
1157084253 18:44562512-44562534 GATCACATTCTGATGTGCTGGGG - Intergenic
1157304679 18:46508297-46508319 GGTCACATTCTGAGGGACTGTGG - Intronic
1157578087 18:48757254-48757276 AGTCACATTCTGAAGTATTGGGG + Intronic
1157663763 18:49468301-49468323 GATCAAATTCTGAGGTACTGGGG + Intergenic
1157883073 18:51340697-51340719 GGTCACATTCTGAGGGACTGGGG + Intergenic
1157898023 18:51486936-51486958 GCTCACATTCTGGGGTACTGGGG - Intergenic
1158283647 18:55854725-55854747 GGTCAAATTCTGAGGTACTGAGG + Intergenic
1158320046 18:56252367-56252389 GGTCACATTCTGAGGTCTTCGGG + Intergenic
1158403555 18:57141759-57141781 GCTCTCAGTCTGAAGAACTGTGG - Intergenic
1158416202 18:57251670-57251692 GGTCACATTCTGAGGTACTGGGG + Intergenic
1158528267 18:58234683-58234705 GGTCACATTCTGAAATACTGGGG + Intronic
1158650732 18:59282730-59282752 GGTCACATTCTGAGGTGCTGCGG - Intronic
1158661263 18:59390346-59390368 GGTCACATTCTGAGGCACTGAGG - Intergenic
1158663703 18:59413183-59413205 GGTCATATTCTGATGTACTGTGG + Intergenic
1158681819 18:59574876-59574898 CCTCACATTCTGAAGTCCTGGGG - Intronic
1158698229 18:59721984-59722006 GGTCACATTCTGAAGCACTGAGG - Intergenic
1158839414 18:61368042-61368064 GGTCACACTCTGAAGTACTGGGG + Intronic
1158866536 18:61643240-61643262 GGTCACATTCTGAAGTACTGGGG - Intergenic
1159469853 18:68837765-68837787 AGTCACATTCTGAGGTACTGGGG + Intronic
1159674266 18:71262045-71262067 GGTCACATTCTGAGGTTCTAGGG - Intergenic
1159896647 18:74002915-74002937 AGTCACATTCTGAGGTACTGGGG - Intergenic
1159918077 18:74203588-74203610 GGTCACATTCTGAGGTACTGGGG + Intergenic
1160013282 18:75122812-75122834 GGTCACATTCTGAAGTACTGGGG + Intergenic
1160886196 19:1349616-1349638 GGTCACATTCTGAGGTTCTAGGG - Intergenic
1161629936 19:5348798-5348820 GGTCACATTCTGAGGTCCTAGGG + Intergenic
1161884794 19:6986104-6986126 GCTCTCCATCTGAAGGACTCAGG + Intergenic
1162838450 19:13337584-13337606 GGTCACATTCTGAGGTACTGGGG + Intronic
1162840730 19:13354700-13354722 GATCACATTCTGAGGTACCAGGG - Intronic
1162882691 19:13671851-13671873 GATCATATTCTGAGGTACTAGGG - Intergenic
1163055217 19:14712848-14712870 GGTCACATTTTGAAGTACTGGGG + Intronic
1163100022 19:15089882-15089904 GGTCACATTCTGAGGTCCTTGGG - Intergenic
1163240039 19:16056401-16056423 GGTCACATTCTGAGATACTGGGG + Intergenic
1164525832 19:29012874-29012896 GTTCACATTCTGAGGTCCTGAGG + Intergenic
1165174387 19:33916739-33916761 CCTCACATTCTGAGATACTTGGG - Intergenic
1165282707 19:34810850-34810872 GGTCACATTCTGAGGTGCTGGGG + Intergenic
1165306484 19:35005791-35005813 GCTCCCATCCTGGACTACTCTGG - Intronic
1165534314 19:36430642-36430664 ACTCACATTGTGAGGTACTGGGG - Intergenic
1166657028 19:44619850-44619872 GGTCACATTCTGAGGTACTGGGG + Intronic
1166763263 19:45237737-45237759 GGTGACATTCTGATGTACTGGGG - Intronic
1166877271 19:45905038-45905060 GGTCACATTCTGAAGCACTGGGG - Intergenic
1167162183 19:47775288-47775310 GGTCACATTCTAAAGTACGGTGG - Intergenic
1167235706 19:48313480-48313502 GGTCACATTCTAAAGTACTGGGG - Intronic
1167255941 19:48428767-48428789 GGTCGCATTCTGAAGTACTAGGG + Intronic
1167340030 19:48909948-48909970 GGTCACATTCTGAGGTACTGGGG + Intronic
1167497390 19:49827659-49827681 GGTCACCTTCTGAGGTACTGGGG + Intronic
1167553722 19:50179401-50179423 GGTCACATTCTGAGGTATTGGGG - Intergenic
1168081455 19:54013255-54013277 GGTCACATTCTTAGGTACTGGGG + Intergenic
1168231776 19:55037160-55037182 GGTCAAATTCTGAAGAAATCAGG + Intronic
925048026 2:789366-789388 GGTCACATTCTCAATTACTGAGG + Intergenic
925344610 2:3162021-3162043 GCCCACATTTTGGAGTCCTCAGG - Intergenic
925440430 2:3880654-3880676 GGTCACATTCTGAGGTGCTGAGG + Intergenic
925601442 2:5612181-5612203 GGTCACACTCTGAGATACTCTGG - Intergenic
925608443 2:5683046-5683068 GCTCCCACTCTGAGGTATTCAGG + Intergenic
925673156 2:6333385-6333407 GGTCACATTCTGAGATACTGGGG - Intergenic
925730077 2:6913470-6913492 GGTCACATTCTGGGGTACTGGGG + Intergenic
925744481 2:7032776-7032798 GGTCACATTCTGAGATACTAGGG + Intronic
925839066 2:7973930-7973952 GCCCACTTTCTGTATTACTCTGG - Intergenic
925973550 2:9125035-9125057 GGTCACATTCTGAGGTACTGGGG - Intergenic
926060981 2:9804690-9804712 GGTCACATTCTGAGGTACTGGGG - Intergenic
926273500 2:11386016-11386038 GGTCACATTCTGAGGTCCTGGGG - Intergenic
926386634 2:12341811-12341833 GATCACATTCTGAGGTTCTAAGG - Intergenic
926687021 2:15705814-15705836 GGTCACATTCAGAGGTACTAGGG + Intronic
926931881 2:18049070-18049092 AGTCACATTCTGAAGTATTGGGG + Intronic
927028869 2:19099829-19099851 GGTCACATTGTGAGGTACTGCGG - Intergenic
927066383 2:19475339-19475361 AGTCACATTCTGAGGTACTAGGG - Intergenic
927110779 2:19862465-19862487 CATCACATTCTGAGGTACTGGGG + Intergenic
927382484 2:22495186-22495208 AGTCATATTCTGAAGTACTAGGG - Intergenic
927585142 2:24296417-24296439 TGTCACATTCTGAGGTACTGGGG - Intronic
928100380 2:28433845-28433867 TATCACATTCTGAAGTACTGGGG + Intergenic
928607306 2:32954613-32954635 GGTCACATTCTGAGGTACTTGGG + Intronic
928613013 2:33009357-33009379 GCTCACATTCTGAGGTACTGGGG - Intronic
928613269 2:33011373-33011395 ACTCACATTCTGAGATACTGGGG - Intronic
929833879 2:45376041-45376063 AGTCACATTCTGAGGTACTGGGG + Intergenic
929863775 2:45700702-45700724 GGTCACATTCTGAAGTACGGGGG - Intronic
929958536 2:46479149-46479171 GGTCACATTCTGAGGTACTGGGG + Intronic
930000759 2:46860066-46860088 AGTCACATTGTGAAGTACTGGGG - Intergenic
930218056 2:48717364-48717386 GCTTACAATCTGAATTACTTTGG + Intronic
930394365 2:50802167-50802189 GTTCACATTCTGAGGCACTGAGG - Intronic
930397238 2:50838498-50838520 GGTCACATTCTGAAGTTCTGAGG - Intronic
930500124 2:52204301-52204323 CCTTACATTCTGAGTTACTCAGG + Intergenic
931163424 2:59719012-59719034 AGTCACATTCTGAGGTACTAGGG + Intergenic
931259404 2:60604204-60604226 GGTAACATTCTGAGGTACTAGGG - Intergenic
931636128 2:64342047-64342069 GGTCACACTCTAAAGTACTGGGG - Intergenic
931644845 2:64412489-64412511 AGTCACATTCTGAGGTACTGGGG + Intergenic
931898641 2:66763224-66763246 GGTCACATTCTGAGATACTGAGG - Intergenic
932260968 2:70327116-70327138 GATCACAGTCTGAAGTACTAGGG - Intergenic
932421735 2:71605337-71605359 GCACACATTCTCCAGTTCTCAGG - Intronic
932638112 2:73411070-73411092 GGTCACATTCTGAGGTATTGGGG - Intronic
932808241 2:74801231-74801253 AGTCACATTCTGAGGTACTGAGG - Intergenic
932853532 2:75210886-75210908 GTTCAAATTCTGTAGTAGTCAGG - Intergenic
932932360 2:76057421-76057443 ATTCACATTCTGAGGTACTGTGG + Intergenic
933082956 2:78016349-78016371 GGTCACATTCTGAGGGACTGGGG + Intergenic
933265078 2:80172962-80172984 GGTCACATTCTGAAGTCCTGGGG + Intronic
933605093 2:84374445-84374467 GATCACATTCTGAGGTATTGGGG - Intergenic
933648527 2:84831066-84831088 GGTCACATTCTGAGGTACTGGGG - Intronic
933655753 2:84885665-84885687 AGTCACATTCTGAAGCACTAGGG - Intronic
933942512 2:87256258-87256280 TGTCACATTCTGAGGTACTAGGG - Intergenic
934049286 2:88197028-88197050 AGTCACATTCTGAAGTACTAGGG - Intergenic
934109140 2:88725689-88725711 CATCACATTCTGAAGTACTGAGG + Intronic
934575108 2:95395283-95395305 AGTCACATTCTGAGGTACTGGGG - Intergenic
934666489 2:96174902-96174924 GGTCACATTCTGAGATACTGGGG - Intergenic
934718893 2:96559195-96559217 GGCCACATTCTGAAGTGCTGGGG - Intergenic
934758608 2:96841150-96841172 GGTCACATTCTGAGGTACCTGGG - Intronic
934886856 2:98032582-98032604 AGTCACATTCTGCAGTACTGAGG + Intergenic
935293132 2:101626477-101626499 AGTCACATTCTGAGGTACTAGGG + Intergenic
935331702 2:101982059-101982081 GGTCACATTCTGAGATACTGGGG + Intergenic
935455887 2:103267594-103267616 GTTCACTTTCTGAGGTACTAGGG - Intergenic
935566379 2:104612377-104612399 GATTACATTCTGAGGTACTAGGG + Intergenic
935603162 2:104943003-104943025 CATCACATTCTGAAGTACTGGGG + Intergenic
935950356 2:108323342-108323364 GGTCACATTCTGTGGTACTGTGG + Intergenic
935981289 2:108630355-108630377 ACTTACATGCTGAAGAACTCAGG + Intronic
936150749 2:110020829-110020851 TGTCACATTCTGAGGTACTGGGG - Intergenic
936193927 2:110350540-110350562 TGTCACATTCTGAGGTACTGGGG + Intergenic
936337713 2:111605310-111605332 TGTCACATTCTGAGGTACTAGGG + Intergenic
936409927 2:112248789-112248811 GGTCACATTCTGAGGTATTAGGG - Intronic
936598435 2:113872218-113872240 GGCCACATTCTGAGGTACTGGGG - Intergenic
936973737 2:118198970-118198992 GTTCACATTCTGAGGTACTGGGG + Intergenic
936980793 2:118263407-118263429 GATCACGTTCTGAGGTACTGGGG - Intergenic
937246269 2:120496055-120496077 GTTCACATTCTGAGGAACTAGGG + Intergenic
937280445 2:120713922-120713944 GGTCACATTCTGAGGTGCTAGGG + Intergenic
937812296 2:126212572-126212594 GACCACATTCTGAGGTACTGGGG - Intergenic
937814636 2:126237726-126237748 GGTCACATTCTGAGGTACTTGGG + Intergenic
938630407 2:133160531-133160553 GGTCATATTCTGAGGTACTGGGG + Intronic
938872896 2:135499848-135499870 GGTCACATTCTGAGGTACTGGGG - Intronic
938933017 2:136103372-136103394 AGTCACATTCTGAGGTACTGGGG + Intergenic
938989335 2:136611920-136611942 GCTAACATTCTGAAGTGGTAAGG + Intergenic
939281092 2:140066025-140066047 GCTCACCTTCTGAGGTACTAGGG - Intergenic
939443587 2:142280022-142280044 TGTCACATGCTGAAATACTCAGG + Intergenic
939454999 2:142422681-142422703 GATCACATTCTTAATTACTGGGG - Intergenic
939532573 2:143382591-143382613 GGTCACCTTCTGAGGTACTGGGG + Intronic
939567634 2:143803321-143803343 AGTCACATTCTGAGGTACTAGGG + Intergenic
939779272 2:146424290-146424312 AGTCACATTCTGAAATACTGGGG + Intergenic
939836026 2:147130835-147130857 AATCACATTCTGAGGTACTAGGG - Intergenic
939956772 2:148533946-148533968 AGTCACATTCTGAGGTACTGGGG + Intergenic
940021120 2:149156728-149156750 CATCACATTCTGAGGTACTAGGG + Intronic
940071378 2:149692037-149692059 GCTTACATTCTGTGGTACTGAGG - Intergenic
940075014 2:149731870-149731892 AGTCACATTCTGAGGTACTGGGG + Intergenic
940173643 2:150854827-150854849 ACTCACATTCTGCAGTACTAGGG + Intergenic
940394606 2:153173580-153173602 GGTTACATTCTGAGGTACTAGGG + Intergenic
940564308 2:155340743-155340765 ACTCACATTTTGAAATACTGGGG + Intergenic
940933542 2:159465360-159465382 GGTCACATTCTGAAGTATTAAGG + Intronic
941150892 2:161914783-161914805 AGTCACATTCTGAGGTACTGAGG - Intronic
941497601 2:166225638-166225660 GGTCACATTCTGAAGTGCTAAGG - Intronic
941696233 2:168554357-168554379 GGTTACATTCTGAGGTACTAGGG - Intronic
941747795 2:169105729-169105751 GGTCACATTCTGAGGTAGTAGGG - Intergenic
941874073 2:170415957-170415979 GGTCACATTCTGAGGTACTGGGG - Intronic
941874527 2:170419502-170419524 AGTCACATTCTGAAGTAGTGGGG + Intronic
942068041 2:172290325-172290347 GGTCACATTTTGAGGTACTAAGG + Intergenic
942073097 2:172332861-172332883 GATCACATTCTGAGGTACTGGGG - Intergenic
942245882 2:174007812-174007834 GGTCACATTCTGAGGTACTAGGG + Intergenic
942568945 2:177293980-177294002 GCTCACATTCTGACGTACTGAGG - Intronic
942752570 2:179304374-179304396 AGTCACATTCTGAGGTACTGGGG - Intergenic
942791543 2:179766735-179766757 GGTCATATTCTGAGGTACTGGGG + Intronic
942847103 2:180440305-180440327 GGTCATATTCTGTAGTACACAGG - Intergenic
942893487 2:181020436-181020458 GCTCACATTTTGAGATACTGGGG + Intronic
942958137 2:181798100-181798122 GATCACATTCTGAGGTACTGGGG + Intergenic
943021521 2:182580192-182580214 GGTCACATTCTGAGGTACTGAGG - Intergenic
943055587 2:182974394-182974416 GGTCACATTCTGAGGTACTGGGG - Intronic
943515474 2:188880666-188880688 AGTCACATTCTGAGGTACTGGGG - Intergenic
943533950 2:189123376-189123398 TGTCACATTCTGAAGTACAGAGG - Intronic
943635802 2:190305578-190305600 GGTCACATTCTGAGGTACTGGGG + Intronic
943651086 2:190458224-190458246 GGTCACACTCTGAGGTACTGTGG - Intronic
943665109 2:190601047-190601069 GGTCACATTTTGAGGTACTAGGG - Intergenic
944137171 2:196412412-196412434 GACCACATTCTGAGGTACTGGGG + Intronic
944438098 2:199712930-199712952 GGTCACATTCTGAGGCACTGAGG + Intergenic
944540090 2:200746284-200746306 GGCCACATTCTGAAGAACTGGGG + Intergenic
944739766 2:202600515-202600537 AGTCACATTCTGAGGTACTGGGG + Intergenic
944832441 2:203546353-203546375 AGTCACATTCTGAGGTACTAGGG + Intergenic
945067956 2:205962822-205962844 GGTCACATTCTGAGGCACTGGGG + Intergenic
945105887 2:206314170-206314192 GTTCACATACTGTAGAACTCAGG - Exonic
945173036 2:207016787-207016809 GGTAACATTCTGAGGTACTGAGG + Intergenic
945175320 2:207037932-207037954 GGTCACATTCTGAGGTACTGGGG - Intergenic
945561028 2:211340478-211340500 GATCACATTCTGAGGTACTGGGG + Intergenic
945635929 2:212351049-212351071 AATCACATTCTGAGGTACTGGGG - Intronic
945742896 2:213685194-213685216 AGTCACATTCTGAGGTACTTGGG - Intronic
945943198 2:215970076-215970098 GGTCACATTCTGAGGTACTGGGG - Intronic
945969126 2:216219169-216219191 GGTCACATTCAGTAGTACTGAGG + Intergenic
946048953 2:216845042-216845064 AGTCACATTCTGAAGTACTGGGG + Intergenic
946293120 2:218760970-218760992 GGTCACATTCTGAGGTGCTGGGG + Intergenic
946542193 2:220696920-220696942 TCTCTCCTTCTGCAGTACTCTGG - Intergenic
946594069 2:221286516-221286538 AGTCACATTCTGAAGTGCTAGGG + Intergenic
946695600 2:222355304-222355326 AGTCACATTCTGAGGTACTGGGG + Intergenic
946737867 2:222772791-222772813 GGTTACATTCAGAGGTACTCAGG - Intergenic
946738700 2:222780334-222780356 GGTCACATTCTGAAGTAGTGGGG - Intergenic
946776656 2:223149293-223149315 AGTCACATTCTGAGGTACTGGGG + Intronic
946827239 2:223691273-223691295 GTTCACATTTTGAGGTACTGAGG + Intergenic
947076237 2:226349031-226349053 GATCACATTCTGGAATACTGAGG - Intergenic
947328644 2:229004850-229004872 GGACACATTCTGAAGTACCAGGG - Intronic
947340292 2:229131098-229131120 GCTCACATTCTGAGGTACTGAGG + Intronic
947701116 2:232234873-232234895 GCTCTCTTTCTGAAGAGCTCTGG - Intronic
947813306 2:233018853-233018875 AGTCACATTCTGAAGTACTGGGG + Intergenic
947923332 2:233898628-233898650 GATCACATTCTAAGGTACTAGGG + Intergenic
947949070 2:234132054-234132076 AGTCACATTCTGAAGTAGTGGGG + Intergenic
948025320 2:234771802-234771824 GGCCACATTCTGAAGTACTGCGG - Intergenic
948076290 2:235167629-235167651 GGTCACATTCTGAGGTCCTGGGG - Intergenic
948312821 2:237001845-237001867 GGTCACATTCTGAGGTACTGAGG - Intergenic
948767250 2:240229244-240229266 ATTCACATTCTGAGGTACTGGGG - Intergenic
948859134 2:240744460-240744482 ACTCTCATTCTGAAGTCCTGGGG - Intronic
949061121 2:241958029-241958051 GGTCACATTCACAAGTACTGAGG + Intergenic
1169512045 20:6274998-6275020 GGTCATATTCTGAGGTACTGGGG + Intergenic
1170360515 20:15541003-15541025 GGTCACATTCTGAGGTACTGTGG + Intronic
1170451712 20:16490136-16490158 GGTCACATTCTGAGGTACTAGGG - Intronic
1170753159 20:19170701-19170723 AGTCACATTCTGAGGTACTGGGG - Intergenic
1170806159 20:19633755-19633777 AGTCACATTCTGAGGTACTGAGG + Intronic
1171053647 20:21884946-21884968 AGTCACATTCTGAGGTACTGGGG + Intergenic
1171109940 20:22471647-22471669 GGTCACATTCTGAGGTACCAGGG + Intergenic
1171133573 20:22677178-22677200 GGTAGCATTCTGAAGTACTAGGG - Intergenic
1171369750 20:24653970-24653992 AGTCACATTCTGAGGTACTGGGG + Intronic
1172306589 20:33885025-33885047 AGTGACATTCTGAGGTACTCGGG - Intergenic
1173068179 20:39735089-39735111 ATTCACATTTTGAAGTACTGGGG - Intergenic
1173076931 20:39828211-39828233 GGTCACATTATGAGGTACTGAGG - Intergenic
1173192003 20:40883888-40883910 GGTCACATTCACAGGTACTCTGG + Intergenic
1173292231 20:41725070-41725092 AATCACATTCTGAAGTACTAGGG + Intergenic
1173398907 20:42706816-42706838 GGTAACATTCTGAGGTACTGAGG - Intronic
1173422358 20:42913563-42913585 GGTCACATTCTGAGTTACTGGGG + Intronic
1173535828 20:43812562-43812584 GGTCACATTCTGAAGTACTGGGG - Intergenic
1173889891 20:46498725-46498747 GGTCACATTCTGAGGTACTTGGG - Intergenic
1174806842 20:53611441-53611463 GCTCACATTTTAAGGTACACAGG - Intergenic
1174894960 20:54438582-54438604 GGTCACATTCTGATGTGCTGGGG + Intergenic
1175089206 20:56487972-56487994 GGTCACATTTTGAGGTACTAGGG + Intronic
1175287720 20:57848876-57848898 TGTCACATTCTGAAGTACTGAGG - Intergenic
1175303479 20:57959635-57959657 GCCCACATTCTGAGGTTCTGGGG - Intergenic
1175507664 20:59497291-59497313 GGTCACTTTCTAAGGTACTCGGG + Intergenic
1175674180 20:60932804-60932826 GCTCATAATCTGTAGTCCTCTGG - Intergenic
1175736922 20:61393496-61393518 GCTGTCATTCAGAATTACTCTGG - Intronic
1176187065 20:63786408-63786430 GCTAACATCCTGCAGTACCCAGG + Intronic
1176910724 21:14561641-14561663 GGTCACATTCTGAGGTGCTGGGG - Intronic
1176927901 21:14772388-14772410 AGTCACATTCTGAAGTACTGGGG + Intergenic
1176983329 21:15408051-15408073 GGTCATATTCTGAGGTACTGGGG - Intergenic
1177116231 21:17090380-17090402 GGTTACATTCTGAGGTACTGGGG + Intergenic
1177126616 21:17201740-17201762 GGGCACATTCTGCAGTTCTCTGG - Intergenic
1177859191 21:26433301-26433323 GGTTACATTCTGAGGTACTGGGG - Intergenic
1178019245 21:28390531-28390553 GGTCACATTCTGAGGTACATGGG + Intergenic
1178110184 21:29362637-29362659 GGTCACATTCTGAAGTAGTGGGG - Intronic
1178251562 21:31008351-31008373 GGTCACATTCTGAGCTACTGAGG - Intergenic
1178368207 21:32005261-32005283 AGTCACATTCTGAGGTACTGGGG - Intronic
1178368763 21:32009791-32009813 AGACACATTCTGAAGTACTGGGG - Intronic
1178376909 21:32074581-32074603 GGTCACATTCTGAGGCACTGGGG + Intergenic
1178546305 21:33495676-33495698 AGTCACATTCTAAAGTACTGGGG - Intergenic
1178627889 21:34233464-34233486 GGTCACACTCTGAGGTACTGGGG + Intergenic
1178686481 21:34715255-34715277 GGTCACATTCTGAGCTACTGGGG - Intronic
1178694821 21:34783656-34783678 GGTCACATTCTGAGGTCCTGGGG + Intergenic
1178759856 21:35392090-35392112 AGTCACATTCTGAGGTACTGGGG - Intronic
1178807566 21:35852051-35852073 GCTCACATTCTGAGGTCCTGGGG - Intronic
1178982003 21:37272242-37272264 CGTCACATTCTGAAGTACCAAGG + Intergenic
1178999544 21:37443923-37443945 GGTAACATTCTGAGGTACTGGGG + Intronic
1179014206 21:37581376-37581398 AGTCACATTCTGAGGTACTGGGG - Intergenic
1179095678 21:38312512-38312534 GGTCACATTCTGAGGTACTAGGG + Intergenic
1179245594 21:39631518-39631540 GGTCACATTCTGAGGTAATTGGG + Intronic
1179391691 21:40998253-40998275 GGTCACATTATGAAGTACTGGGG + Intergenic
1179461522 21:41538581-41538603 GGTCACATTCTGAGGTACGGGGG - Intergenic
1179496648 21:41776022-41776044 GGTCACATTCCAAAGTACTGGGG - Intergenic
1179728287 21:43353229-43353251 AGTCACATTCTGAGGTACTGGGG - Intergenic
1180789384 22:18566352-18566374 GTTTACATTCTGAAATAGTCAGG + Intergenic
1180989798 22:19928664-19928686 AGTCACATTCTGAAGTGCTAGGG - Intronic
1181015661 22:20067005-20067027 AGTCACATTCTGAGGTACTGTGG - Intergenic
1181338316 22:22158200-22158222 GGTCACATTTAGAAGTACTGGGG - Intergenic
1181784375 22:25216225-25216247 GGTCACATTCTGAGGTACTGGGG - Intergenic
1182337106 22:29591333-29591355 GGTCACATTCCGAGGTACTAGGG - Intergenic
1182874494 22:33679316-33679338 GGTCACATTCTGAGGTGCTGGGG - Intronic
1182886750 22:33780255-33780277 GGTCACATTCTGAGGCACTGAGG + Intronic
1183273908 22:36879303-36879325 GGTCACATTCTGGAGTACTAGGG + Intergenic
1183908478 22:41060984-41061006 GGTTACATTCTGAGGTACTAGGG + Intergenic
1184605215 22:45569098-45569120 CGTCACATTCTGAGGTACTGGGG + Intronic
1184941840 22:47773760-47773782 GGTCACATTCTGAGGTACTGGGG - Intergenic
1184997283 22:48217540-48217562 GGTCACATTCTGCAGTACTTGGG - Intergenic
1185202186 22:49514367-49514389 GCACACATTCTGGAGAACCCAGG - Intronic
949128390 3:472785-472807 AGTCACATTCTGAGGTACTTGGG + Intergenic
949398244 3:3637885-3637907 AGTCACATTCTGAGGTACTAGGG + Intergenic
949752538 3:7371253-7371275 GCTCAAATTCTGAAGTTAGCTGG + Intronic
950689799 3:14646678-14646700 GGCCACATTCTGAGGTACTGAGG - Intergenic
950749389 3:15116898-15116920 AGTCACATTCTGAGGTACTGAGG + Intergenic
951092268 3:18587988-18588010 GGTCATATTCTGAAATACTAGGG + Intergenic
951145238 3:19218978-19219000 GGTCACATTCTGCAGTACTAGGG + Intronic
951169703 3:19526687-19526709 GCTCCCATTTTGAAGTGCTGGGG + Intronic
951216998 3:20034610-20034632 AGTCACATTCTGAAGTACTAGGG - Intergenic
951590834 3:24262579-24262601 GCTCACATTCAAAAGTCCTGAGG - Intronic
951657558 3:25026618-25026640 AATCACATTCTGAAGTACTTAGG + Intergenic
951709726 3:25575782-25575804 CGTCACATTCTGACATACTCGGG + Intronic
951911830 3:27758510-27758532 AGTCACATTCTGAAGTACTGGGG - Intergenic
951969214 3:28424368-28424390 GGTCACATTCTGAGGCACTGAGG - Intronic
952199857 3:31114844-31114866 AGTCACATTCTGAGGTACTGGGG - Intergenic
952749879 3:36816529-36816551 AGTCACATTCTGAGGTACTGGGG - Intergenic
952872749 3:37916398-37916420 GGTAACATTTTGAAGTACTAGGG - Intronic
953051139 3:39345041-39345063 GATCACATTCTGAAATACCAGGG - Intergenic
953236672 3:41113200-41113222 GGTCACATTCTGAGGTACTGGGG - Intergenic
953615755 3:44489309-44489331 GATCACATTCTGAAGAAATTTGG + Intergenic
954123386 3:48514071-48514093 GGTCACATTCTGAAGTACTAGGG + Intergenic
954965854 3:54610213-54610235 GATCACATTCTAAGGTACTGGGG + Intronic
955081880 3:55665386-55665408 GGTCACATTCTCAAGTACTAGGG - Intronic
955547667 3:60048512-60048534 GGTCACATTCTGAGGTACTGTGG + Intronic
955717608 3:61847092-61847114 GGTCACTTTCTGAAGTACTAGGG - Intronic
955849504 3:63204505-63204527 GGTCACATTTTGAGGTACTGGGG + Intergenic
955879837 3:63531578-63531600 GGTCACATTCTTAAGTATTGAGG + Intronic
956095457 3:65711560-65711582 ATTCACATTCTGAGGTACTGAGG - Intronic
956568784 3:70670671-70670693 GGTCATATTCTGAAGTACTGAGG + Intergenic
956917452 3:73887291-73887313 TCACACATTCTGAGGTACTGGGG + Intergenic
956932761 3:74064147-74064169 CGTCACATTCTGAAGTACTGGGG + Intergenic
957305211 3:78449173-78449195 GTTTACATAATGAAGTACTCAGG - Intergenic
957319546 3:78611706-78611728 AGTCACATTCTGAGGTACTGGGG - Intronic
957480209 3:80782967-80782989 GGACACATTCTGAGGTACTTGGG + Intergenic
957589639 3:82179430-82179452 ACTCTCATGCTGAAGTGCTCGGG - Intergenic
957668662 3:83270995-83271017 AGTCACATTCTGAAGTACTGGGG + Intergenic
957980057 3:87497427-87497449 AATCACATTCTGAAGTACTAGGG - Intergenic
958143296 3:89590485-89590507 GGTCACATTCTGGGGTACTGGGG + Intergenic
958179267 3:90037100-90037122 AGTCACATTCTGAAGCACTGGGG - Intergenic
958432305 3:94056693-94056715 AGTCACATTCTGAGGTACTGGGG + Intronic
958475532 3:94576080-94576102 GTTCACATTCCGAGGTACTGGGG + Intergenic
958585064 3:96076359-96076381 GGTCCCATTCTGAGGTACTGGGG + Intergenic
958608782 3:96396159-96396181 GTAAACATTCTGAAGTACTGGGG + Intergenic
958612126 3:96439164-96439186 GGTCACACTCTGAGGTACTGGGG + Intergenic
958799961 3:98743939-98743961 GGTCACAATCTGAGGTACTGGGG - Intronic
958841128 3:99206865-99206887 GCTCACTTTCAGAAGTATCCTGG + Intergenic
958862296 3:99458525-99458547 GGTCAAATTTTGAAGTACTGTGG - Intergenic
959223246 3:103549226-103549248 GGTCACATTCTAGAGTACTAGGG - Intergenic
959246472 3:103876439-103876461 GGTCACATTCTGAGATACTGGGG - Intergenic
959354987 3:105314736-105314758 AGTCACATTCTGAGGTACTGGGG + Intergenic
959461871 3:106636918-106636940 GGTCCTATTCTGAGGTACTCTGG + Intergenic
959497989 3:107073404-107073426 GGTCACATTCTGAAGTACCGGGG + Intergenic
959595579 3:108125367-108125389 GGTCACATTCTGAAATATTCAGG + Intergenic
959731913 3:109613732-109613754 AGTCACATTCTGAGGTACTAGGG - Intergenic
959747357 3:109792261-109792283 AGTCACATTCTGAGGTACTTGGG - Intergenic
959826473 3:110803087-110803109 GGCCACATTCTGAGGTACTAGGG - Intergenic
959886263 3:111504799-111504821 GGTCACATTCTGAGGTACTTGGG - Intronic
959968905 3:112386077-112386099 GGTCACATTCTGAGGAACCCAGG - Intergenic
960066967 3:113384451-113384473 AGTCACATTCTGAAGTATTGAGG - Intronic
960151118 3:114249865-114249887 AGTCACATTCTGAAGTGCTAGGG - Intergenic
960205661 3:114894492-114894514 GATCACATTTGGAAGTACTTGGG - Intronic
960240661 3:115338217-115338239 GGTCACATTCTGAGGTACTGGGG - Intergenic
960375633 3:116898019-116898041 GCTCACATACAGAAATACTGAGG + Intronic
960580805 3:119277020-119277042 GGTCATATTCTGAGGTACTAGGG + Intergenic
960617153 3:119606425-119606447 AGTCACATTCTGAAGTATTGGGG + Intronic
960732125 3:120738752-120738774 GCCTACTTTCTGAAGTACTATGG - Intronic
960742811 3:120853450-120853472 GGTCACATTCTGAGGTACTAGGG - Intergenic
960999886 3:123367152-123367174 GCATAGATTCTGAAGGACTCCGG - Intronic
961040088 3:123672060-123672082 GGTCACATTCTGAGGTACCAAGG - Intronic
961121347 3:124373811-124373833 GGTCACATTCTAAGGTACTGGGG + Intronic
961122349 3:124383695-124383717 GGTCACATTCTGAGATACTGGGG + Intronic
961341652 3:126227152-126227174 GGTCACATTCTGAGGTACTGGGG - Intergenic
961598044 3:128035013-128035035 AATCACATTCTGAGGTACTAAGG - Intergenic
961993681 3:131218597-131218619 AGTCACATTCTGAAGTACTGGGG - Intronic
962159100 3:132980124-132980146 GGTCACATTCTGAGGCACTGGGG - Intergenic
962215464 3:133517107-133517129 AGTCACATTCTGAGGTACTCGGG + Intergenic
962234790 3:133698737-133698759 GGTCACATTCTGAGGTAATGTGG + Intergenic
962293850 3:134162196-134162218 GGTCACATTCTGAGGTACTGGGG + Intronic
962551821 3:136501337-136501359 TTTCACATTCTGAGGTACTAGGG - Intronic
962589916 3:136879546-136879568 GGTCACATTCTTAAGTACTAGGG - Intronic
962607958 3:137048431-137048453 GGTCACATTCTGAAGTACTGGGG - Intergenic
962863945 3:139431036-139431058 GCTCACACTCTGAGCTACTGGGG - Intergenic
962864521 3:139436579-139436601 GCTCACATTCTGAGGTACTGGGG - Intergenic
962996414 3:140633226-140633248 GATCTCATTCTGAGGTACTGGGG - Intergenic
964008205 3:151856686-151856708 AATCACATTCTGATGTACTGGGG + Intergenic
964071670 3:152642041-152642063 AGTCACATTCTGAAGTACTAGGG - Intergenic
964100205 3:152979773-152979795 AATCACATTCTGAAATACTAGGG + Intergenic
964121750 3:153192430-153192452 AGTCACATTCTGAAGTACTGAGG - Intergenic
964251734 3:154725707-154725729 GGCCACATTCTGAAGTACTTGGG + Intergenic
964292728 3:155199487-155199509 GGTCACATTCACAAGTACTGTGG - Intergenic
964316100 3:155445706-155445728 GGTCACATTCTGAGGTACTGAGG + Intronic
964399925 3:156288279-156288301 AATCACATTCTGAGGTACTGGGG + Intronic
964417378 3:156461511-156461533 GCTCACATTCTGAGGTTCTGTGG + Intronic
964473152 3:157075275-157075297 GTTCACATTCTGAAGTACTGAGG + Intergenic
964795056 3:160487963-160487985 GGTCACATTCTGAGGTACTGGGG + Intergenic
964881401 3:161427325-161427347 GGTCACATTCTAAAGTACTGGGG - Intergenic
965048987 3:163619463-163619485 AGTCACATTCTGAGGTACTCGGG + Intergenic
965252274 3:166357099-166357121 GCTCACATTTGGAATTACTTTGG - Intergenic
965290978 3:166879927-166879949 GATCACATTCTGAGGTACTACGG + Intergenic
965354931 3:167662127-167662149 GGTCACATTCTGTGGTACTCGGG - Intergenic
965410166 3:168320369-168320391 GGTCACATTCTGAGGTACTGGGG - Intergenic
965456622 3:168909376-168909398 ACTCAGATTCTGGAGTGCTCGGG + Intergenic
965458721 3:168934110-168934132 AGTCACATTCTGAAGTACTGGGG + Intergenic
965762338 3:172092928-172092950 GCTCACAATCTCAGCTACTCAGG - Intronic
965839927 3:172893177-172893199 GGCCACATTCTAAAGTACTGGGG - Intronic
965903226 3:173669627-173669649 GGTTGCATTCTGAAGTACTGGGG + Intronic
966107662 3:176356677-176356699 AGTCACATTCTGAGGTACTGAGG + Intergenic
966403205 3:179567420-179567442 AGTCACATTCTGAGGTACTAGGG + Intronic
966552685 3:181222708-181222730 GGTCACATTCTGAGGTACTGGGG - Intergenic
966622413 3:181980300-181980322 AGTCACATTCTGAGGTACTGGGG - Intergenic
966821767 3:183930462-183930484 GGTCACATTCTTAGGTACTTAGG - Intronic
967070491 3:185958457-185958479 GGTCACATTCTGAGGTACTGGGG + Intergenic
967226390 3:187295664-187295686 AGTCACCTTCTGAAGTACTGAGG - Intergenic
967235071 3:187376302-187376324 GGTCACATTCTGAGGTACTAAGG + Intergenic
967506700 3:190260597-190260619 GCTCACATTCTGGGCTACTGCGG + Intergenic
968280158 3:197471117-197471139 AGTCACATTCTTAAGTACTGGGG + Intergenic
968635506 4:1676426-1676448 GTGCACATTCTGAAGTACTGGGG + Intronic
969045285 4:4332075-4332097 GGTCACATTCTGAGGTCCTGGGG - Intergenic
969145894 4:5123764-5123786 AGTCACATTCTGAGGTACTGGGG + Intronic
969182724 4:5454554-5454576 GGTCACATTCTGAGGTCCTGGGG + Intronic
969185481 4:5471228-5471250 GGTCACATTCTGAAGTAGGGGGG - Intronic
969225825 4:5797653-5797675 CCTCCCATTTTGAAGTACTTGGG + Intronic
969231193 4:5832847-5832869 GGTCACATTCTGAGGTAATGGGG - Intronic
969277406 4:6145941-6145963 TGTCACATTCTGAGGTACTGAGG + Intronic
969459040 4:7317937-7317959 TGTCACATTCTGAAGTGCTAGGG - Intronic
969856116 4:10001202-10001224 GGTCACATTCTGAGGTACTAGGG - Intronic
969978828 4:11133048-11133070 GGTCACATTCTGAGGGACTGGGG + Intergenic
970010907 4:11458092-11458114 GGTTACATTCTAAAGTACTGGGG + Intergenic
970207645 4:13671055-13671077 AGTCACATTCTGAGGTACTGGGG + Intergenic
970316983 4:14838662-14838684 AGTCACATTCTGAGGTACTGGGG - Intergenic
970322723 4:14891156-14891178 GCTCACATTCTGAGATACTGGGG - Intergenic
970323421 4:14898200-14898222 GGTCACATTCTGAGGTACTGAGG + Intergenic
970417212 4:15871204-15871226 AGTCACATTCTGAGGTACTGGGG - Intergenic
970461879 4:16282936-16282958 GGTCACATTCTCAGGTACTGGGG - Intergenic
970479255 4:16457301-16457323 GCCCACATTCTGAAGGACACAGG + Intergenic
970527732 4:16949447-16949469 GATCACATTCTGAGGTATTGGGG + Intergenic
970639661 4:18050149-18050171 TGTCACATTCTGAGGTACTGGGG + Intergenic
970656486 4:18236159-18236181 GGTCACATTCTGAGGTACTGGGG - Intergenic
970739111 4:19212076-19212098 AGTCACATTCTGAGGTACTGGGG + Intergenic
971022482 4:22551194-22551216 AGTCACATTCTGAGGTACTGGGG + Intergenic
971157086 4:24095074-24095096 GGTCACATTCTAAAGTAATGGGG - Intergenic
971313866 4:25550574-25550596 CCTCAGATTCTGAAATGCTCAGG - Intergenic
971355905 4:25895188-25895210 GGTCATATTCTGAAGTACTAGGG - Intronic
971362065 4:25947249-25947271 GCGCTCACTCTGAGGTACTCAGG + Intergenic
971462856 4:26920986-26921008 GGTCACATTCTGAGGTGCTGGGG - Intronic
971493352 4:27237701-27237723 AGTCACATTCTGATGTACTGGGG - Intergenic
971769279 4:30875375-30875397 GATCACATTCTGAGGTAGTAGGG + Intronic
971841130 4:31853697-31853719 GGTCACATTCTGAAATACTAGGG - Intergenic
972167695 4:36307519-36307541 GGTCACATTCTGAGGTACTAGGG + Intronic
972238492 4:37162090-37162112 AGTCACATTCTGAGGTACTAGGG + Intergenic
972355622 4:38277344-38277366 CCTCACATTCTGAGGTACCAGGG + Intergenic
972554847 4:40171548-40171570 GATCACATTCAGGAGTACTGGGG - Intergenic
972573318 4:40329979-40330001 GGTCACATTCTTCAGTACTGGGG - Intergenic
973087314 4:46081725-46081747 AGTCACATTCTGAAGTTCTCGGG - Intronic
973177676 4:47228014-47228036 AGTCACATACTGAAGTACTGAGG + Intronic
973957360 4:56076048-56076070 AGTCACATTCTGAGGTACTTGGG - Intergenic
973973216 4:56236055-56236077 GGTCACATTCTGAGGTCCTGGGG - Intronic
974020946 4:56691846-56691868 GGTCACATTCTGAGGTACTAGGG + Intergenic
974140775 4:57883675-57883697 GGTCACATTCTTATGTACTTGGG + Intergenic
974241964 4:59260944-59260966 GGCCACATTCTGAGGTACTGAGG - Intergenic
974325713 4:60412530-60412552 GGTCACATTCTAAGGTACTGAGG + Intergenic
975318156 4:72978930-72978952 GGTCACGTTCTGAGGTACTGGGG - Intergenic
975341324 4:73244219-73244241 AATCACATTCTGAAATACTTGGG + Intronic
975396292 4:73877718-73877740 GGTCACATTCTGAAGTACTGGGG - Intergenic
975413072 4:74077627-74077649 GGTCACATTCTGATGTACTGGGG + Intergenic
975804470 4:78097798-78097820 AGACACATTCTGAAGTACTAAGG - Intronic
975923502 4:79421383-79421405 AGTCACATTCTGAGGTACTAAGG + Intergenic
976112260 4:81688572-81688594 AGCCACATTCTGAAGTACTAGGG - Intronic
976221967 4:82763165-82763187 AGTCACATTCTGAGGTACTGAGG - Intronic
976281177 4:83328480-83328502 AGTCACATTCTGAGGTACTGGGG + Intronic
976304069 4:83542023-83542045 AGTCACATTCTGAGGTACTGGGG + Intronic
976496332 4:85733856-85733878 GGTCACATTCTGAGGTATTGGGG + Intronic
976816104 4:89149526-89149548 GGTAACATTCTGAGGTACTGGGG - Intergenic
977165424 4:93688945-93688967 AGTCATATTCTGAAGTACTAAGG - Intronic
977545843 4:98375384-98375406 GGTCACATTCTGAAGTGCTAGGG + Intronic
977698750 4:99996813-99996835 GGTAACATTCTGAGGTACTGGGG + Intergenic
977706819 4:100080775-100080797 GCTGCCATTCTGTACTACTCTGG - Intergenic
977784468 4:101016603-101016625 GGTCACATTGTGAGGTACTGGGG + Intergenic
977870433 4:102083819-102083841 GGCCACATTCTGAGGTACTGTGG - Intergenic
977886087 4:102253111-102253133 GGTCACATTCTGAAATACTGGGG + Intronic
977895558 4:102360991-102361013 AGTCACATTCTGAGGTACTGGGG - Intronic
978256407 4:106697667-106697689 GATCACATTCTGAGGTATTCGGG + Intergenic
978267630 4:106845342-106845364 GCTCACATTTAGAGGTACTGAGG - Intergenic
978524533 4:109652212-109652234 AGTCACATTCTGAGGTACTAGGG + Intronic
978630427 4:110737932-110737954 GGTCACATTCTGGAGTACTGGGG - Intergenic
978683196 4:111408328-111408350 GGTCACATGCTGAGGTACTGGGG + Intergenic
978738107 4:112107260-112107282 GGTCACATTTTGAAGTATTGGGG - Intergenic
978991910 4:115094622-115094644 GGTCACATTCTGAGATACTGGGG - Intronic
979033425 4:115680459-115680481 GGTCACATTTTAAAGTACTGAGG - Intergenic
979053637 4:115969273-115969295 GTTCACATCCTGAGGTACTAAGG + Intergenic
979092654 4:116505058-116505080 AGTCACATTCTGAAGTCCTAAGG + Intergenic
979426170 4:120570643-120570665 GGTCACATTCTAAAGTACTCAGG - Intergenic
979568964 4:122193184-122193206 AGTCACATTCTGAGGTACTGGGG + Intronic
979597334 4:122548646-122548668 GGTCACATTCTGAAGTACTGGGG - Intergenic
979611351 4:122692126-122692148 GGTCACATTCTGAGGTACTGGGG - Intergenic
980005304 4:127535301-127535323 AGTCACATTTTGAAGTACTAGGG + Intergenic
980111162 4:128638541-128638563 AGTCACTTTCTGAAGTACTGGGG - Intergenic
980511878 4:133802193-133802215 AGTCACATTCTGAGGTACTGGGG + Intergenic
980764682 4:137286468-137286490 AGTCACATTTTGAAGTACTGTGG + Intergenic
980812562 4:137901513-137901535 GGTCACATTCTGAGGAACTGAGG + Intergenic
980844332 4:138305856-138305878 GGTCACATTCTAAGGTACTCAGG + Intergenic
981220007 4:142220980-142221002 AGTCACATTCTGTAGTACTGGGG + Intronic
981349154 4:143708922-143708944 GGTCTCATTCTCAAGTACTTGGG + Intergenic
981358887 4:143824641-143824663 GGTCACATTCTGAGATACTTGGG + Intergenic
981369670 4:143945524-143945546 GGTCACATTCTGAGATACTTGGG + Intergenic
981379408 4:144055466-144055488 GGTCACATTCTGAGATACTTGGG + Intergenic
981438114 4:144750083-144750105 GGTCACATTCTAAGGTACTGGGG + Intergenic
981486836 4:145295634-145295656 GGTCACATTCTGAGGTGCTGAGG - Intergenic
981605426 4:146535476-146535498 GGTCACATTTTGAGGTACTAGGG - Intergenic
981636747 4:146890221-146890243 GGTCACATTCATAAGTACTGGGG + Intronic
981686618 4:147461914-147461936 GGTCACATTCTGAGGTCCTGGGG - Intergenic
982090069 4:151872711-151872733 GTTCAGATTCTGTTGTACTCGGG - Intergenic
982260378 4:153489050-153489072 GGTCACATTCTGAGGTACTGGGG + Intronic
982446116 4:155492366-155492388 GGTCACATTCTGAGGTATTTGGG - Intergenic
982809848 4:159811540-159811562 GCTCACCATCTGCCGTACTCAGG - Intergenic
982984304 4:162185781-162185803 AGTCAAATTCTGAAGTACTGGGG + Intergenic
983048457 4:163014767-163014789 GGTCACATTCTGAGATACTTGGG + Intergenic
983089178 4:163484100-163484122 GGTCACATTCTGAGGTACTGGGG + Intergenic
983394412 4:167175494-167175516 GGTCACACTCTGAAGTACTGGGG - Intronic
983653306 4:170055017-170055039 GGTCACATTCTGAGGTATTGGGG - Intergenic
983819210 4:172172067-172172089 AGTCACATTCTGAGGTACTGGGG - Intronic
983984927 4:174047424-174047446 AGTCACATTCTGAGGTACTGTGG - Intergenic
984058692 4:174964127-174964149 AGTCACATTCTCAAGTACTGGGG - Intronic
984179728 4:176467356-176467378 GCTCACATTTTGCAGCTCTCAGG - Intergenic
984191689 4:176613464-176613486 GGTCACATTCTGAGGTACCATGG - Intergenic
984194122 4:176638133-176638155 ACACACATTCTGAGGTACCCGGG + Intergenic
984213688 4:176881176-176881198 GCTCACATTCTGAGATATTTGGG + Intergenic
984934804 4:184880776-184880798 GGTCACATTCTGAGGTACTGGGG + Intergenic
985249133 4:188005569-188005591 AGTCACATTCTGAGGTACTGAGG + Intergenic
985690955 5:1312021-1312043 GGGCACATTCTGAAGTTCTGGGG - Intergenic
985931639 5:3062820-3062842 GATCACATTCTGAAGTACTTGGG - Intergenic
985961777 5:3307972-3307994 ACTCACATTCTGAGGTATTGAGG + Intergenic
986030053 5:3885046-3885068 AGTCACATTCTGAGGTACTTGGG + Intergenic
986053185 5:4109179-4109201 GGTCACATCCTGAGGTACTGGGG + Intergenic
986123297 5:4863185-4863207 GGTCACATTCTGAGGTACTGGGG - Intergenic
986252085 5:6069317-6069339 GGTCACATTCTGATGTTCTGGGG - Intergenic
986268963 5:6215235-6215257 GATCACATTCTGAGGTTCTGAGG - Intergenic
986310497 5:6547383-6547405 GGTCAGATTCTGAAGTACCTGGG - Intergenic
986315714 5:6585060-6585082 GCTCCCATTCTGAGGTACTTAGG - Intergenic
986406242 5:7427697-7427719 GGTCACATTCTGAGGTTCTAGGG + Intronic
986414439 5:7514583-7514605 GGTCACATTCACAAGTACTGCGG - Intronic
986449071 5:7849120-7849142 GTTCACATTCTAAGGTACTGGGG + Intronic
986661595 5:10064838-10064860 GGTCACATTCTGAGGTGCTAGGG - Intergenic
986758815 5:10861462-10861484 GGTCACATTCTGAGATACTGGGG - Intergenic
986769220 5:10956683-10956705 GGTCACATTCTGAACTACTGTGG + Intergenic
986808284 5:11329493-11329515 AGTCACATTCTGAGGTACTGGGG + Intronic
986849384 5:11793415-11793437 GGTCACATTCTGAGGTATTGGGG - Intronic
986987076 5:13512241-13512263 GGTCACACTCTGAGGTACTGAGG + Intergenic
987116787 5:14732040-14732062 GTTAACATTTTGAAGTCCTCAGG - Intronic
987117276 5:14735829-14735851 GGTCACATTCTGAGGTACTGGGG + Intronic
987155251 5:15082534-15082556 GCTCACATTCTGAACCCCTGTGG + Intergenic
987207248 5:15640488-15640510 GGTCACATTCTGAGGTACTGGGG + Intronic
987275780 5:16361129-16361151 ACTCACACTCTGCAGTACTAAGG + Intergenic
987362869 5:17122421-17122443 GGTCACATTTTGAGGTACTGGGG - Intronic
987393370 5:17397818-17397840 GGTCACATTTTGAAGTACAGGGG - Intergenic
987437642 5:17915812-17915834 GGTCACATTCTGAGGTAGTAGGG - Intergenic
987548681 5:19348944-19348966 GCTCACATTCTGAGGTACTGGGG - Intergenic
987568642 5:19626100-19626122 GGTCACATTCTGAGTTACTGGGG + Intronic
987575867 5:19727221-19727243 GGTCACATTCTGAGGTACTGGGG - Intronic
987582417 5:19811263-19811285 GATCACATTTTGAAGTATTGGGG - Intronic
987714335 5:21547311-21547333 GTTCACATTTTGAGGTACTTAGG + Intergenic
987736854 5:21857259-21857281 GCACAGAATCTGAAGTAGTCTGG + Intronic
987764740 5:22211098-22211120 GCTATCATTCTGAAATTCTCTGG - Intronic
987841097 5:23223589-23223611 GGTCCCATTCTGAAGTACTGGGG - Intergenic
987865840 5:23536776-23536798 GATTACATTCTGAGGTACTGTGG - Intergenic
988322119 5:29712396-29712418 GACCACATTCTGAAGTACTTTGG - Intergenic
988322283 5:29713805-29713827 GGTCACGTTCTGAGGTACTGGGG - Intergenic
988351093 5:30107948-30107970 GGTCACATTCTGAAGTACTAAGG + Intergenic
988414030 5:30923416-30923438 GCTCATATTCTGAGGTACTGGGG - Intergenic
988589402 5:32535864-32535886 GATCACATTCTGAGGTACTGGGG - Intronic
988625819 5:32873207-32873229 GGTCATATTCTGAGGTACTTGGG + Intergenic
988660154 5:33257690-33257712 GGTCATATTCTGAGGTACTAGGG - Intergenic
989001206 5:36762647-36762669 GGTCACATTCTGGGGTACTGGGG + Intergenic
989125945 5:38052472-38052494 GGCCACATTCTGAGGTACTGGGG + Intergenic
989333026 5:40281863-40281885 ACTCACATTCTGAGGTAATGGGG + Intergenic
989352255 5:40499773-40499795 GGTCACACTCTAAAGTACTGAGG - Intergenic
989384901 5:40845417-40845439 CATCACATTCTGAGGTACTGGGG + Intronic
989492489 5:42073996-42074018 AGTCACATTCTGAGGTACTTGGG + Intergenic
990135047 5:52634891-52634913 GGTCAAATTCTGAGGTACTAGGG + Intergenic
990144700 5:52745790-52745812 GCTCACATTCTGAGGTACTGGGG + Intergenic
990327358 5:54691563-54691585 GCCCACACTCTGAAGAACTCTGG - Intergenic
990349453 5:54901100-54901122 GCTGACATTCTGAATGACACAGG + Intergenic
990596007 5:57313238-57313260 GGTCACATTCTGAGGTTCTGGGG - Intergenic
990620457 5:57553699-57553721 GGTCACATTCTGACGTATTGGGG - Intergenic
990842169 5:60094481-60094503 AATCACATTCTAAAGTACTGGGG - Intronic
991047933 5:62242456-62242478 GGTCACATTCTGAGGTACTGGGG + Intergenic
991569995 5:68043760-68043782 AGTCACATTCTGAGGTACTGGGG - Intergenic
991570095 5:68044762-68044784 AGTCACATTCTGAGGTACTGGGG + Intergenic
991607872 5:68421518-68421540 GGTCACATTCTGAGGTACAGGGG - Intergenic
991613226 5:68469561-68469583 GCTCACATTCTTAGATACTTGGG - Intergenic
991899478 5:71444249-71444271 GCTATCATTCTGAAATTCTCTGG - Intergenic
992179340 5:74181620-74181642 AGTCACATTCTGAGGTACTGAGG - Intergenic
992198215 5:74360469-74360491 CATCACATTCTGAGGTACTAGGG + Intergenic
992523980 5:77587664-77587686 AATCACATTCTGAGGTACTGGGG - Intronic
992936127 5:81707284-81707306 GGTCACATTCTGAGGTACGAGGG - Intronic
993441506 5:87962349-87962371 GGTCACATTCTGAGGTACTGGGG + Intergenic
993567150 5:89489942-89489964 GCTCACATTTTGAGGTACTGGGG - Intergenic
994030023 5:95130813-95130835 AGTCACATTCTGAAGTGCTGGGG + Intronic
994156919 5:96514142-96514164 GGTCACATTCTGAGGTATTGGGG + Intergenic
994300724 5:98143849-98143871 GGTCACATTCTAAAGTACTGAGG + Intergenic
994386209 5:99135836-99135858 GGTCACATTCTGAAATATTGAGG + Intergenic
994425820 5:99586025-99586047 GGGCACATTCTGAGGTACTGGGG - Intergenic
994571157 5:101515717-101515739 GTTCACATTCTGAGATACTGGGG - Intergenic
994787548 5:104183434-104183456 GGTCACATTCTGAGGTACTGAGG + Intergenic
994813312 5:104550768-104550790 GCTTACATACTGATGTACTGAGG + Intergenic
995016704 5:107318148-107318170 AGTCACATTCTGAAATACTGGGG - Intergenic
995094991 5:108225348-108225370 GATCACATTCTGAGGTAGTGAGG - Intronic
995268986 5:110199547-110199569 ACTCACATTCTGAGGTCCTTGGG - Intergenic
995419009 5:111941580-111941602 AGTCACATTCTGAAGTATTAGGG + Intronic
995712648 5:115050715-115050737 GGTCACATTCTGAGGTATTTAGG - Intergenic
996777139 5:127144815-127144837 GTTCACATTCTGAGGTATTATGG - Intergenic
997133102 5:131296690-131296712 GGTCACATTCAGAGGTACTGGGG + Intronic
998048917 5:139014621-139014643 GCTTAGTTTCTGCAGTACTCAGG + Intronic
998513063 5:142729704-142729726 GGTCACATTCTGAAGTACTAGGG + Intergenic
998730981 5:145077042-145077064 TTTCACATTCTGAGGTACTGAGG - Intergenic
999067826 5:148710314-148710336 GGTTACATTCTGAGGTACTAGGG + Intergenic
999070012 5:148734601-148734623 AATCATATTCTGAAGTACTGGGG - Intergenic
999076658 5:148802736-148802758 GGTCACATTCTGAGGTACTAGGG + Intergenic
999200861 5:149815217-149815239 GGTCACATTCTGAGGCACTGGGG - Intronic
999508036 5:152218692-152218714 GGTCACATTCTGAGGTACCGGGG + Intergenic
999842667 5:155446126-155446148 GGGCACATTCTGAAGTACTTGGG - Intergenic
1000041268 5:157486827-157486849 GGTCACATTCTGAGGTACTCAGG - Intronic
1000201160 5:159012446-159012468 AGTCACATTCTGAGGTACTGGGG - Intronic
1000286161 5:159827733-159827755 GGTCACATTCTGAGGTACGAGGG + Intergenic
1000467623 5:161599735-161599757 AGTCACATTCTGAGGTACTGGGG - Intronic
1001056211 5:168452315-168452337 AGTCACATTCTGAGGTACTAGGG - Intronic
1001085614 5:168698253-168698275 GATCACGTTCTGATGTACTCAGG - Intronic
1001707197 5:173750105-173750127 GGTCACATTTTGAGGTACTAGGG - Intergenic
1001756659 5:174175530-174175552 AGTCACATTCTGAAGTCCTGAGG + Intronic
1001773698 5:174313426-174313448 AGTCACATTCTGAGGTACTAGGG + Intergenic
1001808857 5:174611571-174611593 GCTCAGGTTCTGAGGTTCTCAGG - Intergenic
1002361517 5:178675143-178675165 GTTCACATTCTGAGGTACTGGGG + Intergenic
1002765162 6:233045-233067 GGTCACATTCTGAGGTATTGGGG - Intergenic
1002959093 6:1897355-1897377 GGTCACATTCTGAGGTACTGGGG + Intronic
1003143386 6:3490104-3490126 GGTCAGACTCTGAAGTACTGGGG - Intergenic
1003235279 6:4289732-4289754 GGTCACATTCTGAGGTACCAGGG + Intergenic
1003272151 6:4616749-4616771 GGTCACATTCTGAGGTACTGAGG + Intergenic
1003378798 6:5603796-5603818 GCTCGTATTCTGAGGTACTGGGG + Intronic
1003428981 6:6021864-6021886 GGTCACATTCTGAGGTACTGGGG - Intergenic
1003466009 6:6380737-6380759 AGTCACATTCTGAGGTACTGGGG - Intergenic
1003521600 6:6862976-6862998 GGTCACATTCTGAGGTGCTTGGG + Intergenic
1003617485 6:7668736-7668758 AGTCACATTCTGAAGTTCTAGGG - Intergenic
1003862505 6:10335402-10335424 AGTCACATTCTGAGGTACTGGGG - Intergenic
1003991043 6:11486846-11486868 AGTCACATTCTGAAGAACTGGGG + Intergenic
1004037849 6:11941366-11941388 GGTCATATTCTGAGGTACTGTGG + Intergenic
1004062198 6:12208571-12208593 GATCATACTCTGAAGTACTAGGG - Intergenic
1004083248 6:12417118-12417140 GGTCACATTCTGAGGTACTAGGG - Intergenic
1004184717 6:13412182-13412204 AGTCACATTCTGAGGTACTGGGG - Intronic
1004238368 6:13895978-13896000 GATCACATTTTGAGGTACTGGGG + Intergenic
1004308367 6:14521652-14521674 AGTCACATTCTGAAGTACTGAGG - Intergenic
1004310295 6:14539691-14539713 GGTCACATTCTGAGATACTGAGG - Intergenic
1004373866 6:15075320-15075342 GGTCACATTCTGAGTTACTGGGG + Intergenic
1004456148 6:15793147-15793169 AGTCACATTCTGAGGTACTGGGG + Intergenic
1004475246 6:15965638-15965660 GGTCACATTCACAAGTACTAGGG - Intergenic
1004637465 6:17482828-17482850 GGTCACATTCTGAAGTACTTAGG + Intronic
1004884035 6:20034991-20035013 GGTCACATTCTGAAGTATGAGGG - Intergenic
1004890311 6:20095019-20095041 ATTCACATTCTGAAGTCCTGGGG - Intergenic
1004985241 6:21074422-21074444 GGTAACATTCTGAAGTACTGGGG + Intronic
1005304077 6:24496862-24496884 ACTCACATTCTGAGATACTGGGG + Intronic
1005351300 6:24938076-24938098 GGTCACATTCTGAGGTACTGGGG - Intronic
1005607600 6:27490164-27490186 GGTCATATTCTGAGGTACTGGGG + Intergenic
1005726146 6:28650831-28650853 GATCACATTCTGAGGTACTGAGG - Intergenic
1005806349 6:29477369-29477391 AGTCACATTCTGAAGTATTAGGG - Intergenic
1006017665 6:31095085-31095107 GATCACATTCTGAGGTACCAGGG + Intergenic
1006843423 6:37046656-37046678 AATCACATTCTGAGGTACTTGGG - Intergenic
1007765635 6:44158282-44158304 GGTCACATTCTGAAGTACTGGGG - Intergenic
1007877698 6:45124789-45124811 GGTCATATTCTGAGGTACTAGGG - Intronic
1008085012 6:47235285-47235307 AGTCGCATTCTGAAGTACTGGGG - Intronic
1008262499 6:49384374-49384396 AGTCACATTCTAAAGTACTGGGG - Intergenic
1008444156 6:51569139-51569161 GCTCACATCATGAAGAACCCAGG - Intergenic
1008936253 6:56995784-56995806 GGTCACATTCTGAGGTAATAGGG + Intronic
1008972370 6:57384488-57384510 GGTCACATTCTGAGGTACTGGGG + Intronic
1009002393 6:57734767-57734789 GTTCACATTTTGAGGTACTTAGG - Intergenic
1009161280 6:60286012-60286034 GGTCACATTCTGAGGTACTGGGG + Intergenic
1009390559 6:63138827-63138849 AGTGACATTCTGAAGTACTGAGG + Intergenic
1009413033 6:63388392-63388414 GGTCACACTCTGAAGTACTGAGG - Intergenic
1009422954 6:63483894-63483916 AGTCACATTCTGAGGTACTAGGG + Intergenic
1009467088 6:63985023-63985045 AGTCACATTCTGAGGTACTAGGG - Intronic
1009615086 6:65993294-65993316 GGTCACATTCTGAGGCACTCTGG + Intergenic
1009857025 6:69277538-69277560 GCACACCTTCTGAAGTCCTTTGG - Intronic
1010002500 6:70961995-70962017 GGTCACATTCTGAGGTACTGGGG - Intergenic
1010277510 6:73986915-73986937 AGTCACATTCTGAAGTACTGGGG - Intergenic
1010361147 6:74996187-74996209 GGTCATATTCTCAAGTACTGGGG - Intergenic
1010913216 6:81584803-81584825 CATCACATTCTGAGGTACTGTGG - Intronic
1010950436 6:82030648-82030670 GGTCACATTCTGAGGTACTAGGG + Intergenic
1011529059 6:88299995-88300017 GGTCACATTCTGAGGTTCTGGGG + Intergenic
1011591521 6:88974778-88974800 GGTCATATTCTGAGGTACTAGGG - Intergenic
1011670574 6:89679472-89679494 AGTCACATTCTGAAGTTCTAGGG - Intronic
1011724274 6:90193222-90193244 GGTCACTTTCTGAGGTACTGGGG - Intronic
1012024551 6:93972174-93972196 AGTCACATTCTGAGGTACTGGGG + Intergenic
1012227301 6:96718735-96718757 GGTCACATTCTGAGGTACTAGGG + Intergenic
1012777563 6:103517007-103517029 AGTCACATTCTGAAGTTCTGGGG - Intergenic
1013091880 6:106907594-106907616 GGTCACATTCTGAGGAACACAGG - Intergenic
1013140561 6:107329633-107329655 GGTCACATTGTGAGGTACTAGGG + Intronic
1013223459 6:108101084-108101106 GGTTACATTCTGAGGTACTGGGG - Intronic
1013633797 6:112009772-112009794 GGTCACACTCTGAAGTACTAGGG - Intergenic
1013649940 6:112184278-112184300 GCGGCAATTCTGAAGTACTCTGG + Intronic
1013709352 6:112879612-112879634 AGTCACATTCTAAAGTACTGGGG - Intergenic
1013794227 6:113867651-113867673 AGTCACATTCTGAGGTACTGGGG - Intergenic
1013798768 6:113915463-113915485 CATCACATTCTGAGGTACTGGGG + Intergenic
1013799281 6:113922544-113922566 AATCACATTCTGAGGTACTGGGG - Intergenic
1013823102 6:114179126-114179148 GCTTACATTCTGGAGTTCTGAGG - Intronic
1013894045 6:115063189-115063211 GATCACATTATTAAGTTCTCAGG - Intergenic
1013975021 6:116066969-116066991 GGTCACGTTCTGAAGTGCTGAGG - Intergenic
1013976916 6:116089778-116089800 CATCACATTCTGAAATACTGAGG + Intergenic
1014060710 6:117068809-117068831 GCTCACATTCGGAGGTTCTGAGG - Intergenic
1014153683 6:118087356-118087378 AGTCACATTCTGAGGTACTGGGG + Intronic
1014220203 6:118792118-118792140 AGTCACATTCTGAGGTACTGGGG + Intergenic
1014229883 6:118891671-118891693 AGTCACATTCTGAGGTACTAGGG + Intronic
1014409154 6:121092829-121092851 AGTCACATTCTGAAGTAGTGGGG + Intronic
1014451873 6:121591472-121591494 AGTCACATTCTGAGGTACTAGGG + Intergenic
1014516785 6:122388772-122388794 AGTCACATTCTGAGGTACTGGGG + Intergenic
1014698517 6:124654593-124654615 AGTCACATTCTGAGGTACTGGGG - Intronic
1014723625 6:124949795-124949817 GATCACATTCTGAAGTGCTTGGG - Intergenic
1014803348 6:125801857-125801879 GATCACATTCTGGAGTACTGAGG + Intronic
1015051145 6:128841874-128841896 ACTTACATTCTGAGGTACTGAGG + Intergenic
1015149621 6:130022118-130022140 GCTTACATTCTGAATCACTTAGG - Intronic
1015188464 6:130445917-130445939 AGTCACATTCTTAAGTACTGGGG + Intergenic
1015517011 6:134092854-134092876 GGTCACATTCTGCAGTCCTGAGG - Intergenic
1015518854 6:134112065-134112087 GGTCACATTCTGTGGTACTGCGG + Intergenic
1015552885 6:134430695-134430717 GGTCACATGCTGAGGTACTGAGG + Intergenic
1015635033 6:135266516-135266538 GGTCACATTCTGAGGTTCTAAGG + Intergenic
1015695096 6:135971064-135971086 GATCACATTCTGAGGTACGGGGG - Intronic
1015704559 6:136073666-136073688 GGTCACATTCTGAGGTGCTTGGG + Intronic
1015800572 6:137058131-137058153 GGTCATATTCTGAGGTACTGGGG - Intergenic
1015975491 6:138786270-138786292 ACTCACATTCTGAGATACTGGGG + Intronic
1016079273 6:139835840-139835862 GCTCACATGCTGAACTACCAGGG - Intergenic
1016097746 6:140059106-140059128 GGTCACATTCTGATGTACTAGGG + Intergenic
1016631115 6:146232783-146232805 AGTCACATTCTGATGTACTGGGG + Intronic
1016787776 6:148031737-148031759 GGTCACATTCTGAGGCACTGGGG + Intergenic
1016852615 6:148636418-148636440 AGTCACATTCTGAAATACTGGGG - Intergenic
1017046177 6:150349062-150349084 GTTCACATTCTGAGGTACTGGGG + Intergenic
1017331295 6:153200571-153200593 GGTCACATTCTGAGGTACCAGGG + Intergenic
1017332279 6:153213695-153213717 AGTCACATTCTGAGGTACTGGGG + Intergenic
1017411081 6:154168539-154168561 GGTCACATTCTGAGGTATTAGGG + Intronic
1017424638 6:154307505-154307527 AGTCACATTCTGATGTACTGGGG + Intronic
1017751946 6:157496434-157496456 GGTCACATTCTGAGGTCCTGGGG - Intronic
1018063957 6:160112729-160112751 GGTCACATTCTGAAGTACTGGGG - Intronic
1018085672 6:160299611-160299633 AGCCACATTCTGAGGTACTCGGG - Intergenic
1018436303 6:163762265-163762287 GCTCACCTTCTGAGGTACTGGGG + Intergenic
1018603307 6:165570057-165570079 AGTCACATTCTGAGGTACTGGGG - Intronic
1019613952 7:1950477-1950499 GATTACCTTCTGAAGGACTCGGG - Intronic
1020342926 7:7132053-7132075 GGTCACATTCTGAAGTATTAGGG - Intergenic
1020891570 7:13884815-13884837 GGTCACATTCTGAGGTACTGGGG - Intergenic
1021193987 7:17653834-17653856 GGTCACATTTTGAAGGACTAGGG + Intergenic
1021885833 7:25137802-25137824 GGTCACATTCTGAGGTACTTGGG + Intronic
1021971644 7:25970845-25970867 GGTCACATTCTGAGGCACTAGGG + Intergenic
1022217876 7:28282273-28282295 GGTCCCATTCTGAGGTACTGGGG - Intergenic
1022243086 7:28531575-28531597 GGTCACATTCTGAGGTCCTGGGG + Intronic
1022387874 7:29918390-29918412 GGTCACATTCTGAGGTACTGGGG - Intergenic
1022462358 7:30622257-30622279 GCTCATTTTCTGAAATACTGAGG + Intronic
1022499916 7:30876388-30876410 AGTCACATTCTGAGGTACTGGGG + Intronic
1022808377 7:33845609-33845631 AGTCACATTCTGAGGTACTGGGG - Intergenic
1022809859 7:33858258-33858280 GGTCACATTCAGAGGTTCTCGGG - Intergenic
1023040286 7:36167189-36167211 AGTCACATTCTGAAGTACTGGGG + Intronic
1023134138 7:37034150-37034172 AGTCACATTCTGAGGTACTGGGG - Intronic
1023275104 7:38510365-38510387 AGTCACATTCTGAGGTACTGGGG + Intronic
1023380276 7:39600264-39600286 GGTCACATTCTGAAGTACTGGGG - Intronic
1023646844 7:42326570-42326592 AGTCACATTCTGAGGTACTGAGG + Intergenic
1023895442 7:44429242-44429264 GGTCACATTCTGAGGTCCTGGGG - Intronic
1024349749 7:48351675-48351697 AGTCACATTCTGAGGTACTGGGG + Intronic
1024394735 7:48853037-48853059 AGTCACATTCTGAAGTTCTGAGG - Intergenic
1024400525 7:48919604-48919626 AGTCACATTCTGAAGTTCTGAGG + Intergenic
1024436906 7:49367083-49367105 GGTCACGTTCTGAGGTACTGTGG + Intergenic
1024574785 7:50754815-50754837 AGTCACATTCTGAAGTGCTGGGG - Intronic
1024831563 7:53465414-53465436 TGTCACATTCTGAAGTACTAGGG - Intergenic
1025064261 7:55839794-55839816 GGTCACATTCTGAGGTACTGGGG - Intronic
1026151829 7:67794370-67794392 GGTCACATTCTGTAGCACTGAGG - Intergenic
1027440796 7:78217144-78217166 GTTCACATTCTGAGGTACTGGGG + Intronic
1027771838 7:82416758-82416780 GGTCACATTCTGAAGTACTGGGG + Intronic
1028000636 7:85493613-85493635 AGTCACATTCTGAGGCACTCTGG + Intergenic
1028378533 7:90173685-90173707 GGTCACATTCTGAGGTACCAGGG - Intronic
1028430407 7:90740372-90740394 GGTTACATTCTGAGGTACTGGGG - Intronic
1028543842 7:91976051-91976073 GCTCACAATCCCAACTACTCAGG - Intronic
1028749898 7:94371660-94371682 AGTCACATTCTGAGGTACTAGGG - Intergenic
1028859683 7:95634785-95634807 GATCATTTTCTGAAGTACTGGGG - Intergenic
1028882011 7:95890977-95890999 AGTCACATTCTGAGGTACTGGGG - Intronic
1028889939 7:95975609-95975631 GGCCACATTCTGAGGTACTGGGG + Intronic
1028954031 7:96668777-96668799 GGTCACATTCTGAAGTACTAGGG - Intronic
1029188278 7:98754851-98754873 AGCCACATTCTGAAGTACTGGGG + Intergenic
1029295452 7:99536784-99536806 GGTCACATTCTGAGGTACTAGGG - Intergenic
1029907604 7:104107214-104107236 GATCACATTCTGAGGTGCTGGGG + Intergenic
1030279938 7:107762986-107763008 GCTTACATTCTGACTTACTTAGG + Intergenic
1030600252 7:111584074-111584096 ATTCACATTCTGAGGTACTGGGG + Intergenic
1030840873 7:114352752-114352774 AGTCACATTCTGAGGTACTGAGG + Intronic
1030899532 7:115105214-115105236 AGTCACATTCTGAAGTTCTGGGG - Intergenic
1031478337 7:122249160-122249182 GGTCACATTCTGAGGTACTGGGG - Intergenic
1031524516 7:122807908-122807930 GGTTACATTCTGAGGTACTAGGG + Intronic
1031628258 7:124015612-124015634 GGTCACATACTGAGGTACTAGGG - Intergenic
1031759090 7:125688524-125688546 GATCACATTCAGAAGTACTAGGG - Intergenic
1031766699 7:125786974-125786996 AGTCACATTCTGAAGTACTGGGG + Intergenic
1031785260 7:126022382-126022404 GGTCCCATCCTGAAGTACTGGGG - Intergenic
1031817370 7:126454611-126454633 AGTCACATTCTGAGGTACTGGGG - Intronic
1032004389 7:128288611-128288633 GGTCACATTCTGAGGTGCTGGGG - Intergenic
1032172744 7:129599476-129599498 AGTCACATTCCGAGGTACTCAGG - Intergenic
1032296308 7:130642002-130642024 ACTCACATTAGGAAGTACTCTGG - Intronic
1032406973 7:131663417-131663439 GGCTACATTCTGAAGTACTGGGG + Intergenic
1032444485 7:131970162-131970184 GCTCATATTCTGAGGTACTGGGG - Intergenic
1032672603 7:134099087-134099109 GGTCACATTCTGAGGTACTGGGG - Intergenic
1032757147 7:134901932-134901954 GGTCACATCCTGAGGTACTGGGG + Intronic
1033062171 7:138119672-138119694 GATCACATTCTGAGGTACTGGGG - Intergenic
1033094103 7:138414624-138414646 GGTCACATTCTGATGTACTGGGG + Intergenic
1033212271 7:139468797-139468819 GGTCACATTTTGAGGTACTGGGG - Intronic
1033249807 7:139748729-139748751 GGTCACATGCTGAAGTACTGGGG + Intronic
1033306032 7:140226372-140226394 GGTCACATTCTGAGGTACTGGGG + Intergenic
1033404630 7:141060853-141060875 GATCACATTCTGAGGAACTGAGG - Intergenic
1033454472 7:141490252-141490274 GGTCACATTCTCAGGTACTGAGG - Intergenic
1033463596 7:141569906-141569928 GCTCACACTCTGAAGCATTGTGG - Intronic
1033497507 7:141914245-141914267 GTTCACATTCTAAGGTACTGTGG - Intronic
1033592089 7:142817765-142817787 AGTCACATTCTGAGGTACTGAGG + Intergenic
1033837447 7:145332426-145332448 GATCACATCCTGAAATACTGGGG + Intergenic
1034191135 7:149214366-149214388 GGTCACATTCTGAAGTCCTGGGG + Intronic
1034196056 7:149248367-149248389 GATCACATCCTGAGGTACTGAGG + Intronic
1034362306 7:150510952-150510974 GGTCACATTCTCAAGTCCTAGGG - Intergenic
1034396957 7:150833652-150833674 AGTCACATTCTGAGGTACTAGGG + Intronic
1034403692 7:150886879-150886901 AGTCACATTCTGAAGAACTGGGG - Intergenic
1034445023 7:151109644-151109666 GGTCACATTCTGAGGTCCTGGGG + Intronic
1034542247 7:151765687-151765709 GGTCACATTCTGAGGTCCTGGGG + Intronic
1034566112 7:151917058-151917080 GGTCACATTCTGAGGTCCTGGGG + Intergenic
1034573618 7:151978918-151978940 GATCACATTCTGAGGTCCTGGGG + Intronic
1035086048 7:156258819-156258841 GGCCACATTCTGAGGTACTGAGG + Intergenic
1036399178 8:8393103-8393125 GGTCACATTCTGTAGCACTGGGG - Intergenic
1036524390 8:9521315-9521337 GGTCACATTCTGAGGTACTGGGG - Intergenic
1036811953 8:11873145-11873167 AGTCACATTCTGAGGTACTAGGG + Intergenic
1037006369 8:13785916-13785938 AGTCACATTCTGAGGTACTGAGG + Intergenic
1037069534 8:14626493-14626515 GTTCACAATCTGAAGAACTAGGG - Intronic
1037131752 8:15414905-15414927 GATCACATGCTGAAGTACTGAGG + Intergenic
1037215578 8:16447275-16447297 GGTCACATTCTGAGATACTGAGG - Intronic
1037535690 8:19821725-19821747 GGTCACATTCTGAGGTTCTGCGG + Intronic
1037851336 8:22331892-22331914 AGTCACATTCTGAGGTACTGGGG + Intronic
1038341923 8:26693403-26693425 AATCACATTCTGAAGTACTGGGG + Intergenic
1038566075 8:28621171-28621193 GGTCATATTCTGAGGTACTGGGG - Intronic
1038658664 8:29477443-29477465 GATCACATTCTGAGGTACTGTGG + Intergenic
1038730152 8:30119643-30119665 AGTCACATTCTGAGGTACTGGGG + Intronic
1038731991 8:30136170-30136192 AGTCACATTCTGAGGTACTGGGG - Intronic
1038869434 8:31478472-31478494 GGTCACATTCTGAGATACTGGGG + Intergenic
1039099361 8:33924314-33924336 GGTCACATTCTAAGGTACTGGGG + Intergenic
1039176477 8:34813289-34813311 GCTCACATTCTCAGGCACTGGGG - Intergenic
1039717648 8:40127546-40127568 TTTCACATTCTGAGGTACTGGGG + Intergenic
1039833545 8:41236991-41237013 GGTCATATTCTGAGGTACTGTGG + Intergenic
1039896635 8:41721094-41721116 GGTCACATTCTGAGGTCCTGGGG - Intronic
1040010450 8:42657078-42657100 AGTCACATTCTGAGGTACTGGGG + Intergenic
1040716191 8:50255795-50255817 TGTCACATTCTGAAGCACTGAGG + Intronic
1040822189 8:51573783-51573805 AGTCACATTCTGAGGTACTGGGG - Intronic
1040980829 8:53244839-53244861 AGTCACATTCTGAAGTACTGGGG - Intronic
1041081219 8:54216657-54216679 GGTCACATTCTGAGGTACAAAGG - Intergenic
1041119535 8:54571973-54571995 GGTCACATTCACAAGTACTGGGG + Intergenic
1041366539 8:57111895-57111917 GGTCTCATTCTGAGGTACTGGGG - Intergenic
1041391895 8:57354266-57354288 GCTCGCATTCTGAGGTACTGGGG + Intergenic
1041715479 8:60928143-60928165 AGTCACATTTTGAAGTACTGGGG + Intergenic
1042029277 8:64457135-64457157 GGTCACATACTGAAATACTGAGG + Intergenic
1042093000 8:65179198-65179220 GCTCATATTCTGAGATACTGGGG + Intergenic
1042100707 8:65272405-65272427 GGGCCCATTCTGAAGTACTGGGG + Intergenic
1042182773 8:66108506-66108528 AGTCACATTCTGAAGTACTAGGG + Intergenic
1042192204 8:66198403-66198425 AGTCACATTCTGAGGTACTGGGG - Intergenic
1042381256 8:68116768-68116790 AGTCACATTCTGAGGTACTAGGG + Intronic
1042485723 8:69343529-69343551 TGTCATATTCTGAAGTACTGGGG + Intergenic
1042737895 8:72009334-72009356 AGTCACATTCTGAAGTACCTTGG - Intronic
1043199627 8:77350433-77350455 GCTCACATTCTGTAGTACCGGGG + Intergenic
1043356398 8:79417583-79417605 TGTCACATTCTGAGGTACTAGGG + Intergenic
1043665722 8:82810311-82810333 GGTCACATTCTGAGGTACTAAGG - Intergenic
1043788477 8:84432588-84432610 GGTCACATTCTGAGGTACCAGGG - Intronic
1043950177 8:86300055-86300077 GGTCACATTTTGAGGTACTGGGG - Intronic
1043998983 8:86854804-86854826 GGTCATATTCTGAAGTACCAGGG + Intergenic
1044110213 8:88263784-88263806 GGTCACATTCTGGGGTACTGGGG + Intronic
1044361147 8:91285516-91285538 GATCACATTCTGAGGTACTCAGG + Intronic
1044364453 8:91326575-91326597 AGTCACATTCTGAAGTACTGGGG + Intronic
1044387086 8:91601894-91601916 AGTCACATTCTGAGGTACTAAGG + Intergenic
1044534026 8:93339207-93339229 GGTCTCATTCTGAAGTACTGGGG + Intergenic
1044543021 8:93429021-93429043 GCACAGATTCTGAAGTCCTGTGG - Intergenic
1044585735 8:93867908-93867930 GTTCATATTCTGAGGTACTGGGG - Intronic
1044785579 8:95788933-95788955 GGTCACATTCTGAGGTATTAGGG - Intergenic
1044898644 8:96920610-96920632 GATCACCTTCTGAGGTACTAGGG - Intronic
1045429149 8:102096974-102096996 AGTCACATTCTGAGGTACTGGGG + Intronic
1045548310 8:103148074-103148096 GGTCACATTCTGAGGTACCGGGG - Intronic
1045667432 8:104504280-104504302 GCTGACTTTCTGAAAAACTCAGG - Intronic
1045704094 8:104899985-104900007 GGTCACATTTTGAGGTACTGGGG + Intronic
1045736310 8:105299630-105299652 GGTCATGTTCTGAAGTACTGGGG + Intronic
1045754734 8:105529295-105529317 AGTCACATTCTGAGGTACTGGGG + Intronic
1045804290 8:106139056-106139078 GGTCACATTCTGAGGTCCTAGGG + Intergenic
1046837968 8:118824305-118824327 AATAACATTCTGAAGTACTAGGG - Intergenic
1047002240 8:120584692-120584714 GGTCACATTCTGAGGTACTGGGG - Intronic
1047372947 8:124271256-124271278 GATCACATTTTGAGGTACTGGGG - Intergenic
1047599837 8:126414903-126414925 AGTCACATTCTGAGGTACTGGGG + Intergenic
1047612870 8:126538249-126538271 AGTCACATTCTGAAATACTAGGG - Intergenic
1047619775 8:126594561-126594583 GATCACATTCTGAAGTACTGGGG - Intergenic
1047693138 8:127377019-127377041 GGTCACATTCTAAAGTATTGGGG - Intergenic
1047716167 8:127597141-127597163 GTTCACGTTCTGGAGTACTGGGG - Intergenic
1047786079 8:128154930-128154952 AGTCACATTCTGAAGTACTGGGG + Intergenic
1048084991 8:131167665-131167687 GGTCACATTCTGAGATACTAAGG - Intergenic
1048184908 8:132230893-132230915 CCTCACATTCTGAGGTACTGTGG - Intronic
1048270611 8:133025307-133025329 GCTCACATCCTGAAGCACAAAGG + Intronic
1048696506 8:137034511-137034533 AATCACATTGTGAAGTACTTGGG - Intergenic
1048768894 8:137874016-137874038 GGTCACATGCTGATGTACTGGGG - Intergenic
1048921699 8:139237316-139237338 GGGCACATTCTGAGGTACTGAGG - Intergenic
1049045969 8:140151653-140151675 GATCACATTCTGAGGTGCTGAGG + Intronic
1049068503 8:140338525-140338547 GGTCACATTCTGAGGTGCTGGGG - Intronic
1049176015 8:141193202-141193224 GCTCACATTCTGAGGTTCAGAGG + Intronic
1049699169 8:144000171-144000193 GGTCACACTCTGAGGTACTGGGG - Intronic
1050021990 9:1293869-1293891 GGTCATATTCTCAAGTACTGGGG - Intergenic
1050032399 9:1400389-1400411 AGTCTCATTCTGAGGTACTCGGG + Intergenic
1050078434 9:1889395-1889417 GGTCACATTCAGAGGTACTGGGG - Intergenic
1050139202 9:2499938-2499960 GATCACATTCTGAGGTACTGAGG - Intergenic
1050146320 9:2571875-2571897 AGTCACATTCTGAAATACTAGGG + Intergenic
1050285708 9:4099581-4099603 TGTCACATTCTGAGGTACTGGGG + Intronic
1050513584 9:6419124-6419146 AGTCACATTCTGAGGTACTGGGG + Intronic
1050513594 9:6419267-6419289 GGTCACATTCTCAAGTACCATGG + Intronic
1050631082 9:7559529-7559551 AGTCACATTCTGAAGTACTAGGG - Intergenic
1051113933 9:13673013-13673035 GGTCACATTCTGAGGTACTGGGG + Intergenic
1051472384 9:17459876-17459898 AGTCACATTCTAAAGTACTGAGG + Intronic
1051588195 9:18749152-18749174 GGTCACATTCTGAGGTACTAAGG + Intronic
1051621719 9:19057156-19057178 GGTCACATTCTGAGGTACTGGGG - Intronic
1051656409 9:19386022-19386044 AGTCACATTCTGAGGTACTGAGG + Intergenic
1051667043 9:19475366-19475388 AGTCACATTCTGAAGTACAGGGG + Intergenic
1051778173 9:20658886-20658908 AGTCACATTCTGAGGTACTAGGG - Intronic
1052269470 9:26612917-26612939 GTTCACATTCTGAGGAACTGGGG - Intergenic
1052752164 9:32502961-32502983 AATCACATTCTGAAGTACTGGGG + Intronic
1053006078 9:34605505-34605527 AGTCACATTCTGAGGTACTGGGG - Intergenic
1053328940 9:37185824-37185846 GGTCACATTCAGAAGTTCTTGGG + Intronic
1054757715 9:68975966-68975988 GGTCACATTCTGAGGTACTGGGG + Intronic
1054772364 9:69094758-69094780 GGTCACATTCTGAGGTATTAGGG + Intronic
1054968416 9:71056541-71056563 AGTCACATTCTGCAGTACTAGGG - Intronic
1054981526 9:71211849-71211871 GGTCACGTTCTGAGGTACTGTGG + Intronic
1055161038 9:73128460-73128482 AGTCACATTCTGATGTACTGTGG + Intergenic
1055167691 9:73217710-73217732 GGTCACATTCTGAGGTACTGGGG - Intergenic
1055330383 9:75177526-75177548 AGTCACATTCTGAGGTACTCGGG + Intergenic
1055726564 9:79236731-79236753 GGTCACATTCTGAAGTACCAGGG + Intergenic
1055736674 9:79337743-79337765 GGTCACATTCTGAGGTACTCAGG - Intergenic
1055902125 9:81252687-81252709 AGTCACATTCTGAAGTACTGAGG - Intergenic
1055962774 9:81836133-81836155 ACTCACATTCAGAGGTACTTGGG - Intergenic
1056047865 9:82738158-82738180 GGTCACATTCTGAGCTACTGGGG + Intergenic
1056055465 9:82818278-82818300 GCTAACATTCTGCAGTTTTCTGG - Intergenic
1056077455 9:83055959-83055981 TCTCACCTTCTTAAATACTCAGG - Intronic
1056179594 9:84069212-84069234 AGTCACATTCTGAGGTACTGGGG + Intergenic
1056879666 9:90379288-90379310 AGTCGCATTCTGAAGTACTAGGG - Intergenic
1057530030 9:95837070-95837092 AGTCACATTCTGAAGTACTGGGG + Intergenic
1057777508 9:98022774-98022796 AATCACATTCTGAGGTACTAGGG + Intergenic
1057835665 9:98442984-98443006 GGTCACATTCTGAGCTACTGTGG + Intronic
1058217000 9:102246939-102246961 AGTCACATTCTGAGGTACTGGGG + Intergenic
1058601071 9:106670909-106670931 GGTCACATTCTGAGGTGCTGGGG + Intergenic
1058662072 9:107275723-107275745 GGTCACATTCTGAGGTGCTGGGG - Intergenic
1058680267 9:107434582-107434604 GGTCACATTCTCAGGTACTGAGG + Intergenic
1058883104 9:109302462-109302484 AGTCACATTCTGAGGTACTGGGG + Intronic
1059130666 9:111745457-111745479 AGTCACATTCTGAGGTACTGAGG - Intronic
1059400268 9:114065197-114065219 GGTCACATTCTGAGGTTCTGGGG - Intronic
1059498788 9:114732572-114732594 AGTTACATTCTGAAGTACTGGGG - Intergenic
1059621746 9:116013259-116013281 GTTCACATTCTGAGGTATTAAGG + Intergenic
1059754945 9:117284060-117284082 CACCACATTCTGAAGTACTGAGG - Intronic
1059830566 9:118090702-118090724 AATCACATTCTGAGGTACTATGG - Intergenic
1060050958 9:120377782-120377804 GGTCACATTCTGAGGTACTAGGG + Intergenic
1060141920 9:121217657-121217679 AGTCACATTCTGAGGTACTGGGG + Intronic
1061094611 9:128448369-128448391 GGTCACATTCTGAGGTACTGGGG - Intergenic
1061240986 9:129372264-129372286 AATCACATTCTGAAGTAGTGGGG + Intergenic
1061410880 9:130420817-130420839 GGTCACATTCTGAGGTCCTGGGG + Intronic
1061614197 9:131768697-131768719 ACTCATATTCTGAGGTACTGGGG + Intergenic
1061977862 9:134080923-134080945 AGTCACATTCTGAGGTACTGAGG - Intergenic
1062292099 9:135800354-135800376 AATCACATTCTGACGTCCTCAGG - Intergenic
1062530769 9:136998671-136998693 GGTCACATTCTGAGGCACTAGGG - Intergenic
1185721801 X:2388305-2388327 GATCACATTCTGAAGTCCTAGGG - Intronic
1185869590 X:3652722-3652744 AGTCACATTCTGAAGTTCTGGGG - Intronic
1185945635 X:4372698-4372720 GGTCACATAATGAAGTACTAGGG + Intergenic
1186077869 X:5900177-5900199 GCTCACATACTGAGATACTGGGG - Intronic
1186422684 X:9438952-9438974 ATTCACATTCTGAAGTACCAGGG + Intergenic
1186513739 X:10150442-10150464 AGTCACATTCTGAGGTACTGGGG + Intergenic
1186610112 X:11130695-11130717 GATCACATTCACAAGTACTGGGG + Intergenic
1186897422 X:14017849-14017871 GGTCACATTCTGAGGAACTGGGG + Intronic
1186940540 X:14502073-14502095 AGTCACATTCTGAGGTACTGGGG + Intergenic
1187049041 X:15678006-15678028 GGTCACATTCTGAGGTACTGGGG - Intergenic
1187186475 X:16991562-16991584 GGTCACATTCTGAGGTACTAAGG - Intronic
1187329011 X:18318897-18318919 CATCACATTCTGAGGTACTGGGG - Intronic
1187424913 X:19168622-19168644 GGTTACATTCTGAGGTACTCGGG - Intergenic
1187448440 X:19377003-19377025 GGTCACATTCTGAGGTACTGGGG + Intronic
1187548197 X:20274163-20274185 GGTCACATTCTGAAGTACTGAGG - Intergenic
1187682577 X:21782554-21782576 GGTCACATTCTGAGGTACTGAGG - Intergenic
1187892001 X:23945237-23945259 GGTCACATTCTAAAGTACTGGGG - Intergenic
1187928845 X:24275647-24275669 GGTCACATTCTGAGGTACTGGGG - Intergenic
1188113789 X:26220727-26220749 AGTCACATTCTGAGGTACTGGGG + Intergenic
1188379464 X:29473331-29473353 GATCACATTCTGAGGTACTAGGG + Intronic
1188513397 X:30960179-30960201 TCTCAGACTCTGAAGTACTGTGG - Intronic
1188569375 X:31563890-31563912 GGTCACATTCTGAGGTACCAGGG - Intronic
1189136770 X:38558667-38558689 GATCACATTCTGAGGTACTGGGG + Intronic
1189211836 X:39290383-39290405 GGTCACATTCTGAGGTACTGGGG + Intergenic
1189302778 X:39964591-39964613 GGTCACATTCTGAGGTATTAGGG + Intergenic
1189312497 X:40029695-40029717 GGTCACATTCTGATGTACTGGGG - Intergenic
1189563325 X:42213693-42213715 AGTCACATTCTGAGGTACTGAGG + Intergenic
1189641347 X:43075384-43075406 CCTCACATTTTGCAGAACTCAGG + Intergenic
1189663987 X:43333330-43333352 GCTCAGATTCTGAAGCTCTATGG + Intergenic
1189714718 X:43853555-43853577 GGTCACATTCTGAGGTCCTAGGG - Intronic
1189743958 X:44150833-44150855 GGTCACATTCTGAGGTACTAGGG - Intronic
1190009819 X:46774850-46774872 AGTCACATTCTGAGGTACTAGGG + Intergenic
1190146390 X:47895170-47895192 GGTCACATTCTGAAGTATCGAGG - Intronic
1190224169 X:48532969-48532991 AGTCACATTCTGAAGTATTGGGG + Intergenic
1190251963 X:48733635-48733657 GGTCACATTCTGAGGTACTGGGG - Intergenic
1190253479 X:48745180-48745202 ACTCACATTCTGAAGTACTAGGG + Intergenic
1190430532 X:50374122-50374144 GGTCACATTCTGATGTACTGGGG - Intronic
1190622942 X:52306273-52306295 AGTCACATTCTGAGGTACTAGGG + Intergenic
1190792192 X:53710862-53710884 AGTCACATTCTGAGGTACTAGGG - Intergenic
1190872570 X:54436894-54436916 AGTCACATTCTGAGGTACTGGGG + Intergenic
1193146939 X:78086284-78086306 GGTCACATTCTGAGATACTGGGG - Intronic
1193473060 X:81930045-81930067 GGTTACATTCTGAAGTAATGGGG + Intergenic
1193589791 X:83375092-83375114 AATCACATTCTGAGGTACTGGGG - Intergenic
1193751374 X:85349455-85349477 GGTCACATTCTGAGTTACTGGGG - Intronic
1194458226 X:94130993-94131015 AGTCACATTCTGAAGTACTGAGG + Intergenic
1194458305 X:94132386-94132408 AGTCACATTCTGAAGTACTGAGG - Intergenic
1194464140 X:94210969-94210991 GCTCAAATTATGAAGTTTTCAGG - Intergenic
1194759195 X:97774075-97774097 AGTCACATTCTGAGGTACTGGGG + Intergenic
1195612805 X:106888043-106888065 GGTCACATTCTGAGTTACTGGGG - Intronic
1195655740 X:107329884-107329906 AGTCACATTCTGAAGTACTGGGG - Intergenic
1195715118 X:107811005-107811027 GGTCACATTCTGAGGTTCTGGGG + Intergenic
1195843527 X:109201463-109201485 GGTCACATTCTGAGGTACTGGGG - Intergenic
1196276832 X:113776119-113776141 GATCACATTTTGAAGTACTGGGG - Intergenic
1196654060 X:118198671-118198693 GGTCACATTCAGAGGTACTGGGG - Intergenic
1196661345 X:118273541-118273563 CATCACATTCTGAACTACTGGGG - Intergenic
1196701135 X:118670046-118670068 GGTCACATTCTGAGGTACTTGGG + Intronic
1197231249 X:124006106-124006128 GGTCATATTCTGAGGTACTGGGG + Intronic
1197401174 X:125992665-125992687 ATTCATATTCTGAAGTACTAGGG + Intergenic
1197443151 X:126514559-126514581 AGTCACATTCTGAAGTATTGGGG + Intergenic
1197449825 X:126598427-126598449 TCACACATTCTGAAGTATTTGGG - Intergenic
1197681154 X:129386755-129386777 GGTCACATTCTGAGGTACTAAGG - Intergenic
1198055276 X:132988283-132988305 GCCCATAGTCTGAACTACTCGGG + Intergenic
1198406265 X:136315672-136315694 GATCATATTCTGAGGTACTGAGG - Intronic
1198419784 X:136459645-136459667 GGTCACATTCACAAGTACTGAGG - Intergenic
1198487943 X:137107065-137107087 AGTCACATTCTGAAGTACTGGGG - Intergenic
1198706138 X:139450531-139450553 GGTCACATTCAAAAGTACTGGGG - Intergenic
1198874403 X:141207574-141207596 GGTCACATTCTGAGGTACTGGGG - Intergenic
1198895086 X:141444798-141444820 ATTCGCATTCTGAAGTACTGTGG + Intergenic
1199161420 X:144616706-144616728 GGTCACATTCTGAAATACTGGGG - Intergenic
1199323881 X:146474656-146474678 AGTCACGTTCTGAAGTACTTGGG - Intergenic
1199532903 X:148869971-148869993 GACCACATTCTGAAATACTGGGG + Intronic
1199694231 X:150332133-150332155 AGTCACATTCTGAGGTACTGGGG - Intergenic
1199778073 X:151033210-151033232 CATCACATTCTGATGTACTGGGG + Intergenic
1199813754 X:151377938-151377960 AATCACATTCTGAGGTACTGGGG + Intergenic
1199845776 X:151692279-151692301 GATCACATTCTGGAGTACTGGGG + Intergenic
1199903864 X:152205144-152205166 GGTCACATTTTGCAGTACTGGGG + Intronic
1199936203 X:152575989-152576011 AGTTACATTCTGAAGTACTTGGG + Intergenic
1199964884 X:152811606-152811628 AGTCACATTCTGAGGTACTAGGG - Intergenic
1199999739 X:153053072-153053094 GGTCACATTCTGAGGTGCTAAGG + Intergenic
1200050935 X:153431342-153431364 GATCACATTCTGAGGTACTGGGG - Intergenic
1200180686 X:154148696-154148718 GGTCACATTCTGAGGTATTGGGG + Intronic
1201223831 Y:11797219-11797241 AGTCACATTCTAAAGTACTCAGG + Intergenic
1201720632 Y:17093144-17093166 GGTCACATTCTGAGGTGCTAGGG + Intergenic
1201895430 Y:18987367-18987389 GCCTATATTCTGAACTACTCAGG - Intergenic