ID: 1138528097

View in Genome Browser
Species Human (GRCh38)
Location 16:57620373-57620395
Sequence CCTAGCACCGGGAAGCTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 132}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138528092_1138528097 2 Left 1138528092 16:57620348-57620370 CCGGGCATGCTGGCATGGTGGTC 0: 1
1: 0
2: 7
3: 34
4: 241
Right 1138528097 16:57620373-57620395 CCTAGCACCGGGAAGCTGGCAGG 0: 1
1: 0
2: 1
3: 14
4: 132
1138528084_1138528097 24 Left 1138528084 16:57620326-57620348 CCCCTTGCAGTGCACAGCATGGC 0: 1
1: 0
2: 2
3: 23
4: 197
Right 1138528097 16:57620373-57620395 CCTAGCACCGGGAAGCTGGCAGG 0: 1
1: 0
2: 1
3: 14
4: 132
1138528085_1138528097 23 Left 1138528085 16:57620327-57620349 CCCTTGCAGTGCACAGCATGGCC 0: 1
1: 0
2: 3
3: 24
4: 189
Right 1138528097 16:57620373-57620395 CCTAGCACCGGGAAGCTGGCAGG 0: 1
1: 0
2: 1
3: 14
4: 132
1138528086_1138528097 22 Left 1138528086 16:57620328-57620350 CCTTGCAGTGCACAGCATGGCCG 0: 1
1: 0
2: 4
3: 30
4: 211
Right 1138528097 16:57620373-57620395 CCTAGCACCGGGAAGCTGGCAGG 0: 1
1: 0
2: 1
3: 14
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138528097 Original CRISPR CCTAGCACCGGGAAGCTGGC AGG Intronic
900117497 1:1034798-1034820 CCCATCCCCGGGAAGCTGCCGGG - Intronic
900406097 1:2493653-2493675 CAGAGCACAGGGAGGCTGGCGGG + Intronic
901642845 1:10701779-10701801 CCTAGGACCAGGCAGCTGACGGG + Intronic
904535853 1:31198918-31198940 CCTAGCTCCAGGAAGCTGGCTGG + Intronic
905525742 1:38637817-38637839 CCTAGCACCTGAAAGATGGTAGG - Intergenic
905960883 1:42041194-42041216 CCTGGCATCGTGAAGCAGGCAGG + Intergenic
909163489 1:72185090-72185112 CCTGGCACCTGGAACATGGCAGG + Intronic
909659773 1:78069008-78069030 CCTAGCACCGGGAGTCTTGCAGG + Intronic
915457950 1:156053316-156053338 CCTTGCACCGGGAAGGGGGAAGG - Intronic
915992333 1:160530190-160530212 CCTAGCCAAGGGAAGCTGGGAGG - Intergenic
917157883 1:172024716-172024738 CCTAGCAAAGAGAAGCTGGGAGG + Intronic
1069665367 10:70152232-70152254 CCTGGGACTTGGAAGCTGGCAGG - Exonic
1070743692 10:78919747-78919769 TCAGGCACCGGGAAACTGGCAGG - Intergenic
1070804913 10:79265266-79265288 CCCAGCACAGGGAAGCAGGTAGG + Intronic
1071503988 10:86222058-86222080 CCAAGAACCCTGAAGCTGGCAGG + Intronic
1072089322 10:92111662-92111684 CCTAGGATGGGGAAGCTGGAGGG + Intronic
1073025478 10:100484285-100484307 CCTAGGGCAAGGAAGCTGGCTGG - Intergenic
1073177371 10:101564729-101564751 CGGAGCACCAGGAACCTGGCTGG - Intergenic
1075279778 10:121129605-121129627 CCTGGCTCCGGGAACCTGGAGGG - Intergenic
1077660717 11:4066168-4066190 GCTAACCCAGGGAAGCTGGCTGG - Intronic
1080388505 11:31824286-31824308 CCTAGCACCTGCAGGCTGGGGGG - Intronic
1082842212 11:57698956-57698978 CCCAGCAACGGGAAGCTGAGAGG + Exonic
1085318267 11:75559120-75559142 CCTGGCACGTGGAGGCTGGCTGG - Intergenic
1085388896 11:76172249-76172271 GCTTTCACCGGGAAGCGGGCTGG - Intergenic
1089653885 11:119933104-119933126 TCCAGCTCCGGGAAGCTGGCTGG - Intergenic
1090646007 11:128767096-128767118 CCTGGCGCCCTGAAGCTGGCTGG - Intronic
1101876637 12:108600365-108600387 CCTACTACTCGGAAGCTGGCAGG + Intergenic
1103253921 12:119523877-119523899 CCCAGCACCTGGCACCTGGCAGG - Intronic
1103256439 12:119545404-119545426 CTTAGAACCTGGAAGCTGGGAGG - Intergenic
1106283069 13:28294633-28294655 CCTTGCACAGGGAAGTTTGCTGG - Intronic
1110531424 13:76603007-76603029 CCCATCACCCGGAAGCTGGATGG + Intergenic
1111987346 13:95078512-95078534 CTTTGCACTGGGAAGGTGGCAGG + Intronic
1117351356 14:54884873-54884895 GCTAGCCCCAGGAAGGTGGCTGG + Intronic
1119748111 14:77058869-77058891 CCTATCCTCGGGAAGCTGTCAGG + Intergenic
1121536017 14:94691211-94691233 ACTAACACCGGGACTCTGGCCGG - Intergenic
1122719202 14:103712745-103712767 TCAAGCAGCGGGACGCTGGCAGG + Intronic
1124031420 15:26015852-26015874 TCCACCAGCGGGAAGCTGGCCGG - Intergenic
1129705990 15:77794929-77794951 CCTCACACTGGGAAGCTGGTGGG - Intronic
1130543959 15:84841095-84841117 CCTGGCATCTGGAAACTGGCTGG - Intronic
1132483977 16:180856-180878 CCGCTCACCTGGAAGCTGGCCGG - Exonic
1134132854 16:11661377-11661399 CCAAGCACCGGAAACGTGGCTGG + Intergenic
1138528097 16:57620373-57620395 CCTAGCACCGGGAAGCTGGCAGG + Intronic
1139440071 16:66962160-66962182 CCGGGTACCAGGAAGCTGGCTGG - Intronic
1139854884 16:69972374-69972396 CCAAGCACCTGGAAGCGGGCTGG + Intergenic
1139883879 16:70195268-70195290 CCAAGCACCTGGAAGCGGGCTGG + Intergenic
1140055824 16:71524784-71524806 CCTAGCACGGGAAAGATGGCAGG + Intronic
1140368637 16:74400230-74400252 CCAAGCACCTGGAAGCGGGCTGG - Intergenic
1142967576 17:3590906-3590928 CGCAGCACCGGGAAGCAGGGGGG - Intronic
1144407116 17:14962764-14962786 CCTGGCACCTAGGAGCTGGCTGG + Intergenic
1146723192 17:35137603-35137625 CCAAGCACAGGGAAGCAGGTGGG - Exonic
1152279277 17:79375818-79375840 CCAGGCACCCGGAAGCAGGCAGG - Intronic
1152689809 17:81712744-81712766 CCGAGAACTGGGAAGCCGGCTGG - Intronic
1153263789 18:3248023-3248045 CCCAGAACCGGGGACCTGGCTGG - Intronic
1154252416 18:12755695-12755717 CCTGCCACCAGGTAGCTGGCTGG + Intergenic
1157719129 18:49910095-49910117 CCGAGCACTGAGAAGCAGGCAGG + Intronic
1161571526 19:5033253-5033275 CCTGGCTCCAGGGAGCTGGCAGG + Intronic
1161682799 19:5688355-5688377 CCCAGCTAGGGGAAGCTGGCAGG - Exonic
1161686645 19:5706020-5706042 CCTGGCTCCGGGAAGCTGGGTGG + Intronic
1161861516 19:6801678-6801700 CCCAGCACCAGGGAGCCGGCCGG - Intronic
1163767654 19:19172304-19172326 CCCAGCAGAGCGAAGCTGGCTGG + Intronic
1164595287 19:29527810-29527832 CCGAGTACCGGAAAGCCGGCAGG + Intronic
1165068137 19:33240796-33240818 GCTTGCGCGGGGAAGCTGGCAGG - Intergenic
1166701725 19:44886065-44886087 CCTGGCAGGGAGAAGCTGGCTGG + Intronic
1167008026 19:46787986-46788008 CTTAGCGCCTGGAAGCTGGCTGG + Exonic
929650730 2:43677797-43677819 TCCCGCACCGGGCAGCTGGCTGG + Intronic
933356627 2:81218319-81218341 CCTGGCAGCAGGAAGGTGGCGGG - Intergenic
935090817 2:99893172-99893194 CCCAGCACCAGGGAGCAGGCAGG - Intronic
936349760 2:111703779-111703801 CCTGGCACAGGGAAGGTGCCGGG - Intergenic
940005160 2:149003393-149003415 CCTGGCCCCGGGCAGCTGACTGG + Intronic
940330058 2:152464941-152464963 CCTAGCAGAGGGAAGCTAGATGG - Intronic
946341705 2:219073757-219073779 CCCAGCCCCGGGGAGCGGGCGGG + Intergenic
947069473 2:226271127-226271149 GCTAGGATCGGGAAGCTGACTGG - Intergenic
948454988 2:238100733-238100755 CCTGGCTCCACGAAGCTGGCTGG + Intronic
948465066 2:238148334-238148356 CCCAGCACCTGGCAGCTGCCTGG + Intronic
948716280 2:239865521-239865543 CCGAGCGCCGGGAAGACGGCCGG + Intergenic
1169258829 20:4120484-4120506 CCAAGCCCCTGGAATCTGGCTGG - Intergenic
1171346785 20:24471168-24471190 CCTAGCACGGAGAAGTTGGCCGG - Intronic
1171464365 20:25317386-25317408 CTTGGCACAGGGAAGCTGGGAGG - Intronic
1173850660 20:46215913-46215935 CCTGGCACCGGGAAGCCGGTTGG + Intronic
1173898899 20:46572391-46572413 CCCAGCCCTGGGCAGCTGGCCGG - Intronic
1180194998 21:46188589-46188611 CCCAGCACCGAGAAGCCGACGGG + Exonic
1182277048 22:29196194-29196216 CCCAGCCCCGGGAAGCTGTGAGG - Intergenic
1182437630 22:30340913-30340935 CTTAGCACATGGACGCTGGCTGG - Intronic
1183453891 22:37911115-37911137 CCCAGCACGGGACAGCTGGCTGG - Intronic
1184766020 22:46573023-46573045 CCTGGCACCGGGTTGCTGCCAGG - Intergenic
1185315698 22:50178317-50178339 CCTGGCTCCGGGAGGCGGGCAGG - Exonic
949246016 3:1925917-1925939 CCTGTCACCGGGTAGCTAGCTGG - Intergenic
952918559 3:38267899-38267921 CCTGGCAGCAGGAAGCAGGCAGG + Intronic
952954622 3:38549377-38549399 CCTTGCTCCTGGAACCTGGCAGG - Exonic
955653790 3:61222342-61222364 CCTACCACCAGGGAGGTGGCCGG + Intronic
960943350 3:122948678-122948700 CCTAGCTCCGGGAGGCAGACAGG + Exonic
961551063 3:127670972-127670994 CCTGGCATCAGGAAGCTGACTGG + Intronic
962731636 3:138289168-138289190 TCTTGCACAGGGAAGCTAGCAGG + Intronic
964679092 3:159317925-159317947 CCTGCCACCAGGTAGCTGGCTGG + Intronic
966871345 3:184292125-184292147 CCCAGCACGCGGAAGCGGGCAGG - Exonic
967828447 3:193897812-193897834 CCCAGCTCCTGGAAGCTGACAGG + Intergenic
969121350 4:4913717-4913739 CCTAGCATGGGGAAGCTGCTGGG + Intergenic
969251396 4:5970848-5970870 CCTAGCAGCAGGATGCTGGGAGG + Intronic
969376876 4:6768814-6768836 CCTTGCACCGAGGAGCAGGCAGG - Intergenic
971242090 4:24898416-24898438 ACTTGAGCCGGGAAGCTGGCCGG + Intronic
972150443 4:36082967-36082989 CCAAGCATCAGGAAGCTGGAGGG + Intronic
977753019 4:100632337-100632359 CCTGCCACTGGGTAGCTGGCTGG + Intronic
979530472 4:121764809-121764831 CCCCGCACCTGGAAGCTGGGAGG + Exonic
982281015 4:153684017-153684039 CCTTGCACGGGGCAGCTGTCGGG + Intergenic
985774523 5:1833887-1833909 CCTAGGACCAGGGAGGTGGCAGG + Intergenic
985878553 5:2619566-2619588 CTTAGCAGCTGGAAGTTGGCTGG - Intergenic
987188083 5:15445353-15445375 CCTAGAAGCTGGAAGCAGGCAGG + Intergenic
987456167 5:18149850-18149872 CCCAGCACAGGAATGCTGGCAGG + Intergenic
988480000 5:31621605-31621627 CCTGGCACATGGAAGCTGGGTGG - Intergenic
991968627 5:72116498-72116520 CATAGCCCCAGGAAGGTGGCTGG - Intronic
992565308 5:77990280-77990302 CCTTGCACAGGGAACCTGCCAGG + Intergenic
995357665 5:111257997-111258019 CCTAGCACGGGGAGGGTGTCGGG + Intronic
998007308 5:138665550-138665572 CTTAGCACCTGGAGGCTGGAAGG + Intronic
1000280985 5:159781940-159781962 CCAACCACAGGGATGCTGGCTGG + Intergenic
1001540058 5:172531555-172531577 CTTAGCAGCTGGAAGCTGGAGGG + Intergenic
1002307737 5:178293685-178293707 TCTGGCATGGGGAAGCTGGCAGG + Intronic
1006066899 6:31468611-31468633 CCTACAACAGGGAAGCTGGCTGG - Intergenic
1007280744 6:40710505-40710527 ACTGGTACCGGGAATCTGGCAGG + Intergenic
1007782072 6:44260139-44260161 CCCTGCACCTGGCAGCTGGCCGG - Exonic
1017339324 6:153302231-153302253 GCTGGCACCGGCAGGCTGGCAGG - Intergenic
1017529166 6:155270658-155270680 TCTAGCATAAGGAAGCTGGCTGG - Intronic
1019777160 7:2918631-2918653 CCAAGCACCGGGAAGCCAGCGGG + Intronic
1020074191 7:5246975-5246997 GCTAACACAGTGAAGCTGGCCGG - Intergenic
1020281737 7:6653424-6653446 CCCAGGATCGGGAAGCTGTCCGG - Exonic
1021446140 7:20735735-20735757 CCTTGCAGTGGAAAGCTGGCTGG - Intronic
1022260037 7:28695347-28695369 CCTGGCACCAGGAAGCTCACTGG - Intronic
1023789031 7:43737436-43737458 CCTGGCTCCAGGAAGCAGGCAGG + Intergenic
1025204901 7:56986835-56986857 GCTAACACAGTGAAGCTGGCAGG + Intergenic
1025667037 7:63590100-63590122 GCTAACACAGTGAAGCTGGCAGG - Intergenic
1029448304 7:100626980-100627002 CCTAGCATGGGGAAGGGGGCTGG + Intronic
1032182467 7:129692093-129692115 CCTGCCACCGGGAGGGTGGCAGG - Intronic
1034224425 7:149471732-149471754 TCCAGCACATGGAAGCTGGCTGG - Intergenic
1034567198 7:151924633-151924655 CCTAGGAGAGGGCAGCTGGCTGG - Intergenic
1035920590 8:3671720-3671742 CCCAGCACCGGCAGGCTGCCTGG + Intronic
1038249542 8:25890310-25890332 CCCAGCATTGGGATGCTGGCTGG + Intronic
1049480852 8:142821791-142821813 CCTAACACTGGGACCCTGGCAGG + Intergenic
1050091011 9:2016489-2016511 CCTAGCACCCGGACGATCGCAGG - Intronic
1054987653 9:71281041-71281063 CCCAGCACCTGGAAAGTGGCTGG + Intronic
1059061593 9:111038870-111038892 CCCAGCGCCGGACAGCTGGCAGG + Intergenic
1059437655 9:114286190-114286212 CCTAGCACCGTCCAGCTTGCGGG - Intronic
1060055521 9:120409671-120409693 CCTAGCACCAGGAGGCCGGCAGG + Intronic
1061147432 9:128808149-128808171 TCTGGCACTGGGAGGCTGGCAGG + Exonic
1061596663 9:131634904-131634926 CCTAGCACCTGGATGCTGGGGGG - Intronic
1062320857 9:135989986-135990008 CCTGGCACCGGGCTGCTCGCCGG - Intergenic
1062377430 9:136268465-136268487 TCTAGCACCAAGGAGCTGGCAGG + Intergenic
1190115765 X:47625524-47625546 CCTAGGTCCAGGAAGCTGACTGG - Intronic
1195782211 X:108478888-108478910 CCTGCCACCAGGTAGCTGGCTGG + Intronic
1197971576 X:132120380-132120402 CCCAGCACCAGGCAGCAGGCAGG + Intronic