ID: 1138528528

View in Genome Browser
Species Human (GRCh38)
Location 16:57622428-57622450
Sequence CAGGAGCCACACTCGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 5, 3: 24, 4: 177}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138528514_1138528528 24 Left 1138528514 16:57622381-57622403 CCTCCAGACAAGGCTGCTTCTAG 0: 1
1: 0
2: 3
3: 25
4: 178
Right 1138528528 16:57622428-57622450 CAGGAGCCACACTCGGAGGAGGG 0: 1
1: 0
2: 5
3: 24
4: 177
1138528522_1138528528 -6 Left 1138528522 16:57622411-57622433 CCAGGTAGGGATCATCCCAGGAG 0: 1
1: 0
2: 1
3: 20
4: 129
Right 1138528528 16:57622428-57622450 CAGGAGCCACACTCGGAGGAGGG 0: 1
1: 0
2: 5
3: 24
4: 177
1138528515_1138528528 21 Left 1138528515 16:57622384-57622406 CCAGACAAGGCTGCTTCTAGCTG 0: 1
1: 0
2: 0
3: 15
4: 117
Right 1138528528 16:57622428-57622450 CAGGAGCCACACTCGGAGGAGGG 0: 1
1: 0
2: 5
3: 24
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138528528 Original CRISPR CAGGAGCCACACTCGGAGGA GGG Intronic
900256018 1:1698507-1698529 CCGGCCCCACACTCGGTGGATGG + Intronic
900264686 1:1751117-1751139 CCGGCCCCACACTCGGTGGATGG + Intergenic
900347094 1:2215105-2215127 CGGGAGTCCCACTAGGAGGAGGG + Intergenic
900417949 1:2543627-2543649 CAGGAGCCACAGGCGAGGGAGGG - Intergenic
900567330 1:3339956-3339978 GAGGAGGCACGCTCGGGGGATGG - Intronic
901645077 1:10712606-10712628 CGGGAGCCCCACTCGGATGGTGG - Intronic
905284152 1:36868378-36868400 CAGGAGCCATGCTGGGAGAAAGG - Intronic
906296532 1:44652195-44652217 CAGTAGCTACACTGGGATGATGG - Intronic
907728976 1:57047513-57047535 CCAGATCCACACTCTGAGGAAGG + Intronic
908153653 1:61329926-61329948 CCTGAGCCACAGTCGCAGGAGGG + Intronic
910777895 1:90893900-90893922 CAGGAGTCACACGTGGAGGCCGG - Intergenic
913995896 1:143651815-143651837 CAAGAGCCACGCTAGGAGGCAGG + Intergenic
914923222 1:151861265-151861287 CAGGAGCCACAGCCATAGGAAGG - Intergenic
915141432 1:153770939-153770961 CAGGAGCTGCCCTCGGAGGTGGG + Intronic
915530516 1:156500120-156500142 CCGGAGACCCCCTCGGAGGATGG + Intronic
918161234 1:181902049-181902071 CAGCTGGCACACTGGGAGGATGG + Intergenic
920853775 1:209647286-209647308 AGGAAGCCACACTTGGAGGAAGG + Intronic
1063396399 10:5692439-5692461 CAGTAACCCCACTAGGAGGATGG - Intronic
1067053472 10:43038360-43038382 AAGCATCCACACTCTGAGGAGGG + Intergenic
1067156584 10:43786080-43786102 CAGGAGCCTCACTCTGAGGACGG + Intergenic
1067278556 10:44854757-44854779 CAGGATCCACACTGGAGGGAGGG - Intergenic
1069557532 10:69407778-69407800 CAGGGGCCAGGCTCTGAGGAGGG - Intronic
1072617957 10:97062326-97062348 CAAGAGCCTCACACTGAGGAGGG + Intronic
1073124920 10:101143186-101143208 CAGGCGCCTCACGGGGAGGAAGG - Intergenic
1075926425 10:126255019-126255041 CAGGGGCCACCCTCGGAGCACGG + Intronic
1076353175 10:129832568-129832590 CAGGAGACCCACTGGGAGGCTGG + Intergenic
1083185858 11:61017529-61017551 CAGATGCCACCCTTGGAGGAAGG + Exonic
1084465278 11:69319723-69319745 CAGCAGTCACACTTGGAGCAAGG - Intronic
1084960022 11:72711571-72711593 CAGAAGCCACACTCAGAGTGAGG + Intronic
1090272535 11:125398115-125398137 CTGGAGCCACGCGTGGAGGAAGG + Intronic
1096434097 12:51573576-51573598 CAGGAGCTTCACTCTGAGGCAGG + Intergenic
1102492425 12:113297330-113297352 CAGGAGCCGCAGTGGCAGGATGG + Exonic
1102960907 12:117092669-117092691 GAGGAGCCACTGTCTGAGGAGGG + Intronic
1103797018 12:123510184-123510206 CAGGACCCACAGCCGGAGGCAGG - Intronic
1106151278 13:27105252-27105274 CAGGAGCCACACTCCGGGGAAGG - Intronic
1106177920 13:27347091-27347113 TGGGAGGGACACTCGGAGGAAGG + Intergenic
1110214259 13:73009061-73009083 CAGATGCCACACTCTAAGGATGG - Intronic
1115660821 14:35492826-35492848 CAGGATCCACACTAGGACAAAGG + Intergenic
1115972374 14:38960300-38960322 CAGCAGCCACCATAGGAGGAAGG + Intergenic
1118809699 14:69263960-69263982 CAGCAGCCAAACTGGGAGGCAGG + Intronic
1118877485 14:69797465-69797487 CATGAGGCACACTCAGTGGAGGG - Intergenic
1119123062 14:72097826-72097848 AAGGAGCTACAATCTGAGGAAGG - Intronic
1119531141 14:75362184-75362206 CTGGAGACACACTCTCAGGAAGG - Intergenic
1121283123 14:92713721-92713743 CAGCACCCACAGTTGGAGGACGG + Intronic
1121328864 14:93037086-93037108 CAGGAGCCACCCAGGGAGCAGGG - Intronic
1125396699 15:39256402-39256424 CAAGAACCACACACAGAGGAGGG - Intergenic
1126378745 15:48023832-48023854 CAGGAGCCACAACTGGAGGCAGG + Intergenic
1128605981 15:69037050-69037072 CAGAAGCCACACGAGGAGGTAGG - Exonic
1129182674 15:73886973-73886995 CAGGAGCAGCACTCTGGGGAAGG - Intronic
1129664828 15:77573715-77573737 CAGGAGCCAGAAGTGGAGGATGG + Intergenic
1129882979 15:79019179-79019201 CAGGAGGCCCAGTCTGAGGAGGG + Intronic
1129887328 15:79047805-79047827 CACGGTCCACACTGGGAGGAAGG + Intronic
1132555985 16:572893-572915 CTGGAGCCACACTCGAGGGAGGG - Intronic
1132633141 16:929366-929388 CAGGGTCCACACTCAGGGGATGG + Intronic
1132645115 16:995607-995629 CAGGAGACCCACTGGCAGGAAGG + Intergenic
1133029931 16:3005596-3005618 CAAGAGCCATACACTGAGGATGG - Intergenic
1133944030 16:10333737-10333759 AAGGAGACACCCTGGGAGGAAGG + Intronic
1134656839 16:15953928-15953950 CCAAAGCCACACTTGGAGGAGGG - Intronic
1136254402 16:29028738-29028760 CAGGGACCACCCTCTGAGGAAGG - Intergenic
1136894289 16:33987761-33987783 CAGGACACACACTCGGTGGGTGG + Intergenic
1138528528 16:57622428-57622450 CAGGAGCCACACTCGGAGGAGGG + Intronic
1141523672 16:84598061-84598083 CAGGAGCCCCATCCTGAGGACGG + Intronic
1142214107 16:88822409-88822431 CAGCAGGCACCCTGGGAGGAGGG + Intronic
1142302538 16:89266884-89266906 CTGGAGCCACACTGGCTGGAGGG + Intergenic
1147132664 17:38418428-38418450 CAGGAGCCACACCTGATGGAGGG + Intergenic
1147244968 17:39114101-39114123 CAAGAGCCACACCCTAAGGATGG + Intronic
1148560977 17:48605949-48605971 CAGGACCAAAACTTGGAGGATGG - Intergenic
1150385916 17:64760010-64760032 CAGAAGCCACACTCTTAGGCAGG - Intergenic
1150754361 17:67897653-67897675 CAGAAGCCACACTCTTAGGCAGG + Intronic
1152758221 17:82095981-82096003 GAGGAGCCAAGCTCAGAGGATGG - Intronic
1152812875 17:82390647-82390669 CACGGGCCACATGCGGAGGACGG - Intronic
1152875968 17:82786403-82786425 CAGCACCCACACTCGGGGCAGGG - Intronic
1153003250 18:475232-475254 CAGGACTGACACTGGGAGGAAGG - Intronic
1156545398 18:37958878-37958900 AAAGGGCCACACTCAGAGGAAGG + Intergenic
1157314973 18:46579491-46579513 CAGGAGCCTCACTCTGGGTAAGG - Intronic
1157502680 18:48202428-48202450 CAGGAGGCACAGTCGCAGGGCGG + Intronic
1158627637 18:59085242-59085264 CAGGAGCCACACTAGGAGAATGG - Intergenic
1158630837 18:59112573-59112595 CAGGAGTCACATGCGGAGGATGG - Intergenic
1158933205 18:62341167-62341189 CACGAGCCACACTTGGGTGAAGG - Intronic
1160167976 18:76530523-76530545 CAGGAGCCACACCTGAAGAATGG + Intergenic
1160187777 18:76688806-76688828 CAGCAGACACACTAGGAGGATGG - Intergenic
1160710836 19:550285-550307 CAGGAGCCACGCGGGGAGGACGG - Intergenic
1160786122 19:900859-900881 CAGGAGCAAGGCGCGGAGGAGGG - Exonic
1161008685 19:1949464-1949486 CAGGAGCGAGACTCGGACGCGGG - Intronic
1161093433 19:2375171-2375193 TAGGAGCCCCACTGGGAAGAAGG + Intergenic
1161845016 19:6707378-6707400 CAGGAGCCAGAGAGGGAGGAGGG - Intronic
1163416115 19:17187426-17187448 CAGGAGCCACACACAGGTGATGG - Intronic
1167360529 19:49028135-49028157 CAGGAGCCACAGCAGGAGGATGG - Intronic
1167363119 19:49040665-49040687 CAGGAGCCACAGCAGGAGGATGG + Intergenic
1167365448 19:49052921-49052943 CAGGAGCCACAGCAGGAGGATGG - Intergenic
1168063744 19:53908265-53908287 AAGGAGCCGCACTTGGGGGAAGG - Intergenic
925853807 2:8110196-8110218 CAGTACCCACACTCTGAGCATGG + Intergenic
926434548 2:12824697-12824719 CAGGAGAGACACTTTGAGGAGGG - Intergenic
927305898 2:21572512-21572534 CAGCAGCTAAACTAGGAGGATGG - Intergenic
927454984 2:23241538-23241560 CACGAGCCACCCTCTGGGGACGG + Intergenic
928549453 2:32357055-32357077 GAGGGGCCAAACTCGGAGGGAGG - Exonic
931787287 2:65631526-65631548 CGAGAGCCAGACTGGGAGGAGGG - Intergenic
934755366 2:96820755-96820777 CTGCAGCCACACTCTGTGGAGGG - Intronic
935877902 2:107531839-107531861 CAGTAGCCACACAGGGAGAATGG - Intergenic
936017917 2:108973550-108973572 CAGGAGCCACACTCACAGGCTGG - Intronic
936077734 2:109412350-109412372 CTGGGGCCACACTGGGAGGGTGG - Intronic
939886225 2:147684888-147684910 CAGGAACCACAGTCTGAAGAAGG + Intergenic
945517050 2:210775281-210775303 CAAGAGCAGCACTAGGAGGATGG - Intergenic
948136720 2:235642137-235642159 CAGGCGCCGCACTCCGTGGATGG - Intronic
1169046502 20:2537862-2537884 CAGAAGCCACACTCACAGGCTGG + Intronic
1171499779 20:25584988-25585010 CCGCAGCCACACTGGCAGGAGGG + Intronic
1172281551 20:33711384-33711406 CACGTGCCACGCCCGGAGGAGGG + Intronic
1172768684 20:37364441-37364463 CAGGGGCCCCACAAGGAGGAGGG - Intronic
1173443308 20:43096512-43096534 CAGGAGCCCCAGGAGGAGGAGGG - Intronic
1174082323 20:47979325-47979347 CAGGCCCCACACTCGGAGAGGGG - Intergenic
1174115856 20:48225945-48225967 CAGAAGCCCCAGTCAGAGGAAGG + Intergenic
1176233011 20:64041597-64041619 CATGTGCCGCACTGGGAGGAGGG + Intronic
1178362228 21:31958191-31958213 CAGGAGCCACCTCCTGAGGAGGG - Intronic
1180074049 21:45453767-45453789 TCGGGGCCACACTTGGAGGATGG - Intronic
1181052912 22:20246162-20246184 CAGGAGCCACAGTCAGGGGAGGG + Intronic
1182494451 22:30695967-30695989 TAGGACCCACACTCTTAGGAAGG + Intronic
1182774701 22:32822213-32822235 CAGGAGCCAGCCTCGGAGATGGG - Intronic
1182850015 22:33465783-33465805 TGTGAGCCACACTAGGAGGATGG - Intronic
1183367017 22:37412356-37412378 CAGGAGCCCCAGTCTGAGGGTGG - Intronic
1183647751 22:39136287-39136309 TAGGAGCCAGCCTCCGAGGAGGG + Intronic
1185072980 22:48667357-48667379 CAGGAGGCAGACCAGGAGGAAGG + Intronic
1185244631 22:49766332-49766354 CAGGAGCCAGAGTGGGAGGCTGG + Intergenic
949492163 3:4599704-4599726 CAGCAGCCACTGTCGGAGTAGGG - Intronic
950524885 3:13517786-13517808 CAGGAGCCACCTTAGAAGGAAGG + Intergenic
950708957 3:14801784-14801806 CAGGAGCCACACACTGAGTCGGG - Intergenic
950767931 3:15287537-15287559 CAGTAGCCACACGTGGAGGCTGG - Intronic
952581540 3:34838947-34838969 CAGGAGCAACTCTGGGAAGATGG - Intergenic
953533290 3:43757082-43757104 AAGGAGCCACACTGGCAGGTAGG - Intergenic
955043715 3:55340166-55340188 AAGGAGCCACACAGGGAGGTGGG + Intergenic
960611341 3:119557707-119557729 CATGGGCCACACACGGAGGCAGG - Exonic
961212447 3:125136275-125136297 CAGCAGCCACACCCTGAGGAAGG + Intronic
961810354 3:129518462-129518484 CAGGGGCCACACTGGGAGGAGGG + Intronic
969213829 4:5708074-5708096 CAGCTGCCACACCCCGAGGAAGG + Intronic
969216962 4:5730689-5730711 CAGGATCCACGCCTGGAGGAAGG + Intronic
969624538 4:8295597-8295619 CAGGAGACACAATGGCAGGAGGG - Intronic
973115688 4:46455528-46455550 CAGAAGTCACAATCTGAGGAAGG + Intronic
974877646 4:67717643-67717665 CAGAAACCACACTCGGAGGAGGG - Intergenic
975756771 4:77579059-77579081 CAAGGGCTACACTCTGAGGATGG + Intronic
978307514 4:107347937-107347959 CAGGAGCCTCCCTAGAAGGAAGG - Intergenic
982408668 4:155047812-155047834 TAGGAGCCACAGTCTGAGAATGG + Intergenic
983857774 4:172666914-172666936 CAGGAGGCAGATTCTGAGGAGGG + Intronic
985857351 5:2440261-2440283 AAGGGGCCAAACTCGGGGGATGG + Intergenic
988506083 5:31824511-31824533 TAGGGGCTACACTGGGAGGAAGG + Intronic
993877109 5:93320543-93320565 CAGGAGCCAGAAACGGATGAGGG + Intergenic
998396697 5:141823315-141823337 CATGAGCCACCCTCTGAGGCAGG - Intergenic
999240438 5:150124487-150124509 GAGCACCCACACTCTGAGGAGGG + Intronic
999893192 5:156000917-156000939 CAGGGACCACACTTTGAGGATGG + Intronic
1003132110 6:3403578-3403600 CAGCAGCCACACAGCGAGGAAGG + Intronic
1004251035 6:14023354-14023376 CTGGGGCCACACCCTGAGGACGG - Intergenic
1004950716 6:20668107-20668129 CAGGATACACAATTGGAGGAAGG - Intronic
1007701966 6:43770968-43770990 GAGGAGCCGCAGCCGGAGGAGGG + Exonic
1007742632 6:44022066-44022088 CAGGAGCCAGAGTCTGGGGATGG + Intergenic
1008503722 6:52208851-52208873 TATGAGCCACACTTGGAGGTGGG - Intergenic
1011562786 6:88639778-88639800 CAGCAGCCACACTCAGAGCCAGG + Intronic
1013166942 6:107603252-107603274 CAGAAGGCACACTGGGAGGCAGG - Intronic
1018208614 6:161459063-161459085 CAGCAGACACTCTCTGAGGAAGG - Intronic
1019341831 7:512131-512153 CAGGAGACACCCTCGAAGGAGGG + Intronic
1019563508 7:1669065-1669087 CAGGAGCCAGAATCGGAGAGTGG - Intergenic
1020140471 7:5608766-5608788 GAGGAGCCACCCTCGGGGTATGG - Intergenic
1022102334 7:27175869-27175891 CTGGATTCACACTGGGAGGAAGG - Intronic
1023356364 7:39371160-39371182 AAGAAGCCAGACTCGGAGAATGG + Intronic
1024223492 7:47305631-47305653 CAGAAGCCACCCTCGCAGGTGGG + Intronic
1024270077 7:47635496-47635518 CAGGAGCAGCGCTGGGAGGAGGG + Intergenic
1025139183 7:56448428-56448450 CAGGTGCCAGCCTCGGAGGAAGG - Intergenic
1025986332 7:66455734-66455756 CAGGAGCCAAACTCTGAGGCAGG + Intergenic
1026028598 7:66768928-66768950 CAGGAGCCAAACTCTGAGGCAGG - Intronic
1026104152 7:67407849-67407871 CAGGAGGGACACTCAGAGGAGGG - Intergenic
1027420412 7:78012846-78012868 CAGGAGCCACACTGGGGAGATGG - Intergenic
1029101579 7:98135415-98135437 CAGGAGCCTGAGTGGGAGGATGG - Intronic
1035459844 7:159031894-159031916 CAGGACCCGCGCTCGGGGGAGGG + Intronic
1035553187 8:545134-545156 CGGGGACCACACTGGGAGGAGGG - Intronic
1035583293 8:753591-753613 AAGGAGCCACAGACGGTGGATGG + Intergenic
1035595139 8:851793-851815 CAGGAACCACACTCGGAGCTGGG + Intergenic
1035737790 8:1901299-1901321 CAGGAGAGTCACTGGGAGGAAGG - Intronic
1035737985 8:1902675-1902697 CAGCGGCCACAGTCGCAGGAGGG + Intronic
1037835833 8:22214244-22214266 GAGGAGGAACACTCAGAGGACGG + Intergenic
1040416590 8:47201166-47201188 CAGGAGACAGACTCAGGGGAGGG + Intergenic
1041409158 8:57534387-57534409 CACGTGCCACACTCGGGTGATGG + Intergenic
1042144931 8:65718163-65718185 GAGCAGCCACACTCGGGGGAGGG - Exonic
1042524157 8:69747104-69747126 CAGGAGGCAGAATCGGAGCAAGG - Intronic
1044365098 8:91336045-91336067 CTTGAGCCACCCTGGGAGGATGG + Intronic
1044731572 8:95232675-95232697 CATGAGCCACACTCAAAGGAGGG - Intergenic
1044832542 8:96263470-96263492 CAGGGGCCACACTCGTAAAATGG + Intronic
1045542347 8:103098956-103098978 CAGGTGCCACTCTTGGAGGACGG + Intergenic
1047495461 8:125405641-125405663 CAGTAGCCAGACTTGGAGGCAGG - Intergenic
1047619025 8:126587535-126587557 CAGGAGCCATGCACGGAGCAGGG - Intergenic
1048857066 8:138694704-138694726 CAGGAGCCACACTGAATGGAAGG - Intronic
1049400676 8:142425619-142425641 GAGGAGCCCCACTGGGAGAAAGG + Intergenic
1050050775 9:1599205-1599227 CAGTAGCGACCCTCGGTGGATGG + Intergenic
1051183689 9:14437780-14437802 CAGGAGGCACACTGAGAAGAGGG - Intergenic
1056687388 9:88777945-88777967 CAGGAGGCAAACTCTGAGGCCGG + Intergenic
1056906050 9:90648756-90648778 CAGCAGCCCCAGTAGGAGGAGGG - Intergenic
1058932176 9:109732034-109732056 CAGGAGCCACTTTGGCAGGAAGG + Intronic
1060192682 9:121603091-121603113 CAGAGGCCACAGTAGGAGGATGG - Intronic
1062095005 9:134698606-134698628 CAGGTACAACACTGGGAGGAAGG - Intronic
1062144723 9:134982706-134982728 CCGGAGACACACGCGGAAGATGG - Intergenic
1062147179 9:134996203-134996225 AAGGAGCCACACTGGGGAGATGG + Intergenic
1062181167 9:135192016-135192038 CAGGCCCCACACACAGAGGATGG + Intergenic
1062349661 9:136132734-136132756 CAGGAGCCGCACAGGGAGGATGG - Intergenic
1187359232 X:18609477-18609499 CATGACCCACACTCTGATGATGG + Exonic
1187969317 X:24643917-24643939 CAGTAGCCACACTCTGTTGATGG + Intronic
1189898507 X:45681723-45681745 CAGGATCCAAACTCAGGGGATGG - Intergenic
1192208163 X:69109757-69109779 CAGGAGCCAGATTCGCTGGAGGG + Intergenic
1192624561 X:72714168-72714190 CAGGAGTCACACGCGGAGGCCGG - Intronic
1195331097 X:103801299-103801321 TAGGAGCCACACTCCTAGGAGGG - Intergenic
1196967639 X:121076143-121076165 TAGGAGCCAGACTCTGAGGTGGG + Intergenic
1200103546 X:153700291-153700313 CAGGACACACACTCGGCGGGTGG + Intergenic