ID: 1138530830

View in Genome Browser
Species Human (GRCh38)
Location 16:57633516-57633538
Sequence TAGGAGAGGCAGCACGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 193}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138530819_1138530830 -3 Left 1138530819 16:57633496-57633518 CCCTCAGCCAGGCTGCCCCCTAG 0: 1
1: 1
2: 11
3: 83
4: 603
Right 1138530830 16:57633516-57633538 TAGGAGAGGCAGCACGAGGTGGG 0: 1
1: 0
2: 0
3: 15
4: 193
1138530812_1138530830 27 Left 1138530812 16:57633466-57633488 CCCAGCTGTCCCAGACCTTTGCT 0: 1
1: 0
2: 1
3: 26
4: 200
Right 1138530830 16:57633516-57633538 TAGGAGAGGCAGCACGAGGTGGG 0: 1
1: 0
2: 0
3: 15
4: 193
1138530811_1138530830 28 Left 1138530811 16:57633465-57633487 CCCCAGCTGTCCCAGACCTTTGC 0: 1
1: 0
2: 0
3: 20
4: 247
Right 1138530830 16:57633516-57633538 TAGGAGAGGCAGCACGAGGTGGG 0: 1
1: 0
2: 0
3: 15
4: 193
1138530820_1138530830 -4 Left 1138530820 16:57633497-57633519 CCTCAGCCAGGCTGCCCCCTAGG 0: 1
1: 0
2: 9
3: 120
4: 720
Right 1138530830 16:57633516-57633538 TAGGAGAGGCAGCACGAGGTGGG 0: 1
1: 0
2: 0
3: 15
4: 193
1138530814_1138530830 18 Left 1138530814 16:57633475-57633497 CCCAGACCTTTGCTTTTCCATCC 0: 1
1: 0
2: 3
3: 30
4: 318
Right 1138530830 16:57633516-57633538 TAGGAGAGGCAGCACGAGGTGGG 0: 1
1: 0
2: 0
3: 15
4: 193
1138530816_1138530830 12 Left 1138530816 16:57633481-57633503 CCTTTGCTTTTCCATCCCTCAGC 0: 1
1: 0
2: 1
3: 31
4: 406
Right 1138530830 16:57633516-57633538 TAGGAGAGGCAGCACGAGGTGGG 0: 1
1: 0
2: 0
3: 15
4: 193
1138530813_1138530830 26 Left 1138530813 16:57633467-57633489 CCAGCTGTCCCAGACCTTTGCTT 0: 1
1: 0
2: 1
3: 19
4: 216
Right 1138530830 16:57633516-57633538 TAGGAGAGGCAGCACGAGGTGGG 0: 1
1: 0
2: 0
3: 15
4: 193
1138530823_1138530830 -10 Left 1138530823 16:57633503-57633525 CCAGGCTGCCCCCTAGGAGAGGC 0: 1
1: 0
2: 3
3: 29
4: 248
Right 1138530830 16:57633516-57633538 TAGGAGAGGCAGCACGAGGTGGG 0: 1
1: 0
2: 0
3: 15
4: 193
1138530818_1138530830 1 Left 1138530818 16:57633492-57633514 CCATCCCTCAGCCAGGCTGCCCC 0: 1
1: 6
2: 94
3: 437
4: 3147
Right 1138530830 16:57633516-57633538 TAGGAGAGGCAGCACGAGGTGGG 0: 1
1: 0
2: 0
3: 15
4: 193
1138530815_1138530830 17 Left 1138530815 16:57633476-57633498 CCAGACCTTTGCTTTTCCATCCC 0: 1
1: 0
2: 2
3: 32
4: 317
Right 1138530830 16:57633516-57633538 TAGGAGAGGCAGCACGAGGTGGG 0: 1
1: 0
2: 0
3: 15
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138530830 Original CRISPR TAGGAGAGGCAGCACGAGGT GGG Intronic
900575416 1:3380107-3380129 TAGGAGAGGGTGCACGGGGAGGG - Intronic
901028138 1:6290070-6290092 CAGGAGTGTCAGCACGAGGGGGG + Intronic
901636353 1:10672044-10672066 TGGGCAAGGCAGCCCGAGGTGGG + Intronic
902469623 1:16639339-16639361 CAGGAGAGACAGCAGGTGGTAGG - Intergenic
904360565 1:29968714-29968736 AAGCAGAGGCAGCAGGAGGTGGG + Intergenic
909562979 1:77025778-77025800 GAGGAGGGGCAGCAGGAGGGAGG - Intronic
912387021 1:109276034-109276056 TGGGAGAGGCTGCACGGGGCAGG + Intergenic
912496440 1:110094943-110094965 CAGGAGGGGCAGGACGAGGATGG + Intergenic
913162342 1:116155622-116155644 TAGGAGAGGCAACATGGGGCAGG + Intergenic
914331069 1:146671319-146671341 GAGGAGAGGCAGCTGGATGTTGG - Intergenic
915038623 1:152949020-152949042 CAGGAGAGGCAGCACCAGGCTGG + Intergenic
915243251 1:154538875-154538897 GAAGAGAGGCAGAACGTGGTTGG + Intronic
915476589 1:156156191-156156213 GAGGAGAGGCAGCCAGAGGCAGG - Intronic
915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG + Intronic
917178089 1:172261710-172261732 TAGCAGTGGCTGCAAGAGGTTGG + Intronic
919791293 1:201292518-201292540 CAGGGGAGGTGGCACGAGGTGGG + Intronic
920006471 1:202836911-202836933 TAGGAGAAAGAGCAAGAGGTGGG + Intergenic
922703857 1:227778656-227778678 TAGCAGAGCCAGCAAGGGGTGGG + Intronic
1062805310 10:415383-415405 AAGGAGAGGCAGCAGGAGGAGGG + Intronic
1063934869 10:11066859-11066881 GAGGAGATGCAGCAGGAGCTGGG - Intronic
1064913858 10:20434792-20434814 CAAGAGAGGCAGCAAGAGGCAGG - Intergenic
1065384401 10:25119924-25119946 TAGGAGAGACAGCCTGAAGTTGG + Intergenic
1066278035 10:33887829-33887851 CAGGAGAGCCAGCACGATGTGGG - Intergenic
1067205767 10:44211500-44211522 CAGGAGAAGCAGCATGAGGGGGG - Intergenic
1067819079 10:49510848-49510870 TAGGAAATGCAGCAAGAGGTAGG - Intronic
1069900630 10:71704880-71704902 AAGGAGGGGCAGCATGAGGGTGG - Intronic
1069979562 10:72242800-72242822 TAGGAGGGGCAGCAGGAAGAGGG + Intergenic
1070394928 10:76003637-76003659 CAGGAGAGGCAGCATTAGGAAGG + Intronic
1070982166 10:80657748-80657770 TAGGAGAGGCAGATGCAGGTTGG - Intergenic
1073036458 10:100567281-100567303 TGGGAGAGTCAGCGAGAGGTTGG + Intergenic
1073580645 10:104662780-104662802 TAGGAGAGTCAGGAAGAGATGGG + Intronic
1073615662 10:104992139-104992161 TAGGGGAGGGAGCAGGGGGTAGG + Intronic
1074086790 10:110214415-110214437 TGGGAAAGGCAGCAGGAGGGGGG - Intronic
1074620236 10:115111530-115111552 CAGGAGAGGAAGCAAGGGGTGGG + Intronic
1076121392 10:127939748-127939770 AAGGAGAGGCAGGAGGAGGCAGG + Intronic
1078760261 11:14245826-14245848 AAGGAGAAGCAACACGAGGCAGG + Intronic
1079621447 11:22560468-22560490 TAAGAGTGGCATCAGGAGGTGGG - Intergenic
1079996479 11:27300202-27300224 TTGGATAGGAGGCACGAGGTGGG - Intergenic
1082122747 11:48397021-48397043 TGGGAGGGGCAGAACGAGATTGG + Intergenic
1084121292 11:67070561-67070583 TAGGAAACCCAGCCCGAGGTGGG + Intronic
1084576306 11:69990145-69990167 TAGGAGAGGCAGGGCGGGGTGGG - Intergenic
1086145064 11:83542659-83542681 TATGAGTGGCAGCATGAGGGAGG + Intronic
1089706916 11:120284657-120284679 CAGGAGAGGCAGCCCCAGGATGG - Intronic
1089852921 11:121515831-121515853 TAGTAGAGACAGCACCATGTTGG + Intronic
1090934151 11:131326931-131326953 GAGGAGAGGCATCAAGAGGATGG - Intergenic
1091283687 11:134396503-134396525 TAGCAGAGGCAGAAAGAGGCTGG - Intronic
1094076987 12:26488068-26488090 CAGGAGAAGCAGTAGGAGGTAGG + Intronic
1097226134 12:57477750-57477772 TGGGGGAGGGAGCAGGAGGTGGG - Intronic
1100674400 12:96850395-96850417 TGGGAGAGGCTGCACGAAGCAGG + Intronic
1102482086 12:113230902-113230924 GAGGAGAGGCGGCAGGAGGGAGG - Intronic
1103398906 12:120629065-120629087 TGGGAGCGGCAGCAGGAGATGGG - Intergenic
1103828275 12:123757741-123757763 TGGGAAAGCCAGCACGGGGTTGG + Intronic
1103904064 12:124318549-124318571 GAGGAGAAGCTGCAGGAGGTCGG - Intergenic
1106213730 13:27675150-27675172 TAGGAGAGGGAGCAAGGAGTGGG - Intergenic
1106690895 13:32115103-32115125 TGGGAGAGACAGCATGAAGTAGG + Intronic
1106968557 13:35105321-35105343 TTGGAAAGGCAGCAAAAGGTTGG + Intronic
1108952391 13:56111537-56111559 TAGCAGAGGCTGAAAGAGGTAGG - Intergenic
1110852186 13:80258537-80258559 TAGGACAGGAAGCATGATGTTGG + Intergenic
1111363929 13:87215321-87215343 TAGGAGAGGCTGTATGTGGTGGG + Intergenic
1113018714 13:105857723-105857745 AAGGAGAGGCACCACCAGCTGGG + Intergenic
1115499440 14:34036175-34036197 TAAGAGAGCCAGCACCAGCTGGG - Intronic
1118736097 14:68702948-68702970 TATGAGGGGCTGCAGGAGGTTGG - Intronic
1119162225 14:72462210-72462232 TGGGAGAGGCAGCATGATGCAGG + Intronic
1119485181 14:74982167-74982189 TGGGAGAAGCAGCAGGACGTGGG + Intergenic
1119756711 14:77124999-77125021 TAGGCGAGGCAGACCCAGGTTGG + Intronic
1120822533 14:88926197-88926219 TAGGAAAGGCAGCCCCAGGTTGG + Intergenic
1123484428 15:20675198-20675220 TTGGAAAGGCAGCAAAAGGTTGG - Intergenic
1123537155 15:21244165-21244187 TTGGAAAGGCAGCAAAAGGTTGG - Intergenic
1124879519 15:33628334-33628356 TGGGTCAGGCAGCATGAGGTCGG + Intronic
1128808770 15:70554964-70554986 TAGGAGTGGCTGGATGAGGTGGG + Intergenic
1129389541 15:75213767-75213789 TAGGGGTGGCAGCCCTAGGTAGG - Intergenic
1130350269 15:83085184-83085206 GTGGGGAGGCAGCAGGAGGTGGG + Intergenic
1132219559 15:100095142-100095164 AAGGAGAGGCAGGAGCAGGTTGG - Intronic
1132511295 16:342926-342948 TAGGTGAGGGTGCACTAGGTTGG - Intronic
1132763830 16:1524613-1524635 TACGAGAGCCAGGAGGAGGTCGG - Exonic
1133030535 16:3008735-3008757 TAGGAGAGGCTGGAAGAGGGTGG - Intergenic
1133490670 16:6264986-6265008 CATGGGAGGCAGGACGAGGTTGG - Intronic
1134670936 16:16054577-16054599 AAGGAGAGGCCTCACGTGGTAGG + Intronic
1136288230 16:29256643-29256665 AAAAAGAGGCTGCACGAGGTTGG + Intergenic
1136405083 16:30040601-30040623 TAGGAGAGGCAGAAGGAGTGAGG + Intronic
1136411418 16:30079679-30079701 TGGCAGAGGCAGCACGAAGGAGG - Intronic
1137618236 16:49858960-49858982 TAGCAGAGGCAGCCCGCGGCGGG - Intergenic
1138333285 16:56232162-56232184 TAGGAGAGGCTGCAGGAGGGAGG - Intronic
1138530830 16:57633516-57633538 TAGGAGAGGCAGCACGAGGTGGG + Intronic
1139095014 16:63694903-63694925 AAGGAGAGCCATCAAGAGGTTGG + Intergenic
1139747206 16:69084132-69084154 TAGGAGATGCAGTTGGAGGTGGG + Exonic
1140002484 16:71039585-71039607 GAGGAGAGGCAGCTGGATGTTGG + Intronic
1142093906 16:88229410-88229432 AAAAAGAGGCTGCACGAGGTTGG + Intergenic
1142599589 17:1047144-1047166 TAGGAAAGGCAGGAGGAGGAGGG - Intronic
1142962473 17:3559303-3559325 TATGAGAGGCAGCAGGAGCCAGG + Intergenic
1143054864 17:4155259-4155281 TAGGAGAGGGACGAGGAGGTGGG + Intronic
1143332348 17:6147018-6147040 CAGGAGAGGCTGTACTAGGTTGG - Intergenic
1143480943 17:7227029-7227051 TTGGAGAGGCAGAACAAGGTAGG + Intronic
1145751942 17:27361509-27361531 AAGGAGAGGCAGCAGGATGGAGG - Intergenic
1146976374 17:37116310-37116332 TAGGAGAGACAGCATGAGACTGG + Intronic
1148485613 17:47988888-47988910 GAGGTGAGGAAGCAGGAGGTGGG + Intergenic
1148869416 17:50647446-50647468 TCTGAGAGGCAGCAGGAAGTAGG + Intronic
1149602634 17:57903205-57903227 TGGCAGAGGAAGCATGAGGTGGG - Intronic
1150222702 17:63506261-63506283 TAGGAGAGGGCACACAAGGTAGG - Intronic
1152375221 17:79915416-79915438 GGGGAGAGGCAGCACAAGGAGGG + Intergenic
1153453324 18:5253809-5253831 AAGGAGAGGTAGCTTGAGGTGGG + Intergenic
1153480819 18:5544124-5544146 GAGGGCAGGCAGGACGAGGTTGG - Exonic
1153880959 18:9421477-9421499 TGGGAGAGGAAGCTCGAGGGTGG - Intergenic
1154145205 18:11861247-11861269 AAGGAGAGCCAGCAGGAGGGAGG - Intronic
1156949794 18:42881129-42881151 TCAGAGAGGCAGCAGGATGTGGG - Intronic
1157193509 18:45600710-45600732 CAAGGGAGGCAGCAGGAGGTAGG + Intronic
1157285936 18:46377476-46377498 TAGGAGGGGCAGCAAGTGGCTGG + Intronic
1160597017 18:79982758-79982780 TAGGAGAGGCTGAAAGAGGCAGG + Intronic
1160965807 19:1746391-1746413 GAGGAGGGGGAGGACGAGGTAGG + Intergenic
1161861601 19:6802024-6802046 TAGGAGAGGCATTATGAGGACGG - Intronic
1162060492 19:8091730-8091752 TATGAGCTTCAGCACGAGGTGGG + Intronic
1162513226 19:11132340-11132362 TAGAAGTGGAAGCACTAGGTGGG - Intronic
1163054188 19:14706080-14706102 CAGGAGAGGCAGCTGGAGGTGGG - Intronic
1163423463 19:17227916-17227938 TTGGAGCTCCAGCACGAGGTGGG + Exonic
1165364025 19:35352888-35352910 TAGGAGAGGAGGCAGGAGGCAGG + Exonic
1166238591 19:41474102-41474124 TAGGAAAGACATCACGAGGGAGG + Intergenic
1166295401 19:41887003-41887025 TGGGAGAGACAGCAAGAGATGGG + Intronic
1167712193 19:51119221-51119243 TAGGAGAGGAAGCAAGAGAGAGG + Intergenic
925174539 2:1772854-1772876 GAGGAGAGGAAGCATCAGGTGGG + Intergenic
928199242 2:29236675-29236697 TAGGAGAGGATGCAAGAGGATGG - Intronic
933105206 2:78316075-78316097 AAAGAGAGGCAGTAAGAGGTAGG + Intergenic
933309003 2:80637488-80637510 CAGGAGAGGAAGAAAGAGGTGGG + Intronic
934037450 2:88100022-88100044 TAGGAGAAGGAGCAGGAGGTGGG - Intronic
935264327 2:101381763-101381785 TGGGTGAGGCAGCTCGAGGCTGG - Intronic
938367509 2:130746348-130746370 TAGGAGAGGCAGTGCCAGGGAGG + Intergenic
938982061 2:136536398-136536420 CAGGAGAGTCAGTACGAAGTGGG + Intergenic
940412114 2:153377167-153377189 GGGGAGAGGCAGCAAGAGGATGG + Intergenic
943919176 2:193680189-193680211 TTGGAGAGGCAGCTCCAGTTGGG + Intergenic
947263557 2:228251862-228251884 TGGCAGTGGCAGCATGAGGTGGG + Intergenic
1171168549 20:22994746-22994768 TGGGAGAGGCAGGATGGGGTGGG - Intergenic
1173617663 20:44413599-44413621 GAGGAGTGGGAGCAGGAGGTGGG - Intronic
1175605906 20:60312011-60312033 AAGGGGAGGCAGCAGGAGGCAGG + Intergenic
1179906323 21:44425008-44425030 GAGGAGAGGCAGCTGGGGGTGGG + Intronic
1180993966 22:19955354-19955376 CAGGCCAGGCAGCACCAGGTAGG - Intronic
1181276104 22:21688373-21688395 TTGGAGAGGCTGCAGGAGGGAGG - Intronic
1181414665 22:22750715-22750737 AATGAGAGGCAGGCCGAGGTGGG - Intronic
1184158515 22:42684549-42684571 TGGGTGAGGTAGCACGTGGTGGG + Intergenic
1184175343 22:42785804-42785826 GAGGAGAGGCTGCAGGAGCTGGG + Intergenic
1184915458 22:47565797-47565819 TAGGAGAGGCTTGAAGAGGTAGG + Intergenic
1185210959 22:49570236-49570258 TCGGAGAGGCTGCACGAGTGAGG - Intronic
949405179 3:3706448-3706470 TCGGAGAGGGAGCACTGGGTTGG - Intronic
951053664 3:18122863-18122885 TGGGAGAGGAAGCAAGAGGAAGG - Intronic
951553994 3:23902602-23902624 TTGGAGAGGCAGGTGGAGGTGGG - Intronic
952310240 3:32182095-32182117 TAGGAGAGAGAGAACGAGGGGGG + Intergenic
954141570 3:48609463-48609485 TAGCAGTGGCAGGTCGAGGTGGG - Intronic
954299821 3:49694878-49694900 CAGGAGAGACAGCAGGTGGTAGG + Intronic
954805398 3:53216963-53216985 TATCAGAGGAAGCACCAGGTGGG - Intergenic
954852754 3:53617310-53617332 GAGGGGAGGCAGGAGGAGGTAGG + Intronic
963908829 3:150797331-150797353 TAGGGGAGGCTGCATGATGTAGG + Intergenic
965349261 3:167593921-167593943 CAGGAGAGGCAGAACGAGAGAGG - Intronic
966624964 3:182005860-182005882 CTGGAGAGGCAGCTCGAGGCAGG + Intergenic
966648032 3:182268711-182268733 AAGGAGAGGCAGCACTGGGCAGG - Intergenic
969479533 4:7440695-7440717 GAGGAGAGGCAGCATGAGGGTGG - Intronic
976201967 4:82587908-82587930 GAGGAAAGGCAGCAAGAGGGCGG - Intergenic
976635111 4:87279564-87279586 GAGGAGAGGCAGAATGAGGCGGG + Intergenic
977787350 4:101052914-101052936 TAGGGGAGGCAGCAGGAATTGGG - Intronic
980082107 4:128355079-128355101 TGAGAGAGGCAGCAAGAGGAAGG - Intergenic
983321798 4:166204241-166204263 TAGCAGCTGCAGCACTAGGTAGG + Intergenic
984140384 4:175998396-175998418 TTTGAGAGGCAGGACGAGCTGGG - Intronic
985898072 5:2762239-2762261 GAGGGGAGGCAGCAGGAGGCTGG + Intergenic
990232880 5:53734093-53734115 CAGGAGAGGCTGCAGCAGGTTGG + Intergenic
990280929 5:54250141-54250163 CAGGAGTGGGAGCAAGAGGTGGG + Intronic
990801358 5:59607644-59607666 TAGAGGAGGCAGCAGGGGGTAGG + Intronic
992092040 5:73326036-73326058 GTGGAGAGGCAGCAAGAGGGTGG - Intergenic
992969951 5:82046169-82046191 TTGGAGAAGCAGGAAGAGGTAGG - Intronic
993899742 5:93577146-93577168 CAGGAGAAGCAGCAGGAGGAAGG - Intergenic
999322496 5:150624298-150624320 AAGGAGAGCCAGGAAGAGGTAGG + Intronic
1002991333 6:2241663-2241685 TGAGAGAGGAAGCAAGAGGTGGG - Intronic
1006154524 6:32007082-32007104 CAGCTGAGGCAGCACAAGGTGGG + Intergenic
1006160835 6:32039818-32039840 CAGCTGAGGCAGCACAAGGTGGG + Exonic
1006178154 6:32136060-32136082 TGGAAGAAGCAGCACAAGGTAGG + Intergenic
1006393223 6:33771085-33771107 TGGGAGAGACAGCAGGACGTGGG - Intergenic
1007149039 6:39669717-39669739 TATGCGGGGCAGCACGAGGTGGG + Intronic
1008521142 6:52362789-52362811 GAGGAAGGGCAGCCCGAGGTAGG + Intronic
1012004591 6:93696474-93696496 CAGGAGAGGAAGCATGAGTTAGG + Intergenic
1012256853 6:97043004-97043026 TAAGAGAGGAAGCACGAGAGTGG - Intronic
1013492359 6:110660742-110660764 GAGGAGAAGCAGCTGGAGGTTGG - Intronic
1016472920 6:144393701-144393723 TAGAACAGGCAGAAGGAGGTGGG + Intronic
1017326694 6:153149230-153149252 CAAGAGAGGAAGCAGGAGGTAGG + Intergenic
1019038611 6:169084087-169084109 TAGGAGAGGCTGCAGGAGACAGG - Intergenic
1019221475 6:170476649-170476671 TAGAAGAGGCAGCATGGGCTTGG + Intergenic
1020406777 7:7844409-7844431 TAGCAGAGGCATAACTAGGTAGG - Intronic
1022591798 7:31670866-31670888 GAGGAGAAGCAGCTGGAGGTCGG + Intergenic
1026140308 7:67699943-67699965 TATGACAGGCTGCAGGAGGTAGG + Intergenic
1027579070 7:79970316-79970338 TAGAAGGGGCAGCAGGAGATAGG + Intergenic
1028172716 7:87618018-87618040 TAGGTAAAGCAGCTCGAGGTAGG - Intronic
1029103373 7:98153051-98153073 CAGGAGAGGCAGGAGGAAGTCGG + Intronic
1029704403 7:102268467-102268489 GAGAAGAGGCAGCAGGAGGCAGG - Intronic
1033820195 7:145125790-145125812 CAGGAGAGAGAGCACGAAGTGGG + Intergenic
1034152150 7:148925475-148925497 GAGGAGAGGCAACATGAGGACGG + Intergenic
1034162091 7:149001478-149001500 TAGGAGAGGCAGGGCCAGGTTGG - Intergenic
1034946641 7:155266700-155266722 TGGGAGGGGCAGCTGGAGGTTGG + Intergenic
1035583848 8:757111-757133 GAGGAAAAACAGCACGAGGTGGG - Intergenic
1037122399 8:15304579-15304601 TATGAGAGGAAACACCAGGTGGG + Intergenic
1037893205 8:22635040-22635062 CAGGAGAGGCAGCAGGAGGGTGG - Intronic
1047769951 8:128022585-128022607 AAGGAGAGGCAGCAAGAACTTGG - Intergenic
1049558185 8:143294087-143294109 CAGGAGGGGCAGCAGGAGGAGGG - Intronic
1049708204 8:144052372-144052394 TAGGAGCGGGAGGGCGAGGTGGG - Intronic
1051507724 9:17844267-17844289 TAGGAGAGGTAGGACCAGGGAGG - Intergenic
1053489028 9:38486244-38486266 TAGGAAAGGCAGCACAGGGGGGG - Intergenic
1055706506 9:79010963-79010985 GAGGAGAGCCAGCACCATGTTGG - Intergenic
1058472939 9:105299719-105299741 TAGGACAGGCAGAAGGAGGAAGG - Intronic
1062070331 9:134552023-134552045 GAGCAGAGTCAGCAGGAGGTGGG - Intergenic
1187056230 X:15743748-15743770 CAGGGGATGCAGCAGGAGGTGGG - Intronic
1188475732 X:30589665-30589687 CAGGAGAGAAAGCAAGAGGTGGG + Intergenic
1189211425 X:39287260-39287282 AGGGAGAGGCAGCACGAAGAAGG + Intergenic
1192212703 X:69137711-69137733 TGGGAGAGGCAGCCTGGGGTGGG - Intergenic
1199408576 X:147492717-147492739 GAGGAGAGGCAACACTAGGCAGG + Intergenic
1201416166 Y:13751450-13751472 TAGGAGGGGCAGGAAGCGGTTGG + Intergenic