ID: 1138532892

View in Genome Browser
Species Human (GRCh38)
Location 16:57644624-57644646
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 610
Summary {0: 2, 1: 3, 2: 17, 3: 80, 4: 508}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900080720 1:855204-855226 ACACATGCACACATACGCTTTGG - Intergenic
900098436 1:950088-950110 ACACAGGCGCACACATGCACAGG + Intronic
900430747 1:2602032-2602054 CCACAGGCACACACAGGCATGGG + Intronic
900555394 1:3277823-3277845 GCACATGCACACACGTGCACAGG + Intronic
900803146 1:4749947-4749969 AAACATACACACACATGAATGGG - Intronic
900803164 1:4750189-4750211 ACACACGCACACACAAACATGGG - Intronic
900852985 1:5158259-5158281 ACACAAGCAAACTAATGCAAAGG - Intergenic
900898115 1:5497990-5498012 ACATCTGCACACTCATGCATGGG - Intergenic
901563331 1:10090784-10090806 ACACACACACACAAATGCATAGG - Intronic
901815433 1:11790927-11790949 ACACATGCACACACACACAGAGG + Intronic
901958686 1:12807623-12807645 TCACATGCAGACAAATGCATGGG - Intergenic
903352196 1:22724229-22724251 ACACACACACACACATGCAAGGG - Intronic
904979614 1:34486636-34486658 ACACATGCACACACACACACAGG - Intergenic
905254453 1:36671228-36671250 CCACATGGACAGTCATGCAAAGG - Intergenic
905446795 1:38032865-38032887 TCCCATGCACACACATGCAGAGG - Intergenic
905812679 1:40924217-40924239 ACACACACACACACAAGCATGGG - Intergenic
906275727 1:44513777-44513799 ACACACGCGCACACATGCAGAGG - Intronic
906342795 1:44995631-44995653 ACACATGCACACACACACACAGG + Intergenic
907745654 1:57210845-57210867 ATACATGCATACACATGCATAGG - Intronic
907871523 1:58448010-58448032 CCACATGCAGCCTCATGCAATGG + Intronic
908369275 1:63465204-63465226 ACATGTGCACACACATACATAGG - Intronic
909136669 1:71809727-71809749 ACACATACACACACACACATTGG - Intronic
909287674 1:73840345-73840367 ACACATGCAAACACAGACATAGG + Intergenic
910031642 1:82732871-82732893 ACACATGGACACACAATCATGGG - Intergenic
910264689 1:85326026-85326048 AGACATGCCCACTCAGTCATGGG + Intronic
911291819 1:96065636-96065658 ACATATTCTCACTCATACATAGG - Intergenic
911455743 1:98121058-98121080 ACACATTCACACACATGGACAGG - Intergenic
912951457 1:114123416-114123438 ACCCCTGCACCCACATGCATGGG - Intronic
913081013 1:115387202-115387224 TCACATGCAAAGACATGCATAGG - Intergenic
913118769 1:115720449-115720471 ACCCATGCAAATTCATACATTGG - Intronic
914968338 1:152282016-152282038 ACACATCCATGCTCATGGATGGG + Intergenic
915010738 1:152683889-152683911 ACACATGCACACACACACACAGG + Intergenic
915767869 1:158385014-158385036 ACACAAGCACACACATACACTGG - Intergenic
915780696 1:158546995-158547017 ACACATGCACACACACACAGAGG + Intergenic
915830078 1:159119773-159119795 ACACATGCACACACACACATAGG - Intronic
916178061 1:162059472-162059494 ATACATATACACACATGCATGGG + Intergenic
916834417 1:168528791-168528813 ACACATACACACATATGCTTTGG - Intergenic
917231060 1:172838655-172838677 ACAAATGCACATTCTTGCTTTGG - Intergenic
917367666 1:174250833-174250855 GCACATGCACACTCCAGCCTGGG - Intronic
917647843 1:177046667-177046689 ATACATGCACACACATGCAGAGG + Intronic
918302748 1:183218966-183218988 TTACATGCACACACATGAATGGG + Intronic
918539253 1:185610515-185610537 ACACGTGCTCACTTATTCATAGG + Intergenic
919199294 1:194332728-194332750 ACACATACACATACATACATCGG + Intergenic
919204195 1:194399352-194399374 ACACACACACACACATACATAGG + Intergenic
920185673 1:204157695-204157717 ACACATGCACATGTGTGCATGGG + Intronic
920241415 1:204554385-204554407 ACACATGCACACTCATGACTGGG - Exonic
920542764 1:206791922-206791944 ACACACACACACACATGCACAGG - Intergenic
920659006 1:207899237-207899259 ACACATGCACACCCATGTTTTGG - Intronic
921342236 1:214145684-214145706 ACATATGCACACATATGCACAGG + Intergenic
922218664 1:223541089-223541111 ACACACACACACACATGCTTTGG - Intronic
922743777 1:228031591-228031613 ACACATGCACACACATGCACAGG - Intronic
922852407 1:228744755-228744777 ACTCATGCACACAGATACATAGG + Exonic
922974296 1:229770869-229770891 GCACATGCTCACACATGCAGAGG - Intergenic
923945075 1:238876347-238876369 ACACATTCACACACATACAACGG - Intergenic
924367996 1:243317198-243317220 ACACATACAAACTAATGCCTGGG - Intronic
1063103334 10:2970815-2970837 ATACATGCAAACACATGTATAGG - Intergenic
1064168267 10:13005064-13005086 ACACATGGACACTGATTCGTGGG - Intronic
1065183327 10:23148449-23148471 CCACATGCACACACACGCACAGG - Intergenic
1065209051 10:23385112-23385134 ACACATGCACACATATGGAGAGG + Intergenic
1065418209 10:25512155-25512177 ACACATTCATGCTCATGGATTGG - Intronic
1065481138 10:26194911-26194933 ACACATACACATCCATACATGGG + Intronic
1065950598 10:30647313-30647335 ACACGTTTACACTCATGCGTGGG - Intergenic
1066282751 10:33933670-33933692 ACACATGCACACACACACAATGG + Intergenic
1066686849 10:37989814-37989836 ACACATGCACAGCCAGACATTGG - Intergenic
1067094343 10:43288790-43288812 AGACATCCACATTCATGGATTGG + Intergenic
1068996652 10:63213537-63213559 ACACATGCATACTCAGGACTTGG - Exonic
1069748503 10:70731245-70731267 ACACATGTACATGCATGCACAGG + Intronic
1070432636 10:76356663-76356685 ACAGATGTACACGCATACATAGG - Intronic
1071337122 10:84609828-84609850 ACACAAGCACACACATGCATAGG + Intergenic
1071677623 10:87670590-87670612 ACACACACACACTCATGCTGAGG + Intronic
1073093435 10:100965082-100965104 ACACACACACACACATTCATAGG - Intronic
1073617684 10:105013995-105014017 ACACACACACACACAGGCATGGG + Intronic
1074645804 10:115450644-115450666 AAACATCCAGACTCATGGATAGG + Intronic
1074857305 10:117482945-117482967 ACACAAGCACACGCATTAATAGG - Intergenic
1075397051 10:122134889-122134911 AAACATGCAGTCTCAGGCATGGG - Intronic
1075450790 10:122550795-122550817 ACACATGCACACACACACACAGG + Intergenic
1075563921 10:123489655-123489677 ACACATATACACTCATGCAATGG - Intergenic
1075947668 10:126451710-126451732 ACACATACATACACATGCAACGG + Intronic
1076278683 10:129226497-129226519 ACACATGCACACCCATAAATGGG - Intergenic
1076438446 10:130462721-130462743 GCACACACACACACATGCATGGG - Intergenic
1076599622 10:131648752-131648774 ACACGTGCACACACATGTAAAGG + Intergenic
1076856936 10:133121575-133121597 GCACAGGCACACACATGCACAGG - Intronic
1077324932 11:1959589-1959611 ACACAGGCTCTTTCATGCATGGG + Intronic
1077370302 11:2178728-2178750 ACACATGCACATGCATACATAGG - Intergenic
1077600006 11:3568050-3568072 ACACATACACACTCAGGCTCAGG + Intergenic
1077716896 11:4590134-4590156 ACACATGAACACACCTACATAGG - Intergenic
1078968854 11:16381806-16381828 ACACATACACACACAGGCAGAGG + Intronic
1079451459 11:20602711-20602733 ACACATTCACACTTATCCACAGG + Intronic
1079615551 11:22488228-22488250 ACAAATGCACACAAATGAATAGG - Intergenic
1079704737 11:23600154-23600176 ACACATCCATACTCATGGATGGG - Intergenic
1079879607 11:25908621-25908643 ACACATGCACACACAGGTTTGGG + Intergenic
1081075432 11:38667576-38667598 ACACATGCCCACTCGTGCTTCGG - Intergenic
1081299437 11:41432648-41432670 AAACATACACACACATGCACAGG + Intronic
1081412599 11:42777355-42777377 ACACATGCATACACACGCACAGG + Intergenic
1082886241 11:58086043-58086065 AATCATGCACACTAATGCCTTGG + Intronic
1083209302 11:61172947-61172969 GCACATGCCAACTCATGCACCGG - Intergenic
1083747506 11:64744169-64744191 ACACATGCACACACCCCCATGGG + Intronic
1084389631 11:68866591-68866613 ACACATGCGCACACACGCACAGG + Intergenic
1084725302 11:70937948-70937970 ACACATGCACACACACACACAGG - Intronic
1086759531 11:90610912-90610934 CCACATGCACACACATGCCCAGG - Intergenic
1087139527 11:94751806-94751828 ACACACGCACACACACACATAGG + Intronic
1087923293 11:103891646-103891668 ACACACACACACACATGCAAAGG + Intergenic
1090064733 11:123492880-123492902 ACACACACACACACACGCATAGG + Intergenic
1090302556 11:125657180-125657202 ACACACACACACACAAGCATAGG - Intronic
1090339929 11:126008762-126008784 ACACACGCACATTCATTTATAGG + Intronic
1090924295 11:131236066-131236088 ACACATGCACACATGTGCACAGG - Intergenic
1091025952 11:132141559-132141581 GCACATGCTCACTCATGCATGGG - Intronic
1091057998 11:132436789-132436811 ACACACACACACACATGCACAGG + Intronic
1202807914 11_KI270721v1_random:14768-14790 ACACAGGCTCTTTCATGCATGGG + Intergenic
1091452340 12:581074-581096 ACACATGCACACACACACAGAGG - Intronic
1091452341 12:581134-581156 ACACATGCACACACACACAGAGG - Intronic
1091859983 12:3772406-3772428 AAACACACACACTCATGCCTAGG - Intergenic
1092071672 12:5636638-5636660 ACACACACACACGCATGCACAGG + Intronic
1092121395 12:6046527-6046549 ACACATGCAAAGACATGCCTTGG + Intronic
1092601723 12:10073459-10073481 TCACATGTACAGACATGCATGGG + Intronic
1093546178 12:20351929-20351951 AGAAATGCAAACTCTTGCATGGG - Intergenic
1093863810 12:24200526-24200548 AAACACGCACACTCATATATAGG + Intergenic
1095331128 12:40966028-40966050 ACACACACACACGCACGCATTGG + Intronic
1095432257 12:42146201-42146223 ACACACGAACACACATTCATGGG + Intergenic
1095957546 12:47815321-47815343 ACACATGCACACACACACACAGG + Intronic
1098407992 12:70147164-70147186 ACACACACACACACAGGCATAGG + Intergenic
1098799429 12:74935194-74935216 ACACATACACACTGAAACATGGG - Intergenic
1099509893 12:83521300-83521322 AGACATGCACACTCATGTTAAGG - Intergenic
1100147018 12:91690743-91690765 ACACATGCAGAGCCACGCATGGG + Intergenic
1100472832 12:94908942-94908964 AACCAAGCACACTCCTGCATTGG + Intronic
1101283351 12:103282983-103283005 ACACATGCACACACACACAAAGG + Intronic
1102561196 12:113763447-113763469 ATACATGCATACACATGCATGGG - Intergenic
1104158311 12:126154357-126154379 ACACACACACACACAGGCATGGG + Intergenic
1106002075 13:25733424-25733446 ACGCATGCACACACAGGTATGGG - Intronic
1106229937 13:27813975-27813997 ACACACACACACACATGCACAGG + Intergenic
1106403190 13:29449337-29449359 ACACATACACACACATACAGTGG + Intronic
1106843257 13:33708919-33708941 AATCATGCACACTAATGCCTTGG - Intergenic
1107040381 13:35941551-35941573 ACACATGCACACACGTGCACAGG + Intronic
1107717438 13:43214830-43214852 CCACATGCATACACATGGATTGG - Intronic
1108323579 13:49308608-49308630 ACACAGCCACACACATGCAATGG + Intergenic
1108464293 13:50698862-50698884 ACACATGTACATACATACATTGG + Intronic
1108976970 13:56457683-56457705 ACACATACACACACGTGCATAGG + Intergenic
1109433272 13:62264497-62264519 ACACACACACACACACGCATTGG + Intergenic
1109824554 13:67700997-67701019 ACACATCCATATTCATGGATCGG + Intergenic
1110063369 13:71069020-71069042 ACACATGCACACACATGTTCAGG - Intergenic
1110707814 13:78614825-78614847 ACACATACACACACACGCAGAGG + Exonic
1111416683 13:87956226-87956248 ACACATACACACACAGGCATGGG + Intergenic
1111548311 13:89774027-89774049 ACACATGCACACACACACATTGG - Intergenic
1112827333 13:103406837-103406859 ACATATGTACATACATGCATAGG + Intergenic
1113558967 13:111262397-111262419 ACACATGCACACACACACACAGG - Intronic
1115665299 14:35538337-35538359 ACAAATCAACACTCATGGATAGG + Exonic
1115924430 14:38414731-38414753 ACACATGCAAAGACATACATAGG + Intergenic
1115947689 14:38681157-38681179 ACACATCCACACTCATGAACTGG - Intergenic
1117016500 14:51523694-51523716 ACACATGATAACTCATGCATAGG + Intronic
1117298698 14:54402293-54402315 ACACACGCACACACATGCCATGG - Intronic
1119924312 14:78477904-78477926 ACACACGCACACACATACACAGG + Intronic
1120217154 14:81692411-81692433 ACACACACACACACATGCACAGG - Intergenic
1120624947 14:86813676-86813698 TCACATGCAAAGACATGCATAGG - Intergenic
1120704963 14:87736189-87736211 ACACATGCACACACACACACAGG + Intergenic
1120788700 14:88559762-88559784 ACACACGCACACACGTGCAAAGG + Intergenic
1120897488 14:89546763-89546785 ACACATACACACATATACATAGG + Intronic
1121426827 14:93858319-93858341 ACACACACACACACATGCACAGG - Intergenic
1122047302 14:99033363-99033385 ACACACACACACATATGCATAGG + Intergenic
1122477256 14:102019096-102019118 ACACATACATACACATGCATAGG - Intronic
1123108402 14:105853819-105853841 ACACATGTACAAACATGCACAGG - Intergenic
1123185150 14:106509471-106509493 GCAAATGCAAACACATGCATGGG - Intergenic
1123587929 15:21775414-21775436 ACACATGCACACACACGCACAGG + Intergenic
1123624567 15:22217979-22218001 ACACATGCACACACACGCACAGG + Intergenic
1124069400 15:26377699-26377721 ACACATGCACCCTCTTGCCATGG + Intergenic
1124098954 15:26675442-26675464 ACACACTCACACACATGCACAGG - Intronic
1128089270 15:64908183-64908205 AAACAGGCACCCTCATACATTGG + Intronic
1128272625 15:66324623-66324645 AAATATGCACTCTCATACATTGG - Intronic
1128524920 15:68405920-68405942 ACACAGACACACACATGCACAGG + Intronic
1129152807 15:73699660-73699682 CCACATGCACACCCATGCCAGGG - Exonic
1129227324 15:74177618-74177640 ACACACACACACACATGCACTGG - Intergenic
1129453997 15:75666873-75666895 ACACATGCACACGTATCCACAGG - Intergenic
1129691870 15:77718361-77718383 TCACATGCACAGCCATGCGTGGG - Intronic
1129706258 15:77796222-77796244 ACACATGTACTCTCATTCACTGG + Intronic
1130913626 15:88288200-88288222 ACACATGCAAACACATACACAGG + Intergenic
1131068148 15:89447571-89447593 ACACAGGCACACGCAGGCCTGGG + Intergenic
1131456483 15:92586113-92586135 ACACATGCACTCTCATGTCATGG - Intergenic
1131463070 15:92633570-92633592 ACACACGGACACACAGGCATGGG + Intronic
1131855592 15:96590297-96590319 GCACATGCACACACATGATTAGG + Intergenic
1132505455 16:306125-306147 ACACATGCCCACACATGCGCAGG + Intronic
1132704679 16:1238045-1238067 ACACATGCACACTCACACACAGG - Intergenic
1133723278 16:8514854-8514876 ATACATATACACTCATACATAGG + Intergenic
1133899302 16:9958424-9958446 ACACATGCACACACACACACAGG + Intronic
1134505073 16:14798618-14798640 ACACATACACACACACACATTGG + Intronic
1134575502 16:15330295-15330317 ACACATACACACACACACATTGG - Intergenic
1134726943 16:16426201-16426223 ACACATACACACACACACATTGG + Intergenic
1134884593 16:17778446-17778468 ACACCTGCACGCACATACATGGG + Intergenic
1134940494 16:18285654-18285676 ACACATACACACACACACATTGG - Intergenic
1135753143 16:25073112-25073134 ACTCATGCACACTCAGGAAAAGG - Intergenic
1137356675 16:47773072-47773094 TCACATGCAAACACACGCATAGG - Intergenic
1137620698 16:49874781-49874803 ACACAGCCACACCCATGCATGGG - Intergenic
1137869757 16:51938646-51938668 ACACACACACACACATACATAGG + Intergenic
1138532868 16:57644246-57644268 ACACATGCACAGTCATGCACGGG + Intronic
1138532872 16:57644313-57644335 ACACAAGGACATTCATGCATGGG + Intronic
1138532877 16:57644388-57644410 ACATATGCACACTAATGCATGGG + Intronic
1138532884 16:57644490-57644512 ACATATGCACACTCATGCATGGG + Intronic
1138532892 16:57644624-57644646 ACACATGCACACTCATGCATGGG + Intronic
1138532895 16:57644682-57644704 GCACAAGCACACACATGCACGGG + Intronic
1138532902 16:57644774-57644796 ACATATGCACACTCATGCATGGG + Intronic
1138532909 16:57644870-57644892 ACACATGTACACTCATGCATGGG + Intronic
1138532911 16:57644921-57644943 GCACACACACACTCATGCACGGG + Intronic
1138532921 16:57644992-57645014 ACACATGCACACTCATGCATGGG + Intronic
1138767369 16:59620423-59620445 ACACATGCACACCCATATAAAGG - Intergenic
1138810268 16:60140804-60140826 ACACACACACACACATTCATCGG + Intergenic
1138840818 16:60503031-60503053 ACACATACACACACATGCTTGGG - Intergenic
1138900789 16:61267393-61267415 ACTCATACAAACTCATGCAAAGG - Intergenic
1138956233 16:61973616-61973638 CCACATGCACAGTAATGCAAAGG + Intronic
1139209081 16:65058476-65058498 ACACATACACAGTCATCCCTGGG + Intronic
1139230721 16:65279773-65279795 ACACACCCACACTCATTCATTGG + Intergenic
1140622723 16:76755602-76755624 ACACATGCATACTTATACTTGGG + Intergenic
1141136792 16:81471472-81471494 AGACATGCACACAGATACATAGG + Intronic
1142075173 16:88113820-88113842 ACACATGCAGCCTCTTGCTTTGG + Intronic
1142259105 16:89034145-89034167 GCACACACACACTCAAGCATGGG + Intergenic
1142259137 16:89034411-89034433 TCACATGCACACTCACACGTGGG + Intergenic
1142309536 16:89304376-89304398 ACACATGCAAACGCACACATGGG + Intronic
1142309553 16:89304552-89304574 ACACGGGCACACACATACATGGG + Intronic
1142866936 17:2796875-2796897 AGACACGCACACACATACATGGG - Intronic
1143857128 17:9860261-9860283 ACAAATGCACACATATGCACAGG + Intronic
1144709257 17:17389655-17389677 ACACACACACACACACGCATAGG - Intergenic
1145253675 17:21311053-21311075 ACACATGCACACACACGCAGTGG + Intronic
1145322911 17:21776908-21776930 ACACATGCACACACACGCAGTGG - Intergenic
1145828975 17:27899498-27899520 ACACATGCACACTGATCAAATGG - Intergenic
1145903146 17:28500899-28500921 ATACGTACACACTCATGCAGAGG + Intronic
1146440104 17:32886519-32886541 ACACACGCACACACACGCAGAGG - Intergenic
1146544268 17:33724848-33724870 ACACATACACACTCACACATTGG + Intronic
1147266386 17:39237261-39237283 ACACATACGCACACATGCACTGG - Intergenic
1147442011 17:40453153-40453175 GCACATGCACATTTGTGCATCGG - Intronic
1148694957 17:49553213-49553235 ACACATGTACACACTTGCACAGG + Intergenic
1149536954 17:57440701-57440723 TCACATCCACACCCATGCACAGG - Intronic
1153275910 18:3367643-3367665 ACCTATTCACACTAATGCATTGG + Intergenic
1153667738 18:7381498-7381520 ACACATGTGCACACATGCACAGG + Intergenic
1155502058 18:26496752-26496774 ACACACACACACACACGCATTGG + Intronic
1155848407 18:30737998-30738020 ACACATGCACATACACACATAGG + Intergenic
1155949328 18:31892258-31892280 ACACATGCACATACATATATAGG - Intronic
1156157326 18:34318701-34318723 ACACATGCACACATGTGCACAGG + Intergenic
1156799932 18:41098087-41098109 ATACATTCACACACATGTATGGG + Intergenic
1156840273 18:41602840-41602862 ACACACACACACACATGCACAGG + Intergenic
1157393458 18:47322396-47322418 ACACATGCACTCACATGCCAAGG - Intergenic
1157945532 18:51975556-51975578 ATACTTGCACACTCATGTTTAGG + Intergenic
1157971649 18:52276710-52276732 ACACATGCACACTTATACCAAGG - Intergenic
1158332231 18:56375371-56375393 TCACACCCACGCTCATGCATGGG - Intergenic
1158558177 18:58492214-58492236 ACACATGCACACACATACACAGG + Intronic
1158897098 18:61924564-61924586 ACAGATGTGCACTCATTCATGGG + Intergenic
1159202394 18:65204258-65204280 ACACACACACACGCATGCACCGG - Intergenic
1159330622 18:66990353-66990375 ACAGATCCACATTCTTGCATAGG + Intergenic
1159639902 18:70851414-70851436 ACACATGTACACTCATATTTTGG - Intergenic
1159751836 18:72312378-72312400 AAATGTGCACACTAATGCATAGG + Intergenic
1160014013 18:75127281-75127303 GCACACTCACACTCATGCAAAGG - Intergenic
1160109151 18:76008439-76008461 ACACAAACACACTCAGGCACTGG + Intergenic
1160122962 18:76146819-76146841 ACACATGCACACACTCTCATAGG - Intergenic
1160389577 18:78519868-78519890 ACACAGAAACACACATGCATAGG + Intergenic
1160542326 18:79630983-79631005 ACACAAGCACACACATGCACAGG - Intergenic
1161227973 19:3156446-3156468 ACACATGCACACGCACACACAGG + Intronic
1161227976 19:3156516-3156538 ACACATGCACGCACACGCACAGG + Intronic
1161353764 19:3807745-3807767 ACACATGGACATGCATGCACAGG - Intronic
1161353787 19:3808044-3808066 ACACATGCACGCACACGCACGGG - Intronic
1161701745 19:5799692-5799714 ACACATACAGAGTCATACATAGG - Intergenic
1161707780 19:5830089-5830111 ACACATGCACACTGTGGCAGGGG - Intergenic
1161972807 19:7592246-7592268 ACACACACACACACATACATAGG - Intergenic
1162064775 19:8118747-8118769 ACACTTGCACGCTCACACATAGG + Intronic
1162926851 19:13934766-13934788 ACCCATGCACACTTATGCACAGG - Intronic
1162926854 19:13934834-13934856 TCACATGCACACTTATGCACAGG - Intronic
1162969320 19:14170583-14170605 ACACATGTGCACACATGCATGGG - Intronic
1164829052 19:31306533-31306555 GCGCATGTGCACTCATGCATGGG + Intronic
1165120308 19:33554592-33554614 ACACATGCACACTCTCACAGGGG + Intergenic
1166854763 19:45777998-45778020 ACAGATGCACACTTAAGCCTGGG + Intronic
1166872551 19:45879552-45879574 ACACATGCACACACAGTCATCGG + Intergenic
1167762993 19:51461084-51461106 ACACACACACACCCAAGCATTGG - Intergenic
1168323845 19:55527161-55527183 ACTCACACACACTCATGCACAGG + Intergenic
1168477583 19:56688122-56688144 ACACACACACACACATGCACAGG - Intergenic
925067386 2:938988-939010 CCATGTGCACACGCATGCATGGG + Intergenic
925424959 2:3741689-3741711 ACACATACACACACACACATAGG + Intronic
925465036 2:4099560-4099582 ACACATACACACACATACAGAGG + Intergenic
925658726 2:6179980-6180002 ATGCATGCACACACATGCATGGG + Intergenic
925779058 2:7363512-7363534 ACACACGCACACACATATATTGG + Intergenic
925821639 2:7804914-7804936 ACACACACACACACATGCGTGGG + Intergenic
926418256 2:12672126-12672148 ACACACACACACTCATGCTGTGG - Intergenic
927024742 2:19054887-19054909 ACACATCCATGCTCATGGATGGG - Intergenic
928327559 2:30332178-30332200 ACACATGGACACACAAACATGGG - Intergenic
930764015 2:55065665-55065687 ACACATACACACACACGCAAAGG + Intronic
933378908 2:81517808-81517830 ACACATGCACACACACAAATGGG + Intergenic
934791689 2:97067677-97067699 ACACAAACAGACTAATGCATTGG + Intergenic
935440130 2:103083707-103083729 ACACATACACACACATACACAGG + Intergenic
936247152 2:110838102-110838124 ACACATGCACACTCATATATAGG - Intronic
936249147 2:110854088-110854110 AGACATGCACACACATGCCTTGG - Intronic
936292905 2:111240271-111240293 ACACATGTGCACTCACACATGGG - Intergenic
936979170 2:118248487-118248509 ACACACGCACACACATCCCTTGG - Intergenic
937120683 2:119438239-119438261 ACACATGCACACACGGGCCTTGG - Exonic
937629197 2:124080489-124080511 ACACACCCACATTCATGCAGCGG - Intronic
937840108 2:126516440-126516462 ACACATTCACACACATGCAATGG - Intergenic
939223525 2:139335828-139335850 ACACATGCACACTCTTCATTTGG + Intergenic
939592512 2:144082896-144082918 ACACACACACACACATGCACAGG + Intronic
939846731 2:147255548-147255570 ACAAATGCACACTCACAAATGGG + Intergenic
941440566 2:165529613-165529635 ATACATATACACACATGCATAGG + Intronic
942573687 2:177339761-177339783 ACACATACACACACATACACTGG - Intronic
943524192 2:188996239-188996261 ACACACACACACTCAAGGATAGG - Intronic
943925606 2:193774704-193774726 ACATGTTCTCACTCATGCATGGG + Intergenic
944569212 2:201026073-201026095 TCACATGCAAAGACATGCATAGG + Intronic
945287618 2:208098048-208098070 ACACTTGCTCACTGCTGCATGGG + Intergenic
945648793 2:212536185-212536207 ACACAGCCACACACATACATAGG + Intronic
945702251 2:213186619-213186641 AGACATGTAAACTCATGCAAAGG - Intergenic
946477899 2:220026308-220026330 ACACATACACACTCACACATCGG - Intergenic
947641886 2:231711494-231711516 ACACATACACACACATATATAGG - Intronic
948097128 2:235344133-235344155 ACACATGCACACTCATACACAGG + Intergenic
948097150 2:235344431-235344453 ACACCTGCACACTCTTGCACAGG + Intergenic
948463775 2:238142700-238142722 ACACATGCACTCACATGCTGAGG + Intronic
948496477 2:238353216-238353238 ATACATGCACACTCGTGCCCAGG - Intronic
948508708 2:238448713-238448735 ACACCACCACACTCACGCATGGG - Exonic
1169241680 20:3986622-3986644 CTGCATGCACACTCATGCCTGGG - Intronic
1169575448 20:6955246-6955268 ACACATGCACACATACACATGGG - Intergenic
1169725111 20:8720179-8720201 ACACAAGCACCCACATGCAAAGG - Intronic
1170048759 20:12115957-12115979 AAACATGCAAACACATGCATAGG - Intergenic
1170822350 20:19765363-19765385 ACACATGCACACTGATCCCTGGG + Intergenic
1170906787 20:20523272-20523294 ACACATACACACTGATGACTAGG - Intronic
1170967587 20:21089087-21089109 ACACATGCACACACATACACGGG - Intergenic
1171320872 20:24243010-24243032 ACACATGCACACACAAACACAGG + Intergenic
1172846532 20:37932863-37932885 ACACATTCACAAACACGCATTGG + Intronic
1172881766 20:38204998-38205020 ACACACGCACACACATACAATGG - Intergenic
1172931746 20:38591333-38591355 ACACATGCACACTCATACAGAGG + Intergenic
1173124359 20:40322989-40323011 ACACAGCCACACTCATTCATAGG + Intergenic
1173368206 20:42408379-42408401 ACACATACACACACACGCACGGG - Intronic
1173576842 20:44117573-44117595 AGAAATGCACATTCATTCATGGG + Intronic
1173732651 20:45339352-45339374 ACACACGAACACACATGCCTGGG - Intronic
1174862886 20:54108717-54108739 AGACATGCACACACATACAACGG - Intergenic
1174975698 20:55330873-55330895 ACACATTCAGTATCATGCATTGG + Intergenic
1175438263 20:58971074-58971096 ACACATTCTCACTCATACATGGG + Intergenic
1175705181 20:61171476-61171498 ACTCATGCACACTCAGGCACTGG + Intergenic
1175728113 20:61333223-61333245 ACGCATGCACACATATGCACAGG + Intronic
1175745493 20:61454147-61454169 ACACAGGCAGACTCATGCTGCGG - Intronic
1176228989 20:64021228-64021250 ACACACGCACACACAGACATGGG - Intronic
1176229010 20:64021453-64021475 ATACATGCACACACATGCACGGG - Intronic
1176229024 20:64021604-64021626 ACACACGCACACACAGACATGGG - Intronic
1176336727 21:5605980-5606002 AAAGATGCACAGTCATGGATAGG + Intergenic
1176391030 21:6214968-6214990 AAAGATGCACAGTCATGGATAGG - Intergenic
1176470389 21:7101206-7101228 AAAGATGCACAGTCATGGATAGG + Intergenic
1176493950 21:7482984-7483006 AAAGATGCACAGTCATGGATAGG + Intergenic
1176506692 21:7655399-7655421 AAAGATGCACAGTCATGGATAGG - Intergenic
1177613026 21:23477794-23477816 ACACACACACACACATGCAGGGG - Intergenic
1177676158 21:24302670-24302692 ACACAGACACACACATACATGGG - Intergenic
1178893672 21:36541900-36541922 ATACATGCACACACATGATTGGG - Intronic
1179094667 21:38302070-38302092 ACACACGCACACACTTGCACAGG + Exonic
1179174360 21:38996594-38996616 ACACATGCACACACATTCATGGG - Intergenic
1179326937 21:40356022-40356044 ATACATATACACACATGCATAGG - Intronic
1179339204 21:40488547-40488569 ACACATGCACAGTCAAGAAGAGG + Intronic
1179532024 21:42026184-42026206 GGACATGCACACTCAACCATCGG - Intergenic
1179651133 21:42809636-42809658 ACACATGCACATGCACGCATAGG + Intergenic
1180172852 21:46069207-46069229 ACACATGCACACACATGGACTGG - Intergenic
1180195818 21:46193354-46193376 ACACATACATACGCATGCACAGG - Intronic
1180195825 21:46193475-46193497 ACACATACATACGCATGCACAGG - Intronic
1180195846 21:46193715-46193737 ACACATACATACGCATGCACAGG - Intronic
1181003979 22:20000979-20001001 ACACAAGCACACCCAGGCACAGG + Intronic
1181861851 22:25825077-25825099 ACACGTGCACACATATGCACAGG + Intronic
1181950943 22:26553281-26553303 AGAAGTGCACACTCATGCATAGG + Intronic
1182118421 22:27771634-27771656 ACACAGCCACACCCATCCATTGG + Intronic
1182829624 22:33294479-33294501 ACAGATGCACACTCCAGCACAGG - Intronic
1183240036 22:36650840-36650862 CCACAGGCACACTCCTGCCTCGG + Intronic
1183700964 22:39450787-39450809 ACACATGCACACGCTTCCACAGG + Intergenic
1184241815 22:43214994-43215016 ACACGTGCACACACAGGCATGGG - Intronic
1184397396 22:44250958-44250980 ACACATTCCCACTAATGCAAAGG - Intronic
1184924684 22:47629096-47629118 ACACATGCACATGCACCCATGGG - Intergenic
1184990631 22:48167065-48167087 ACTCATGCACACACATGCACGGG + Intergenic
1185204069 22:49527624-49527646 ACAGATGCACAAACATGCACAGG + Intronic
949659195 3:6258015-6258037 ACACACACACACACATACATGGG + Intergenic
952088852 3:29859860-29859882 ATACATACACACATATGCATGGG + Intronic
952303320 3:32123856-32123878 ACACAAGCATAGTCAGGCATGGG - Intronic
952595116 3:35008180-35008202 ACACACACACACTCATACACAGG + Intergenic
952615634 3:35269443-35269465 ACATATACACACACATACATAGG - Intergenic
954072423 3:48152510-48152532 ACACTTGACCACTCAGGCATCGG + Intergenic
955505991 3:59633685-59633707 ACACACACACACACATGCTTAGG - Intergenic
955751810 3:62191110-62191132 ACACACGCACACATGTGCATGGG - Intronic
956038628 3:65122129-65122151 TCACATGCAGAGACATGCATAGG + Intergenic
957670816 3:83300386-83300408 ACACAGGCACACTCATGCACAGG + Intergenic
958506161 3:94979702-94979724 ACACATACACACATATACATGGG - Intergenic
958923762 3:100135421-100135443 ACACATGCACACACACACAAAGG - Intronic
959595674 3:108126085-108126107 ACATAGGCACACACATGCACAGG - Intergenic
959967499 3:112373436-112373458 ACCCATGCACCCTCTTTCATGGG + Intergenic
960262846 3:115588128-115588150 GAACATGCACACTCCTGCCTTGG + Intergenic
960408290 3:117289103-117289125 ACACACACACACACACGCATAGG - Intergenic
960448114 3:117773062-117773084 ACACACGAACACACATACATAGG - Intergenic
962358748 3:134717368-134717390 ACACATGCACACGTGTGGATGGG - Intronic
962851556 3:139312110-139312132 ACACATGCACACACACACACAGG - Intronic
963956971 3:151264760-151264782 ACACATACACACACACGCACTGG - Intronic
964329014 3:155579925-155579947 ACACATACACACACATGCAGAGG + Intronic
965284395 3:166799635-166799657 ACACATACACACACATATATAGG - Intergenic
965417467 3:168414734-168414756 ACTCATGAAGACTCATGAATGGG + Intergenic
965453185 3:168863795-168863817 ACCCAGTCACACACATGCATGGG - Intergenic
966612760 3:181884345-181884367 ACACATGCACAATCATAAATGGG - Intergenic
966922146 3:184619469-184619491 ACAGATACACACACATGCATGGG + Intronic
967411748 3:189173180-189173202 ACACATGCACACACACACAGAGG - Intronic
967867534 3:194202880-194202902 ACACATCCACACTCACACACAGG + Intergenic
967956382 3:194880640-194880662 ACAAACACACTCTCATGCATTGG + Intergenic
968609225 4:1549557-1549579 ACCCATTCACAGTCAGGCATGGG + Intergenic
968909234 4:3468870-3468892 ACACAGGCACACTCGTACACAGG - Intronic
968909242 4:3469210-3469232 ACACACGCACACTCACACAGAGG - Intronic
969706041 4:8792232-8792254 ACACATGCTCACACACGCAGAGG + Intergenic
969739522 4:9014044-9014066 ACACATACACACTCAGGCTCAGG - Intergenic
969798699 4:9545578-9545600 ACACATACACACTCAGGCTCAGG - Intergenic
970211250 4:13712019-13712041 ACACACACACACTCATACACTGG - Intergenic
970636681 4:18018903-18018925 ACACATGTATACACATGCAAAGG + Intronic
970692657 4:18637569-18637591 ACACATGCACATACACACATAGG - Intergenic
970719767 4:18972801-18972823 TCACAAGCTCACTCATGCCTTGG - Intergenic
971379867 4:26086720-26086742 ACACATGCTCACACATCCAATGG + Intergenic
971502029 4:27328168-27328190 ACACATGCCCACTTAGGCTTTGG - Intergenic
972745091 4:41924633-41924655 ACACATGTACATGCATGCACAGG + Intergenic
972855679 4:43103836-43103858 ACACACTCACACACATGTATAGG - Intergenic
972955126 4:44379543-44379565 ACACATACACACACCTGCAATGG - Intronic
973634617 4:52850566-52850588 ACATATGCACACACATTCTTCGG + Intergenic
973957814 4:56080536-56080558 ACACATGCATGCTACTGCATGGG + Intergenic
974022061 4:56700551-56700573 ACACACACACACACATCCATTGG + Intergenic
974254963 4:59440181-59440203 ACACACACACACACATTCATAGG - Intergenic
975866079 4:78724844-78724866 ACACACACACACACATGAATTGG - Intergenic
975960052 4:79891593-79891615 ACACATGCACACTCACACACAGG + Intergenic
975993289 4:80283539-80283561 GCACACACACACTCATGCACAGG - Intronic
976128935 4:81863688-81863710 ACATATTCTCACTCATCCATGGG + Intronic
976689764 4:87856102-87856124 ACACATGCACACACACACACAGG + Intergenic
976983329 4:91260305-91260327 ACACATACACACCCATGCATGGG + Intronic
977583991 4:98755126-98755148 AAAAATGTACACTCAGGCATAGG - Intergenic
977662408 4:99605862-99605884 ACACACACACACACATACATGGG - Intronic
977765247 4:100789876-100789898 ACACTTGCACACTCACACAGAGG + Intronic
979320918 4:119324107-119324129 ACATATACACACTCATGAGTTGG + Intergenic
979644688 4:123054074-123054096 AATCATGCACACTAATGCCTTGG - Intronic
980528707 4:134022432-134022454 ACACACGCACACAGAAGCATTGG + Intergenic
980621461 4:135311547-135311569 TAACATGCTCACTCTTGCATAGG - Intergenic
980829564 4:138113406-138113428 ACACATAAACACACATACATAGG - Intergenic
981419688 4:144534916-144534938 ACACACACACACACATGCACAGG - Intergenic
981544050 4:145876140-145876162 ATATATGAACACACATGCATAGG - Intronic
983650399 4:170031294-170031316 ACACATGCACACCCCTCCAAGGG - Intronic
985142303 4:186854136-186854158 TCAAATGACCACTCATGCATTGG + Intergenic
985330338 4:188824672-188824694 ACACAGGGACACACACGCATAGG + Intergenic
985848121 5:2368919-2368941 ACACATGCACATACATGCATGGG + Intergenic
985848127 5:2369121-2369143 ACACATGCATATACATCCATGGG + Intergenic
985848138 5:2369341-2369363 ATGCATGCACACACATGCATGGG + Intergenic
985848140 5:2369380-2369402 ACACATGCAAACACATGCATGGG + Intergenic
985848142 5:2369419-2369441 ACACATGCAAACACATGCACGGG + Intergenic
985848144 5:2369458-2369480 ACACATGCAAACACATGCACAGG + Intergenic
985848146 5:2369497-2369519 ACACATGCAAACACATGCACGGG + Intergenic
985873686 5:2578896-2578918 ACACATGCACACACACACAGTGG + Intergenic
985927825 5:3031519-3031541 ACACAGGCACACACACGCACAGG - Intergenic
985958619 5:3282816-3282838 ACACAGGCACAGACATGCACAGG + Intergenic
985958642 5:3283056-3283078 ACACAGGCACAGACATGCACAGG + Intergenic
985958875 5:3284496-3284518 ACACAGGCACAGACATGCACAGG - Intergenic
986081937 5:4403846-4403868 ACACATGCACATACATGCAAAGG - Intergenic
986461865 5:7980741-7980763 ACACACACACACACATGCACAGG + Intergenic
986522560 5:8636297-8636319 ACATGTGCATACACATGCATAGG - Intergenic
986923000 5:12710568-12710590 ACATGTACACACACATGCATGGG - Intergenic
987248854 5:16078981-16079003 ACACGTGCACACTCATATATGGG + Intronic
987927189 5:24357529-24357551 AAACATACACAATCATGCATTGG - Intergenic
989290255 5:39756055-39756077 ACTCATGCTGACTCATGCTTGGG - Intergenic
989972663 5:50543319-50543341 TCACATGCAGACACATGCATAGG + Intergenic
990003653 5:50922277-50922299 ACCCATTCACAGTCAGGCATGGG - Intergenic
991950068 5:71938927-71938949 CCACATGCACACTCATCCCGGGG - Intergenic
991954259 5:71976689-71976711 ACACACACACACACATGCAATGG - Intergenic
991962124 5:72055506-72055528 CCACTTGCACACTCATGCCAAGG + Intergenic
992359622 5:76023810-76023832 ACATATGCCCACATATGCATGGG + Intergenic
992511647 5:77442430-77442452 ACACATGTACACACATACATAGG + Intronic
992768092 5:80021451-80021473 ACACATACACACATATGTATAGG + Intronic
993116779 5:83728544-83728566 ACTCATGCAGATTAATGCATAGG + Intergenic
993507815 5:88732945-88732967 ACACAATCTCACTCATGCAGGGG - Intronic
993649239 5:90498148-90498170 ACACACACACACACATACATGGG - Intronic
994525610 5:100901864-100901886 ACACATACACACACACGCAAGGG + Intronic
996013683 5:118507796-118507818 ACACAAGGACACTCAGGCAGTGG + Intergenic
996244212 5:121240515-121240537 ACACATACAAACACATACATAGG + Intergenic
996307424 5:122064805-122064827 ACACATTTACAATCATTCATTGG - Exonic
996361143 5:122648506-122648528 ACAAATGCACACACATTAATGGG + Intergenic
996450257 5:123613404-123613426 ACACACACACACACATGCACTGG - Intronic
998485510 5:142498507-142498529 ACAAAAGCAAACTCGTGCATGGG - Intergenic
999074634 5:148782271-148782293 ACACAGGCAAACTCATGTTTCGG - Intergenic
999970807 5:156860305-156860327 ACACTTTCACATTCATGCATTGG - Intergenic
1001844258 5:174906653-174906675 TCACATGCAAAGACATGCATAGG + Intergenic
1001935105 5:175698032-175698054 ACCCATGCACACTCAGGCACTGG + Intergenic
1003778326 6:9394732-9394754 AGACATGCACACTCAGCCAGTGG + Intergenic
1005034668 6:21544588-21544610 GCACATGCACACTTCTGCTTTGG - Intergenic
1005240989 6:23826055-23826077 ACACACACACACACAAGCATGGG - Intergenic
1005364582 6:25064330-25064352 AGACATGGACACTCAGGCTTAGG + Intergenic
1007756033 6:44100390-44100412 ACACATACACACTCAGACACAGG - Intergenic
1008648172 6:53537234-53537256 ACGCATGCACACACGTGCAAAGG + Intronic
1010373743 6:75141754-75141776 ATACATGCACACACATACACAGG + Intronic
1010651728 6:78463458-78463480 ACACACACACACACATGCACGGG - Intergenic
1012591090 6:100982421-100982443 ACACATGCACATACATGTACAGG + Intergenic
1012794176 6:103738758-103738780 ACACATCCATGCTCATGGATGGG + Intergenic
1013293953 6:108742284-108742306 ACAAATGCACAGTCATGCAATGG - Intergenic
1013699184 6:112742766-112742788 ACACATTCACACTCATATTTGGG + Intergenic
1013701327 6:112773772-112773794 ACACAAGCACACACCTGCATGGG - Intergenic
1014207781 6:118675106-118675128 ACACATGCACTCACATACAAGGG + Intronic
1014456252 6:121637998-121638020 ACACATACACACAGATACATAGG + Intergenic
1015081965 6:129237775-129237797 AAACAAGTACTCTCATGCATTGG - Intronic
1016096643 6:140045630-140045652 ACACAAACACACTCTTGCCTTGG + Intergenic
1016340993 6:143061101-143061123 ACACACGCACACACAGGCACGGG - Intronic
1016928746 6:149381143-149381165 ATACATGCACACGCATACCTAGG - Intronic
1017655515 6:156624760-156624782 ACAGATGCACAGTCATGCTGAGG - Intergenic
1018117649 6:160603277-160603299 ACACATACTCACACATGCACAGG - Intronic
1018794540 6:167175632-167175654 ACACATGCACACACACACAGAGG + Intronic
1018821781 6:167379435-167379457 ACACATGCACACACACACAGAGG - Intronic
1019601805 7:1887894-1887916 ATGCATGCACACACATGCACAGG - Intronic
1019601824 7:1888143-1888165 ACACATGCACACACATGCACAGG - Intronic
1019601827 7:1888205-1888227 ATGCATGCACACACATGCACAGG - Intronic
1019601831 7:1888243-1888265 ACCCATGCATACAGATGCATAGG - Intronic
1019601832 7:1888273-1888295 ATGCATGCACACACATGCACAGG - Intronic
1019601833 7:1888311-1888333 ACGCATGCACACACACACATAGG - Intronic
1019601835 7:1888341-1888363 ATGCATGCACACACATGCACAGG - Intronic
1019601837 7:1888379-1888401 ACGCATGCACACACACGCATAGG - Intronic
1019601850 7:1888603-1888625 ATGCATGCTCACACATGCATAGG - Intronic
1019769596 7:2875374-2875396 ACACAGTCGCACCCATGCATGGG - Intergenic
1020796408 7:12683016-12683038 ACACATACACACACATACACAGG + Intergenic
1021361293 7:19715947-19715969 ACACACACACTCTCATGCTTAGG - Intergenic
1021639258 7:22722090-22722112 AGACATCCACACACATACATAGG + Intergenic
1022886480 7:34652154-34652176 ACACATGCAAATTCATGGTTTGG - Intergenic
1023374050 7:39538572-39538594 ACACCTCCACACTCAAGCCTGGG + Intergenic
1023787968 7:43727276-43727298 AAAGATGCACACTGATGCTTTGG + Intronic
1024175925 7:46841121-46841143 ACACAACCACTCTCATGCCTGGG + Intergenic
1024970779 7:55068107-55068129 ACACATGCACACACACACACAGG - Intronic
1026180891 7:68039795-68039817 ACACAAGCACACACAAGCACAGG + Intergenic
1027632904 7:80629791-80629813 ACACCTTAACACTCATGTATTGG + Intronic
1028409792 7:90517270-90517292 ACACACCCAAACCCATGCATAGG + Intronic
1030448353 7:109676189-109676211 AAACATGCACACACATGCACAGG + Intergenic
1031765658 7:125773531-125773553 ACACATGCCCACTAGAGCATTGG + Intergenic
1033045684 7:137960405-137960427 ACACATGCACACACACACAGGGG + Intronic
1033739607 7:144260145-144260167 ACGCATGCACACGTATACATAGG + Intergenic
1033991670 7:147295250-147295272 ACGCATGCACACACACACATGGG - Intronic
1034315714 7:150130673-150130695 AGTTATGAACACTCATGCATAGG - Intergenic
1034717594 7:153257601-153257623 ACACATGCACACACAAGCATGGG - Intergenic
1034791176 7:153970131-153970153 AGCTATGAACACTCATGCATAGG + Intronic
1035271130 7:157720570-157720592 CCGCGTGCACACCCATGCATCGG - Intronic
1035720523 8:1787992-1788014 CCACATCCACACTCAGGCATGGG + Intergenic
1035758516 8:2052020-2052042 ACACAAACACACACATGCACAGG - Intronic
1035794296 8:2339146-2339168 TCACATGCAAAGACATGCATAGG + Intergenic
1036508204 8:9375668-9375690 ACACACACACACTCCTACATTGG - Intergenic
1036638250 8:10565974-10565996 ACGCACGCACATGCATGCATGGG - Intergenic
1036960463 8:13239638-13239660 ACATATGCACACTCATACAGGGG + Intronic
1037465112 8:19152122-19152144 ACAAAGGCACATTCATGCTTGGG + Intergenic
1037625480 8:20602632-20602654 AGACATGGACACCGATGCATGGG + Intergenic
1038058762 8:23887858-23887880 ACACATACACACACATACAGAGG - Intergenic
1038333652 8:26629179-26629201 ACACATGTACACACAGACATAGG + Intronic
1039448241 8:37649361-37649383 ACACATGCACAAACACACATGGG - Intergenic
1039664145 8:39504110-39504132 ACACATGCACACACACTCACAGG + Intergenic
1040679272 8:49789099-49789121 ATACATGAACACTCCTGAATGGG + Intergenic
1040784204 8:51146461-51146483 ACATATTCTCACTCATGAATGGG + Intergenic
1040826227 8:51623487-51623509 ACACATGCATGCTCATGCACAGG - Intronic
1041117850 8:54557722-54557744 ACACACCCACACTCATGCACTGG - Intergenic
1041246433 8:55892774-55892796 ATACACACACACTCCTGCATTGG - Intronic
1041453127 8:58028716-58028738 ACACATGCACACACATGGTCAGG - Intronic
1042819171 8:72911415-72911437 ACACATGCACATGCGTGCAGGGG + Intronic
1043282712 8:78488332-78488354 ACACATATACACACATACATTGG - Intergenic
1043307561 8:78815962-78815984 ACACATGCACGCACAAGCAAGGG - Intergenic
1044122990 8:88420820-88420842 ACACACACACACACATACATTGG - Intergenic
1046018068 8:108630093-108630115 TCACATGCAAAGACATGCATAGG + Intronic
1046238218 8:111455245-111455267 ACACATACACACACATACAATGG + Intergenic
1046278032 8:111987834-111987856 TCACATGCAGAGACATGCATAGG + Intergenic
1047525202 8:125627169-125627191 ACACATGCATACTCATACTCTGG + Intergenic
1048636869 8:136306210-136306232 ACTTATTCACACTCATACATAGG - Intergenic
1048870210 8:138791043-138791065 AAACATGCCCACACATTCATGGG - Intronic
1049064233 8:140300361-140300383 ACACATGCACATGCATGAACTGG + Intronic
1050243373 9:3660885-3660907 ACACATGCACACACACACACAGG - Intergenic
1050619649 9:7439518-7439540 ACACAGGCACACTGCTGGATGGG + Intergenic
1051272561 9:15369437-15369459 TCACATGAACACTCATACATTGG - Intergenic
1051431784 9:16986897-16986919 ACACATACACACTCACACAGGGG + Intergenic
1052166242 9:25332580-25332602 AAAACTGCATACTCATGCATCGG + Intergenic
1052425890 9:28303956-28303978 ACACATACACACACATACACAGG - Intronic
1054943004 9:70764214-70764236 AGACATGCACACTCAGACCTAGG + Intronic
1055989774 9:82092970-82092992 ATACATGCACACGTGTGCATAGG - Intergenic
1056068861 9:82964993-82965015 ACATATGCTTACTTATGCATGGG - Intergenic
1057114957 9:92512170-92512192 ATACATGTACACACATGTATGGG + Intronic
1057172333 9:92970260-92970282 ACCCATGCACACCCATGCCCAGG - Intronic
1057294087 9:93825362-93825384 ACACATACACACACATGGAGAGG - Intergenic
1057585276 9:96323303-96323325 ACACATGCACATGAATGAATAGG - Intronic
1057947705 9:99344243-99344265 ACACCTGCTCACTTGTGCATGGG + Intergenic
1057981094 9:99664400-99664422 ACACATGTACACACATGCTTAGG - Intergenic
1059266776 9:113040489-113040511 ACACATGCATACACATGCACGGG - Intronic
1059569604 9:115420512-115420534 AACCATGCACACTCTTGCTTTGG + Intergenic
1060401330 9:123351155-123351177 ACACATGCACACACACCCCTGGG - Intergenic
1061444998 9:130632576-130632598 ACCCATCCCCACCCATGCATAGG - Intronic
1061780707 9:132994572-132994594 ACACATGCACACACACGGATTGG + Intergenic
1062101200 9:134729333-134729355 ACCCATACACACTCCTGCACGGG - Intronic
1062368879 9:136226353-136226375 ACACACGCACACACAGGCACAGG - Intronic
1062522256 9:136963080-136963102 ACACACGCACACACGTGCACAGG + Intergenic
1062562402 9:137147408-137147430 ACACACGCACACACGTGCACAGG + Intronic
1062563601 9:137152866-137152888 ACACATGCAGAATCATGTACAGG + Intronic
1062563608 9:137153015-137153037 ACACATGCAGAATCATGTACAGG + Intronic
1062563617 9:137153175-137153197 ACACATGCACCATCATGTACAGG + Intronic
1062563634 9:137153467-137153489 ACACATGCACCATCATGTACAGG + Intronic
1062609136 9:137365660-137365682 CCACACGCACACACATGCACAGG + Intronic
1203445990 Un_GL000219v1:56874-56896 AGACATGAAAACCCATGCATGGG - Intergenic
1185451840 X:285715-285737 ACACATGCACACTCACATATAGG + Intronic
1186775630 X:12862178-12862200 TCACATGCAGAGACATGCATAGG - Intergenic
1187280719 X:17856845-17856867 ACACATGCACACACAGACACAGG - Intronic
1189507398 X:41625636-41625658 ACACATGCACACCACTGCACTGG + Intronic
1190710998 X:53070331-53070353 ACACACTCACACACATGCAATGG - Intronic
1192210156 X:69122852-69122874 ACATATGCACATGCATGTATAGG + Intergenic
1193575081 X:83186220-83186242 ACACATGCACATACCTGCCTGGG + Intergenic
1193578308 X:83231254-83231276 ACACCTGTCCACTAATGCATGGG - Intergenic
1193904186 X:87223193-87223215 ACACACACACACACATACATGGG - Intergenic
1194037314 X:88892157-88892179 ACACACACACACACATGCCTGGG + Intergenic
1194078106 X:89422665-89422687 ACATATGCACACACATACAATGG + Intergenic
1194611904 X:96054975-96054997 ACACATTCTCACTCATAGATGGG - Intergenic
1196767052 X:119256034-119256056 ACACACACACACTCATACACTGG + Intergenic
1198038855 X:132828734-132828756 ACACATACACACACAAACATAGG + Intronic
1198640681 X:138752583-138752605 AAATATGCACACTCAGGCAGAGG + Intronic
1199436273 X:147815992-147816014 ACACACGCACACACACACATAGG - Intergenic
1199585063 X:149406000-149406022 ACATAAGCACACTCATTCATGGG - Intergenic
1200430752 Y:3078211-3078233 ACATATGCACACACATACAATGG + Intergenic
1200666478 Y:6032132-6032154 AAACATCCATACTCATGGATAGG + Intergenic
1200973741 Y:9184320-9184342 GCATGTTCACACTCATGCATGGG + Intergenic
1200976903 Y:9221410-9221432 ACACATGCACACATGTGCATTGG - Intergenic
1201352548 Y:13060385-13060407 TCACATGCAAAGACATGCATAGG - Intergenic
1201469824 Y:14320616-14320638 ACACATGCACACACACACAATGG - Intergenic
1201603073 Y:15751926-15751948 ATACATGCACATACATGCTTAGG - Intergenic
1202137376 Y:21680474-21680496 GCATGTTCACACTCATGCATGGG - Intergenic
1202172130 Y:22060995-22061017 ACAGATGCACACATGTGCATTGG - Intergenic
1202219232 Y:22525376-22525398 ACAGATGCACACATGTGCATTGG + Intergenic
1202323949 Y:23670689-23670711 ACAGATGCACACATGTGCATTGG - Intergenic
1202546822 Y:25999365-25999387 ACAGATGCACACATGTGCATTGG + Intergenic