ID: 1138533394

View in Genome Browser
Species Human (GRCh38)
Location 16:57647046-57647068
Sequence CTACATCCCTGGCGCCTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 153}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138533384_1138533394 26 Left 1138533384 16:57646997-57647019 CCAGAGGCAGAGACAGGTCAGGT 0: 1
1: 2
2: 2
3: 35
4: 345
Right 1138533394 16:57647046-57647068 CTACATCCCTGGCGCCTGGGTGG 0: 1
1: 0
2: 0
3: 13
4: 153
1138533390_1138533394 2 Left 1138533390 16:57647021-57647043 CCAGGGGTCTGTGCGGAGACTCA 0: 1
1: 0
2: 1
3: 13
4: 129
Right 1138533394 16:57647046-57647068 CTACATCCCTGGCGCCTGGGTGG 0: 1
1: 0
2: 0
3: 13
4: 153
1138533389_1138533394 3 Left 1138533389 16:57647020-57647042 CCCAGGGGTCTGTGCGGAGACTC 0: 1
1: 0
2: 0
3: 13
4: 98
Right 1138533394 16:57647046-57647068 CTACATCCCTGGCGCCTGGGTGG 0: 1
1: 0
2: 0
3: 13
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138533394 Original CRISPR CTACATCCCTGGCGCCTGGG TGG Intronic
900178178 1:1299786-1299808 CTGCACACCAGGCGCCTGGGAGG - Intronic
900591209 1:3460835-3460857 GTCCCTCCCTGGGGCCTGGGAGG + Intronic
901639813 1:10687507-10687529 CTGAAGCCCTGGCGCCTGGCTGG + Intronic
902408299 1:16198538-16198560 CTCCATGCCTGGCTCCTGGATGG - Exonic
905400759 1:37701380-37701402 CTCCCTTCCTGGGGCCTGGGAGG - Intronic
905650043 1:39650220-39650242 CTCCATTCCTGGTGACTGGGTGG + Intergenic
907885270 1:58587008-58587030 ATACAGACCTGGCACCTGGGAGG - Intergenic
908121319 1:60988737-60988759 CTTCATCCATGGCGGCTGTGTGG - Intronic
909392971 1:75136637-75136659 CTACAGCCCTGGCGGCCGGGAGG + Exonic
911549769 1:99264577-99264599 CGACATCCCTGCCGCCTGCCCGG - Exonic
912638112 1:111318016-111318038 CGACCTCCATGGCTCCTGGGAGG + Exonic
920443096 1:205994480-205994502 CTCCATCCCTGGCTCCAGGCTGG - Intronic
922090488 1:222390799-222390821 CCAGATGCCTGGAGCCTGGGTGG - Intergenic
922984799 1:229857941-229857963 GCCCATCCCTGGCTCCTGGGTGG + Intergenic
1065685422 10:28279752-28279774 TTACATCCCTGATGCCTGTGCGG - Intronic
1068521981 10:58086967-58086989 ATACATGCCTGGTGCCTGGCTGG - Intergenic
1069374325 10:67778748-67778770 CTACAGCCTTGGAGCCTGGTGGG - Intergenic
1070159448 10:73857078-73857100 CTACATCCCTGCCCCCATGGTGG - Intronic
1070304773 10:75233850-75233872 CCACAGACCTGGCGCCAGGGAGG + Intergenic
1073349997 10:102812865-102812887 CTCCATCCCTGGGGCTTTGGTGG - Exonic
1073498698 10:103917454-103917476 CCACATACCTGGCACCTGGCGGG + Exonic
1073694083 10:105845641-105845663 GTAGATCCCTTGAGCCTGGGAGG + Intergenic
1075174339 10:120145206-120145228 CTACAACCTTGTCTCCTGGGCGG - Intergenic
1077143575 11:1035301-1035323 CTCCCTCCCTGGCTCCAGGGTGG + Intronic
1078132079 11:8621274-8621296 CTCCAGACCTGGGGCCTGGGTGG + Exonic
1078430121 11:11281898-11281920 CTCCCTCCCTGGAGGCTGGGAGG + Intronic
1080764590 11:35283448-35283470 TTAAATCTCTGGCCCCTGGGTGG - Intronic
1081520946 11:43880696-43880718 CCACATCCCCCGCGCCTGGAGGG - Intergenic
1081773709 11:45664557-45664579 CTGGGTCCCTGGAGCCTGGGAGG + Intronic
1083375058 11:62213520-62213542 CTACAACCCTGGCCCCTGTTTGG + Intronic
1084178990 11:67437327-67437349 TTGCATTCCTGGAGCCTGGGCGG - Intronic
1084657052 11:70525780-70525802 CCACATCCCTGGGGGCTAGGAGG - Intronic
1084751955 11:71209833-71209855 CTACATCCCAGGGGCCTGCCTGG + Intronic
1085707253 11:78797679-78797701 CTACCTCCCAGGCAACTGGGAGG + Intronic
1089213677 11:116822771-116822793 CCTCAGCCCTGGCTCCTGGGTGG + Exonic
1089578794 11:119468585-119468607 CTCCAGCCCTGGCTCCTGGATGG - Intergenic
1091840088 12:3614621-3614643 CTACAACCCTGACTCCAGGGTGG - Intronic
1093530380 12:20154817-20154839 CCACATCGCTGACTCCTGGGTGG + Intergenic
1094784447 12:33830053-33830075 CTCCCTCCCTGGGGCCTGTGAGG + Intergenic
1097745938 12:63302993-63303015 CTTCTTCCCTGCTGCCTGGGAGG - Intergenic
1098234991 12:68409927-68409949 CTACATCCATGGCTCCTGGTGGG - Intergenic
1104890444 12:132137020-132137042 CTAAAACCCTGGGCCCTGGGAGG - Exonic
1106023869 13:25939618-25939640 TGACTTCCCTGGCTCCTGGGAGG + Intronic
1106137330 13:26983476-26983498 CTACGTCACTGGAGTCTGGGAGG + Intergenic
1113937732 13:114003282-114003304 CTGCATCCAGGGCACCTGGGAGG + Intronic
1114941567 14:27617815-27617837 CTTCATCCTTGATGCCTGGGTGG + Intergenic
1119140896 14:72266199-72266221 TCACATGCCTGGCGCCTTGGTGG + Intronic
1119746838 14:77050858-77050880 CAACATCGCTTGAGCCTGGGAGG - Intergenic
1122229229 14:100297231-100297253 CTACTTCACTGGCGTCTGGAGGG - Intronic
1127247081 15:57188875-57188897 GAAGATCGCTGGCGCCTGGGAGG - Intronic
1128361566 15:66965308-66965330 CACCATGCCTGGCTCCTGGGAGG - Intergenic
1129774762 15:78229558-78229580 CCACATCCCTGGCTCTTAGGGGG + Intronic
1131972467 15:97906199-97906221 CCAGATCCCTGGAGCCTGGAGGG + Intergenic
1132585723 16:705180-705202 CTCCACCCCGGGCGCCTGGTCGG - Intronic
1135592248 16:23712969-23712991 CTCCCTCCCTCACGCCTGGGTGG - Intronic
1135860830 16:26054479-26054501 CTACTTCCCTGGCCCCTTGATGG - Intronic
1136480167 16:30536168-30536190 CTGTAATCCTGGCGCCTGGGAGG + Intronic
1137466072 16:48710959-48710981 TTACCTCCCTGGCCCCTGGGAGG - Intergenic
1138225387 16:55290270-55290292 CCACATCTCTGGCACCTTGGTGG - Intergenic
1138533394 16:57647046-57647068 CTACATCCCTGGCGCCTGGGTGG + Intronic
1139962244 16:70724688-70724710 CTTCAGCCCTGGCCCCTGGGCGG + Intronic
1142117201 16:88365318-88365340 CTCCACCCATGGCTCCTGGGTGG + Intergenic
1143839791 17:9723155-9723177 CTGCAACCCTGGGGCCTGGGAGG - Intronic
1144625194 17:16840851-16840873 CTGCCTCCCTGCCTCCTGGGGGG + Intergenic
1144881237 17:18431870-18431892 CTGCCTCCCTGCCTCCTGGGGGG - Intergenic
1145150995 17:20512516-20512538 CTGCCTCCCTGCCTCCTGGGGGG + Intergenic
1145942454 17:28749743-28749765 CTTCAGCCCTGGCCCCTGTGGGG + Exonic
1147563001 17:41520371-41520393 CTGCATGTCTGGCACCTGGGTGG - Exonic
1147579346 17:41619550-41619572 CTGCCTCCCTGCCTCCTGGGTGG + Exonic
1151251909 17:72842755-72842777 CTACTTCCGTGGCGCCTGCCTGG - Intronic
1152145151 17:78564013-78564035 CTGCATCCCTGGCACCTGTTAGG - Intronic
1153509043 18:5832643-5832665 CCACATCCATGGAACCTGGGGGG - Intergenic
1157481022 18:48053904-48053926 CCACATCCCTGGCTGCTTGGGGG - Intronic
1157566083 18:48680148-48680170 CTTCTTCCCTGGTGCCTGGAGGG - Intronic
1158185147 18:54762890-54762912 CTATATCCCTCACACCTGGGGGG + Intronic
1158725691 18:59969621-59969643 CTTCATCCCTCGCGCCCGGGTGG + Intergenic
1158933508 18:62344043-62344065 CTACATCACAGCCGCCTTGGAGG - Intronic
1159900811 18:74043837-74043859 CTACATCCCTCAAGCCTGGGAGG + Intergenic
1163692569 19:18745506-18745528 CTACATCCCTGGCACCCGGCGGG + Intronic
1165596054 19:37011923-37011945 CTGCCTCCCTCGCCCCTGGGAGG - Intronic
1165837358 19:38767364-38767386 CCACACCCCTGGCACCTGGGTGG - Intronic
1167096061 19:47375675-47375697 CGCCATCACTGGCCCCTGGGGGG - Exonic
1168056241 19:53866708-53866730 CTACATTCCTGACTCCTGGATGG - Intronic
925496420 2:4454776-4454798 CTGCATCCCTAGAGCCTGGGTGG - Intergenic
932800213 2:74735142-74735164 CTACAGGCCTGGTGCCTAGGAGG - Intergenic
935191435 2:100781780-100781802 CTGGAACCCTGGCGGCTGGGTGG - Intergenic
936977174 2:118231921-118231943 CTCCATTCCTGGCCCCTGAGTGG - Intergenic
938138742 2:128779920-128779942 CTGCCTGCCTGGGGCCTGGGAGG + Intergenic
938564701 2:132508228-132508250 CTTTGTCCCTGGCTCCTGGGAGG - Intronic
938577501 2:132618647-132618669 CTTCATCCCTGGTGCATGTGTGG - Intronic
938949008 2:136240243-136240265 CTACTTCCCAGGGGCATGGGAGG + Intergenic
942779345 2:179622871-179622893 CTACAACACTGGCACCTGTGAGG + Intronic
948277397 2:236719579-236719601 CTGCATCTCTGGCCCCTGGCTGG + Intergenic
948783661 2:240340074-240340096 CAACATCCCTGGCTTCTGAGTGG - Intergenic
1171229954 20:23476107-23476129 CCCCATCCCTGGACCCTGGGAGG + Intergenic
1172072937 20:32272007-32272029 CTAGATACCTGGCGACTGGGTGG - Intergenic
1175302837 20:57955007-57955029 CTTTGTCCCTGGCTCCTGGGAGG - Intergenic
1175503596 20:59467036-59467058 CTGCATCCCTGGGGCCTGGCAGG - Intergenic
1176664843 21:9675999-9676021 CCACATCCCTGCTGCCTGAGGGG + Intergenic
1180558166 22:16593951-16593973 CTACCTCCCTGACCGCTGGGAGG - Intergenic
1181085135 22:20436403-20436425 CTGCATTCCTGGGGCCGGGGAGG + Intronic
1181164443 22:20975881-20975903 CCACAGCCCAGGCACCTGGGAGG + Intronic
1181684969 22:24522129-24522151 CTGCATGCCTGGCACCTAGGAGG + Intronic
1181806063 22:25375144-25375166 CTCCATCCCTGGTCCCTGTGGGG + Intronic
1183339852 22:37274116-37274138 CCATATCCCTGGCTGCTGGGAGG - Intergenic
1183744040 22:39683366-39683388 CCCCACCCCTGGCTCCTGGGAGG - Intronic
1183903464 22:41022611-41022633 CTGCAGCCCTGGGGCCCGGGAGG - Intergenic
1184277833 22:43420303-43420325 CTAAGTCCCTGAGGCCTGGGCGG - Intronic
1184285924 22:43471458-43471480 CCACAGCCGTGGGGCCTGGGTGG + Intronic
1185064925 22:48627376-48627398 CTCCATCCTCGGCGCCTGTGGGG - Intronic
1185181910 22:49368613-49368635 CTACATTCCTGGAGCCTTTGGGG - Intergenic
950025839 3:9819421-9819443 CTACATGCCAGGCCCATGGGAGG - Intronic
955129986 3:56156693-56156715 CTACATCCCTAGTGCATGGAAGG + Intronic
967904130 3:194486892-194486914 CTACGTCGCTGGCGGCGGGGGGG - Intronic
968742840 4:2340032-2340054 CTTCATCCCTGTGGCCTGGACGG - Intronic
970447512 4:16136484-16136506 TTACATCCCTGACAGCTGGGTGG - Intergenic
972265273 4:37453752-37453774 CGACATCCCCGGGGCCGGGGTGG - Intergenic
972362931 4:38345506-38345528 CTTAATCCCTGGAGCTTGGGAGG - Intergenic
973607506 4:52602228-52602250 CTACATCCCTGGCTCCCAGCAGG + Intronic
978178766 4:105767706-105767728 CTTCAGCCCTGTAGCCTGGGTGG + Intronic
981192990 4:141885312-141885334 CTACATCTCTGGGACCAGGGCGG - Intergenic
981918944 4:150066124-150066146 CTTTATCCCTGGCTCGTGGGAGG + Intergenic
985493125 5:190782-190804 CTGCAACCCTGCCGCCTGTGCGG - Intergenic
997369386 5:133348459-133348481 CTACATCCCATTCTCCTGGGAGG + Intronic
998138677 5:139688042-139688064 ATCCATCTCTGGCACCTGGGAGG - Intergenic
1001397913 5:171429773-171429795 CTGCATCCCTGTCTCTTGGGTGG + Intronic
1002767496 6:254983-255005 CTGCATCCCTGGCACATGGTAGG - Intergenic
1006629099 6:35418648-35418670 CTACATCTCTCGGGCCTGGGAGG - Intronic
1012944205 6:105448720-105448742 TTTCATCCATGGCGACTGGGGGG - Intergenic
1013285014 6:108673693-108673715 CTAGATCCCTGGAGGGTGGGTGG - Intronic
1014612748 6:123564760-123564782 CTACATGCCTGGCACATAGGAGG - Intronic
1018173791 6:161162274-161162296 CCACATCCCTGGGGCACGGGCGG + Intronic
1019698173 7:2459580-2459602 CCACCTCCCTGGGGCCTGGTGGG + Intergenic
1024004696 7:45216813-45216835 CTGCATCCTTGGCTCCTCGGTGG + Intergenic
1024278404 7:47697809-47697831 CCACCTCCCTGGCACCTGGAAGG - Intronic
1032125163 7:129188498-129188520 CAGCGTCCCTGGCGCCTGGAGGG - Intergenic
1032737024 7:134701993-134702015 CTATCTCCCTGACTCCTGGGAGG - Intergenic
1034619147 7:152444046-152444068 CTACCTCCCTGACCGCTGGGAGG + Intergenic
1035186948 7:157133880-157133902 GAACATCCCTTGAGCCTGGGAGG - Intergenic
1036627646 8:10484600-10484622 GTACTTCCCTGGGTCCTGGGAGG - Intergenic
1036770117 8:11572855-11572877 GTACATGCCCGGCGCCTTGGAGG + Intergenic
1041261017 8:56020516-56020538 CCACAGGCCTGGGGCCTGGGTGG + Intergenic
1042916328 8:73878904-73878926 CAACATCCCGGGCGCGGGGGCGG + Exonic
1046671544 8:117062105-117062127 CTACCTCCCTGGATCCTGTGTGG - Intronic
1048580362 8:135725416-135725438 CTGGAGCCCTGGCTCCTGGGTGG + Intergenic
1049059738 8:140267209-140267231 TTCCATCCCTGACACCTGGGAGG - Intronic
1051820863 9:21166117-21166139 ATACAGCCCTTGTGCCTGGGAGG - Exonic
1051822722 9:21187036-21187058 ATACAGCCCTTGTGCCTGGGAGG - Exonic
1051824274 9:21201670-21201692 ATACAGCCCTTGTGCCTGGGAGG - Exonic
1051824611 9:21206602-21206624 ATACAGCCCTTGTGCCTGGGAGG - Exonic
1051825714 9:21216810-21216832 ATACAGCCCTTGTGCCTGGGAGG - Exonic
1051826545 9:21227678-21227700 ATACAGCCCTTGTGCCTGGGAGG - Exonic
1051827723 9:21239440-21239462 ATACAGCCCTTGTGCCTGGGAGG - Exonic
1051836974 9:21350392-21350414 GTACAGCCCTTGTGCCTGGGAGG - Exonic
1051838484 9:21367512-21367534 ATACAGCCCTTGTGCCTGGGAGG - Exonic
1051839957 9:21384837-21384859 ATACAGCCCTTGTGCCTGGGAGG - Exonic
1051844934 9:21440981-21441003 ATACAGCCCTTGTGCCTGGGAGG + Exonic
1053165514 9:35841352-35841374 CTACCTGCCTGGTCCCTGGGTGG + Intronic
1060183048 9:121546993-121547015 CTATATCCCTGGCACCAGGCAGG - Intergenic
1061595955 9:131629154-131629176 CTTCATCCGTGGCATCTGGGAGG + Exonic
1061816352 9:133199727-133199749 CTCCGTCCCTGGCTCCCGGGAGG - Intergenic
1062274879 9:135725984-135726006 CCACAGCCATGGCTCCTGGGTGG - Intronic
1062566171 9:137164906-137164928 CTGGCTCCCTGGCTCCTGGGTGG - Intronic
1203661255 Un_KI270753v1:45748-45770 CCACATCCCTGCTGCCTGAGGGG - Intergenic
1186767321 X:12784074-12784096 CTATAAACCTGGCGACTGGGAGG - Intergenic
1196032288 X:111103651-111103673 CTCCTTTCCTGGTGCCTGGGTGG + Intronic
1199635070 X:149806316-149806338 CCACCTCTCTGGGGCCTGGGAGG - Intergenic