ID: 1138536266

View in Genome Browser
Species Human (GRCh38)
Location 16:57661998-57662020
Sequence GGGTGTCTACACATGGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 148}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138536254_1138536266 14 Left 1138536254 16:57661961-57661983 CCAAGGTAAGGAGAAGACCCGTC 0: 1
1: 0
2: 0
3: 6
4: 92
Right 1138536266 16:57661998-57662020 GGGTGTCTACACATGGAGCAAGG 0: 1
1: 0
2: 0
3: 10
4: 148
1138536262_1138536266 -9 Left 1138536262 16:57661984-57662006 CCTTGGCCCAGGCAGGGTGTCTA 0: 1
1: 0
2: 2
3: 21
4: 292
Right 1138536266 16:57661998-57662020 GGGTGTCTACACATGGAGCAAGG 0: 1
1: 0
2: 0
3: 10
4: 148
1138536253_1138536266 18 Left 1138536253 16:57661957-57661979 CCTTCCAAGGTAAGGAGAAGACC 0: 1
1: 0
2: 2
3: 15
4: 131
Right 1138536266 16:57661998-57662020 GGGTGTCTACACATGGAGCAAGG 0: 1
1: 0
2: 0
3: 10
4: 148
1138536252_1138536266 21 Left 1138536252 16:57661954-57661976 CCTCCTTCCAAGGTAAGGAGAAG 0: 1
1: 0
2: 0
3: 19
4: 193
Right 1138536266 16:57661998-57662020 GGGTGTCTACACATGGAGCAAGG 0: 1
1: 0
2: 0
3: 10
4: 148
1138536258_1138536266 -3 Left 1138536258 16:57661978-57662000 CCCGTCCCTTGGCCCAGGCAGGG 0: 1
1: 0
2: 4
3: 39
4: 365
Right 1138536266 16:57661998-57662020 GGGTGTCTACACATGGAGCAAGG 0: 1
1: 0
2: 0
3: 10
4: 148
1138536261_1138536266 -8 Left 1138536261 16:57661983-57662005 CCCTTGGCCCAGGCAGGGTGTCT 0: 1
1: 0
2: 3
3: 46
4: 466
Right 1138536266 16:57661998-57662020 GGGTGTCTACACATGGAGCAAGG 0: 1
1: 0
2: 0
3: 10
4: 148
1138536260_1138536266 -4 Left 1138536260 16:57661979-57662001 CCGTCCCTTGGCCCAGGCAGGGT 0: 1
1: 0
2: 2
3: 37
4: 355
Right 1138536266 16:57661998-57662020 GGGTGTCTACACATGGAGCAAGG 0: 1
1: 0
2: 0
3: 10
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138536266 Original CRISPR GGGTGTCTACACATGGAGCA AGG Intronic
900584249 1:3424848-3424870 GAGTGTCTTTCCATGGAGCAAGG + Intronic
905119036 1:35667606-35667628 CGGTGCATACACATGGGGCAGGG - Intergenic
907052636 1:51340023-51340045 CTGTGTCTTCACATGGAGGAAGG - Intronic
909487816 1:76193224-76193246 GGGTGGCTACACATGAAGGAAGG - Intronic
910088648 1:83435808-83435830 GGGTGTCTAGACCTTGAGAATGG + Intergenic
919973999 1:202599182-202599204 GGGTTCCTAGGCATGGAGCAGGG - Intronic
922077698 1:222264235-222264257 GGGTATCTACCAATGGAGAAAGG - Intergenic
1062855886 10:779376-779398 GGGTGGCTCCACAGGGAACAGGG + Intergenic
1065328008 10:24567708-24567730 GGGTCTCCACACTTGGAACATGG + Intergenic
1065328021 10:24567801-24567823 GGGTCCCTGCACTTGGAGCATGG - Intergenic
1066549844 10:36544459-36544481 GGATGTGTACACATGCATCAGGG - Intergenic
1066976130 10:42369249-42369271 GGCTGTCTACACTGGGTGCATGG + Intergenic
1068433645 10:56963544-56963566 GTGTGTGTAGACATGGAGCTGGG - Intergenic
1072686382 10:97539814-97539836 TGGTGTCTGCACAGGGAGCAGGG - Intronic
1073141084 10:101248235-101248257 CTGTGTCTTCACATGGAGGAAGG + Intergenic
1074242598 10:111654134-111654156 GGGTGTATACACAGTGAGAAAGG - Intergenic
1074635574 10:115312640-115312662 GGGTGTCTACATTTCTAGCAAGG + Intronic
1077805452 11:5587545-5587567 CTGTGTCTTCACATGGAGAAAGG + Intronic
1079095562 11:17507818-17507840 GGATGGCAACACATGGAGGATGG - Intronic
1081750270 11:45505598-45505620 GGTTGTCTCCACATGCAGGAAGG - Intergenic
1083792397 11:64994436-64994458 GGTTGTCCACACCTGGTGCAGGG + Exonic
1084117796 11:67052114-67052136 GGGACTGTACACATGGAGGAGGG + Intergenic
1085604426 11:77884500-77884522 GGCTGTCTACACAGGGAGCTGGG - Intronic
1087009961 11:93503759-93503781 GAGTCTGTGCACATGGAGCACGG + Intronic
1091647535 12:2285121-2285143 GTGTTTCTACAGAGGGAGCAAGG - Intronic
1096257436 12:50072129-50072151 GGGTCTCTGCAAATGGAGAAGGG + Intronic
1096488678 12:52001550-52001572 CTGTGTCTTCACATGGTGCAAGG + Intergenic
1098910503 12:76203969-76203991 GGGTGTCTCCAGAGGGATCATGG + Intergenic
1099903128 12:88737103-88737125 TGGTGTCTACAAAAGGAGGAAGG - Intergenic
1103983017 12:124748975-124748997 GGGTGACTGCGCATGGAACAGGG + Intergenic
1104640735 12:130465295-130465317 GGGTGTCTCCTCCTGGAGCGAGG - Intronic
1104810428 12:131617171-131617193 GGAGGTCTCCACATGGAGCCAGG + Intergenic
1105793201 13:23823448-23823470 GGGTGACCACACATGGAGGTGGG + Intronic
1106024461 13:25943778-25943800 GGGAGTCTACACAGGCAGCCAGG - Intronic
1109967327 13:69717913-69717935 GGCTGTATACACATTGAGAAAGG - Intronic
1110128607 13:71979020-71979042 GGGTGCCTAGGCATGGAGCTGGG - Intergenic
1110302529 13:73945941-73945963 GGTTGTTTTCACATGGGGCAGGG + Intronic
1112103427 13:96215062-96215084 GGGTGTTTAGAAATGAAGCAAGG + Intronic
1112317080 13:98372428-98372450 GGGTGGCTAAACATGGCACAAGG - Intronic
1114844184 14:26301145-26301167 GGGTGTCTTCACGTGGTGGACGG - Intergenic
1118725670 14:68627387-68627409 GTGTGTCCACAGTTGGAGCAGGG + Intronic
1120016487 14:79480097-79480119 GGGTGTCTTCACAGCGACCATGG + Intronic
1120719874 14:87879216-87879238 GGCTTTCTGCACAAGGAGCATGG + Intronic
1124136194 15:27038292-27038314 GTGTGTCGTCACATGGTGCAGGG + Intronic
1125086832 15:35739975-35739997 GGTTGTCTTCTCATGTAGCATGG + Intergenic
1125383898 15:39115689-39115711 ATGTGCCTACACATGGAGCTGGG - Intergenic
1129034291 15:72640345-72640367 GGGTGCTCACACATGGGGCACGG - Intergenic
1129215591 15:74096871-74096893 GGGTGCTCACACATGGGGCACGG + Intergenic
1129732727 15:77941200-77941222 GGGTGCTCACACATGGGGCACGG + Intergenic
1134834588 16:17350430-17350452 GGGAGTCTGGACTTGGAGCATGG - Intronic
1135906999 16:26521337-26521359 GGGTTTCTTCACATGCCGCAGGG - Intergenic
1137863852 16:51873449-51873471 AGGTGTCTTCACATGGCACAAGG - Intergenic
1138536266 16:57661998-57662020 GGGTGTCTACACATGGAGCAAGG + Intronic
1138815514 16:60199038-60199060 GGGAGTATGCACATAGAGCAAGG + Intergenic
1139654926 16:68381700-68381722 GGGTGAAGAGACATGGAGCAGGG + Intronic
1144301150 17:13923792-13923814 TGGTGTGTACCCATGAAGCAGGG - Intergenic
1149436041 17:56634216-56634238 CTGTGTCTACACATGGTGGAAGG + Intergenic
1149531214 17:57396889-57396911 GGCTGTCCCCACATGGTGCAAGG + Intronic
1152233537 17:79126575-79126597 GGGTGTATAGACAGGGAGGAGGG - Intronic
1152429162 17:80237922-80237944 GGGAGTTTGCACATGGAGCTGGG + Intronic
1152576718 17:81144369-81144391 GGGTGTTCACACCTGGGGCAAGG + Intronic
1153614673 18:6923542-6923564 GGGTTTCTAGCCAAGGAGCAGGG - Intergenic
1158077553 18:53548260-53548282 GGTTGGCTAGACATGGATCATGG + Intergenic
1161482378 19:4517501-4517523 GGGACTCTACACATGGACCTGGG - Intronic
1162309558 19:9897792-9897814 GGCTTTCTTCCCATGGAGCATGG + Intronic
1168338546 19:55610940-55610962 GGGTGTCTATACAAGGGGCCTGG - Intronic
1168449859 19:56457937-56457959 CTGTGTCTGCACATGGAGGAAGG - Intronic
928077419 2:28277902-28277924 GGGTTTCTACACATGTATTATGG - Intronic
931981713 2:67700124-67700146 AGGTTTCTACCTATGGAGCAAGG + Intergenic
935210322 2:100934485-100934507 AGGAGTCTACACCGGGAGCAAGG - Intronic
935271241 2:101436050-101436072 GGGTGCCCACAGATGCAGCAGGG - Intronic
935459086 2:103307485-103307507 GGGTCCTTACACATGGAGGAGGG - Intergenic
943635443 2:190301800-190301822 GTGTGTCCACACATGGCACAAGG + Intronic
946397389 2:219449775-219449797 GGGTGGCCACACATGGGTCAGGG - Intronic
947443464 2:230143455-230143477 GGGTGTGGACACCTGGATCATGG + Intergenic
1170905883 20:20514930-20514952 GTGTGCCTAGACATGGAGCTGGG - Intronic
1178730065 21:35093669-35093691 GGATGTCCCCAGATGGAGCAGGG - Intronic
1179176374 21:39010870-39010892 GGGTGTGTCCACCAGGAGCACGG - Intergenic
1179384235 21:40927278-40927300 GGGAGTGTTCAAATGGAGCAGGG - Intergenic
1181470465 22:23136106-23136128 GGGTGACTAGACACGGACCAAGG - Intronic
1184287701 22:43481259-43481281 GGCTTTCTACACATGGTGCTAGG - Intronic
1184397022 22:44248380-44248402 GTGTGTCTACACTGGCAGCATGG + Exonic
949231736 3:1757705-1757727 GTGTGCCTACACATGGAGCTGGG - Intergenic
951545288 3:23818801-23818823 GGATGTCTTCAGATGGAGGATGG + Intronic
951707065 3:25554069-25554091 GTGTGTCTACCTCTGGAGCAGGG + Intronic
953793033 3:45962822-45962844 GGGACTCTACACATGGGGCATGG + Intronic
959739087 3:109695296-109695318 GAGTGACTAGACATGGAGCTGGG + Intergenic
960004306 3:112766438-112766460 GTGTGTCCTCACATGGAGGAAGG - Intronic
960673321 3:120172313-120172335 GCATGTCTACAGATGGAGAAGGG - Intronic
962916935 3:139912697-139912719 GAGCCTCTACTCATGGAGCAGGG - Intergenic
964947397 3:162243054-162243076 GGGTGTGTACACATGGATCTTGG - Intergenic
965044418 3:163557352-163557374 TAGTGTCTTCAGATGGAGCATGG - Intergenic
967285175 3:187862231-187862253 AGGTATCTACACATGTACCATGG - Intergenic
968718227 4:2177805-2177827 GGGTGTAGACACATGGTACAAGG + Intronic
968871519 4:3245090-3245112 GGCTGTCCACACCTGGACCAGGG - Intronic
972837827 4:42895566-42895588 GAGTGGCTACACTTGGATCAGGG + Intronic
972842252 4:42945102-42945124 GCGTGTCTTCACATGGTGGAAGG - Intronic
977603765 4:98961474-98961496 CTGTGTCTTCACATGGAGGAAGG - Intergenic
978018333 4:103777296-103777318 GGGTGCCTACTCCTGGATCAAGG + Intergenic
981032139 4:140136179-140136201 GGGTCTCTACACATGAACTAGGG - Intronic
982572545 4:157068495-157068517 CTGTGTCTTCACATGGAGGAAGG + Intergenic
986201888 5:5586652-5586674 GTGTGTCCTCACATGGAGGAAGG + Intergenic
987071039 5:14337389-14337411 GGGTGACTACAAATTGAGTAGGG + Intronic
992845108 5:80738914-80738936 GTGTGTCTTCACATGGAGGAGGG - Intronic
993720195 5:91314633-91314655 GATTCTCTACACTTGGAGCATGG - Intergenic
994163271 5:96580940-96580962 TTGTGTCCTCACATGGAGCAAGG - Intronic
1001039632 5:168324938-168324960 AGGTGTCTACACATTTAGGATGG - Intronic
1002587399 5:180258511-180258533 TGATGTCTTCACATGGAGCGGGG - Intronic
1002600512 5:180352022-180352044 GTGGCTCTACACATGGAGAATGG + Intronic
1002867309 6:1132854-1132876 GGGAGTCCACACTTGGAGGAAGG + Intergenic
1003352827 6:5334930-5334952 GCTTGCCTACACATGGAGCTGGG - Intronic
1003841721 6:10127493-10127515 TGGTATCTGCACATGGAGTAGGG - Intronic
1004050747 6:12076540-12076562 CTGTGTCTTCACATGGAGGAAGG + Intronic
1004286373 6:14324666-14324688 GGAAGTATACACATGGAGGAAGG - Intergenic
1010475004 6:76276180-76276202 GTGTGCCTAGACATGGAGCTGGG + Intergenic
1011155803 6:84329784-84329806 GGGTGTAGAGACAGGGAGCAGGG + Intergenic
1012728769 6:102852404-102852426 GTGTGTGTACAAATGGAGTAAGG - Intergenic
1017303462 6:152889251-152889273 TGGTGTCCTCACATGGAGGAAGG - Intergenic
1020151241 7:5683483-5683505 TGGTCTCTCCACATGGAGGATGG - Intronic
1021577504 7:22117569-22117591 GGGTGCCTTCATCTGGAGCAGGG + Intergenic
1022470945 7:30681671-30681693 GGCTGTCACCGCATGGAGCACGG + Intronic
1022857495 7:34329802-34329824 GAGGGAATACACATGGAGCATGG + Intergenic
1026766627 7:73164237-73164259 GGGTGGCTACAGATGGATCAGGG + Intergenic
1027043105 7:74973936-74973958 GGGTGGCTACAGATGGATCAGGG + Intronic
1027080542 7:75228423-75228445 GGGTGGCTACAGATGGATCAGGG - Intergenic
1027305503 7:76892244-76892266 GGGTGTCTAGACCTTGAGAATGG + Intergenic
1027750075 7:82132386-82132408 GGGTATGTACACATGGGTCAAGG + Intronic
1029389741 7:100267032-100267054 GGGTGGGTACAGATGGATCAGGG - Intronic
1029687512 7:102158882-102158904 GGGTGTTTAGAGATGGAGTAGGG - Intronic
1030456019 7:109774421-109774443 GGGTGTCTAGATCTGTAGCAAGG - Intergenic
1030536391 7:110772212-110772234 TGGAGTCTACACATTGAGAATGG + Intronic
1030627365 7:111858834-111858856 ATGTGTCTATACATGGAGGAAGG - Intronic
1031904671 7:127447312-127447334 GTGTGCCTAGGCATGGAGCAGGG - Intergenic
1034676889 7:152898419-152898441 AGGTGTGCACACCTGGAGCATGG + Intergenic
1036952146 8:13150996-13151018 AGATGTCTACAGATGGAACAGGG + Intronic
1039225242 8:35380999-35381021 GGATGGCTACAAATGAAGCAGGG + Intronic
1041174760 8:55183918-55183940 AGGTGTGTACACATTGAGGATGG + Intronic
1043798558 8:84578267-84578289 GGGTGTCTACATCTGGACAAGGG + Intronic
1044850817 8:96425481-96425503 TGGCTTCTACACATGGAGGAAGG + Intergenic
1046751731 8:117933908-117933930 GGGCATCTTCACGTGGAGCAAGG - Intronic
1048636760 8:136304847-136304869 GAGTGTTTACACCTGGAGAAGGG + Intergenic
1049043392 8:140129560-140129582 GGATGTCCACACAGGGGGCAGGG + Intronic
1049331813 8:142058638-142058660 GGGTGTTGTCAGATGGAGCAGGG - Intergenic
1051633608 9:19162218-19162240 GGGTGGCTGCACCTGGAGCTGGG + Intergenic
1056735176 9:89203312-89203334 CTGTGTCTTCACATGGAGGAAGG + Intergenic
1060779771 9:126402878-126402900 GGTTCTTTACACAAGGAGCACGG + Intronic
1060803064 9:126556886-126556908 GGGAGTCCCCCCATGGAGCAGGG + Intergenic
1061840795 9:133357435-133357457 GGATGGCTCCACCTGGAGCAAGG - Intronic
1062609421 9:137367322-137367344 GGGTGTCTACACAGCCTGCAGGG - Intronic
1186117392 X:6319258-6319280 CTGTGTCTACACATGGTGGAAGG + Intergenic
1186387188 X:9121759-9121781 CTGTGTCTTCACATGGAGGAAGG - Intronic
1186506806 X:10100318-10100340 GGGGCTCCACACAGGGAGCAAGG + Intronic
1186576240 X:10768974-10768996 GGGTGTGCACACATGTAGGAGGG + Intronic
1187527421 X:20066714-20066736 GGGTTTAAACAGATGGAGCAGGG - Intronic
1188760835 X:34027377-34027399 CTGTGTCTACACATGGTGGATGG - Intergenic
1194333423 X:92614742-92614764 GTGTGTCTAGGCATGGAGCTGGG + Intronic
1199143002 X:144334078-144334100 CGGTATGTACACATGAAGCAAGG + Intergenic
1199944567 X:152654872-152654894 GGGTGTATGCATATGCAGCAGGG + Exonic
1200642108 Y:5733748-5733770 GTGTGTCTAGGCATGGAGCTGGG + Intronic