ID: 1138539843

View in Genome Browser
Species Human (GRCh38)
Location 16:57681200-57681222
Sequence ATGTATCCACAGGGGGAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 179}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138539843_1138539849 19 Left 1138539843 16:57681200-57681222 CCAGATTCCCCCTGTGGATACAT 0: 1
1: 0
2: 1
3: 20
4: 179
Right 1138539849 16:57681242-57681264 ATATCAAAACCAGCAGCTGGTGG 0: 1
1: 0
2: 1
3: 11
4: 183
1138539843_1138539848 16 Left 1138539843 16:57681200-57681222 CCAGATTCCCCCTGTGGATACAT 0: 1
1: 0
2: 1
3: 20
4: 179
Right 1138539848 16:57681239-57681261 TCAATATCAAAACCAGCAGCTGG 0: 1
1: 0
2: 0
3: 20
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138539843 Original CRISPR ATGTATCCACAGGGGGAATC TGG (reversed) Intronic
900543999 1:3218399-3218421 AGGTATCCCCAGGGGGCAGCCGG + Intronic
900707639 1:4090420-4090442 ATGCCTCCACAGGGGGAAATCGG + Intergenic
901210379 1:7521351-7521373 ATGTTACCACTGGGGGAAACTGG - Intronic
901277999 1:8007979-8008001 ATGTCATCACTGGGGGAATCTGG + Intronic
910174042 1:84409499-84409521 ATGTATCCACAGGCTGGATTTGG + Intronic
912915316 1:113808972-113808994 ATGTAGCCACTGAGGGAAACTGG + Intronic
913198853 1:116479710-116479732 AGGTATCCACTGGGGGATCCTGG - Intergenic
914921460 1:151850331-151850353 ATGTGTCCACAAGGGAAATCAGG - Intronic
918135269 1:181667931-181667953 ATGTTACCACTGGGGGAAACTGG - Intronic
918474192 1:184905550-184905572 ATGTATGCACAGGGGCAAGAAGG - Intronic
918819751 1:189237137-189237159 TTATATTCCCAGGGGGAATCTGG + Intergenic
921340928 1:214133562-214133584 ATGTAACCATTGGGGGAAACTGG - Intergenic
922482477 1:225948768-225948790 ATGTGTCCCCAGGTGAAATCAGG - Intergenic
923076312 1:230611850-230611872 AGGTAACCACAGTGGGACTCAGG - Intergenic
1062892024 10:1069848-1069870 ATGTAACCACTGGGGAAATATGG + Intronic
1063490042 10:6455778-6455800 ATGTGACCACTGGGGGAAACTGG + Intronic
1063490255 10:6457560-6457582 ATGTGGCCACTGGGGGAAACTGG + Intronic
1064324607 10:14338348-14338370 CTGAATCCACAAGGGGAAGCAGG + Intronic
1065735189 10:28745133-28745155 ATGTATTCACAGGTGGAATAGGG + Intergenic
1071402175 10:85284663-85284685 TCCTATCCACAGGGAGAATCCGG - Intergenic
1071404643 10:85318333-85318355 ATGTATTCACAGGCTGAATGGGG + Intergenic
1074335529 10:112570649-112570671 ATGTATGCACAGAGGTATTCTGG - Intronic
1075500921 10:122973408-122973430 ATTTATCCACAGAGGGAAAATGG - Intronic
1076466079 10:130682495-130682517 ATGTTTCCACTGGTGGAAGCAGG - Intergenic
1078286883 11:9965667-9965689 ATGTCACCATAGGGGGAAGCTGG - Intronic
1080579709 11:33632233-33632255 CTGTATCCACAGGTGGACTCTGG + Intronic
1084885802 11:72206059-72206081 ATCTCTCCACAGGGAGAAGCTGG - Intergenic
1085534488 11:77209819-77209841 GGGAATCCACTGGGGGAATCTGG - Intronic
1086675890 11:89606622-89606644 ATGTAATCACAGGGTTAATCTGG + Intergenic
1088420097 11:109635998-109636020 CTGTATCTACAGGGGCGATCTGG + Intergenic
1088813157 11:113405010-113405032 AGGTAAGCACAGGGGGCATCAGG - Intergenic
1088936518 11:114406492-114406514 ATTTATCCACAGGCAGAATTTGG + Intronic
1092094437 12:5829567-5829589 AAGTTTCCACAGGAGGAATGAGG - Intronic
1106164140 13:27227268-27227290 AAGTAACCACAGGGGGAAACTGG + Intergenic
1107258911 13:38467406-38467428 AGGTATCCACAGGGAGAAAGAGG + Intergenic
1108556268 13:51595874-51595896 ATGCCTCCAGAGAGGGAATCAGG - Intronic
1109244724 13:59939812-59939834 ATGTATCTACAGGGAGAATGAGG + Intronic
1110634084 13:77745336-77745358 ATGTTACCACTGGGGGAAACTGG + Intronic
1112817661 13:103291897-103291919 ATGTAACCACAGTGAGATTCTGG + Intergenic
1114260465 14:21032907-21032929 ATGTAACCATTGGGGGAAACTGG - Exonic
1114696394 14:24631204-24631226 CTCTATTCACAGGGGGACTCTGG - Exonic
1116764498 14:49053597-49053619 ATGTATACACAGTGGGAATATGG - Intergenic
1118741720 14:68744474-68744496 ATTCATCCACAGGTGGAAACTGG + Intergenic
1118978085 14:70694520-70694542 ATTTGTCCACTGGGGGAAACAGG - Intergenic
1120186815 14:81402064-81402086 AGGTATCTACTGGGGGAATATGG + Intronic
1120668251 14:87333197-87333219 ATGGATCCCCAGTGGGAATCAGG + Intergenic
1126375644 15:47994233-47994255 GTGTATCCACATAGGGAAGCTGG - Intergenic
1127010802 15:54625354-54625376 GTGGATCCACAGGGGGAAACTGG + Intronic
1129162618 15:73755016-73755038 ATGTATTCACAGGGGGCTGCTGG + Intergenic
1130423053 15:83767469-83767491 ATGTTTGAACAGGGGGAATTGGG + Intronic
1131312546 15:91304068-91304090 AGGTATCCACAGGGAAAATGGGG + Intergenic
1131529853 15:93181755-93181777 AGGTATCCACTGGGGCAGTCAGG + Intergenic
1131896386 15:97035113-97035135 ATGTTACCACTGGGGGAAACTGG + Intergenic
1133487563 16:6234924-6234946 ATGTTTCCATTGGGGGAAACTGG + Intronic
1133923169 16:10172653-10172675 CTGTTGCCATAGGGGGAATCGGG + Intronic
1134563905 16:15234601-15234623 ATGTATCCACATTGGGAACTTGG - Intergenic
1134738589 16:16522095-16522117 ATGTATCCACATTGGGAACTTGG + Intergenic
1135344087 16:21673226-21673248 ATGTAACCAATGGGGGAAACTGG - Intergenic
1135721600 16:24822625-24822647 ATGGAGCCACAGTGGGGATCTGG + Intronic
1138539843 16:57681200-57681222 ATGTATCCACAGGGGGAATCTGG - Intronic
1138718507 16:59051677-59051699 ATGAAACCACAGGGGTAAGCAGG - Intergenic
1138774605 16:59706401-59706423 ATGTCTCCAGAGAGGGGATCAGG - Intergenic
1142728788 17:1836472-1836494 ATATCTCCACAGGGGCAATGTGG - Intronic
1143129558 17:4668668-4668690 ATGTAACCACTGGAGGAAACTGG + Intergenic
1143501011 17:7338916-7338938 ATGTCACCACTGGGGGAAGCTGG - Intronic
1147901359 17:43787514-43787536 ATGCTACCACTGGGGGAATCTGG + Exonic
1148279971 17:46340173-46340195 AGGTATCCACAGGGAAATTCAGG + Intronic
1149137219 17:53381627-53381649 ATCTGTGCACAGGGGGAATGGGG + Intergenic
1149902140 17:60490289-60490311 ATGTGACCACTGGGGGAAGCTGG + Intronic
1150400042 17:64849299-64849321 AGGTATCCACAGGGAAATTCAGG - Intergenic
1155782598 18:29856325-29856347 ATGTAACCACATGAGGAGTCTGG - Intergenic
1158687851 18:59630807-59630829 TTGTACCCACAGTGGGATTCAGG + Intronic
1159527509 18:69612057-69612079 ATGTTACCACTGGGGGAAACTGG + Intronic
1159929861 18:74299336-74299358 ATGTAACCATTGGGGGAAACTGG - Intergenic
1160775987 19:855946-855968 CTGCCTCCACAGGGGGACTCCGG + Exonic
1165596172 19:37012530-37012552 ATGAAGCCACAGGCGGAGTCTGG + Intronic
1165683338 19:37796435-37796457 ATGAAACCACAGGCAGAATCCGG - Intronic
1166650046 19:44566348-44566370 ATGTATTCATTGGGGGAAACTGG + Intergenic
926509516 2:13757257-13757279 ATGTAACCACTGGGAGAAACTGG - Intergenic
926691786 2:15740596-15740618 ATGTAACCACTGAGGGAAACTGG - Intronic
930025848 2:47028745-47028767 ATGTGGGCACAGTGGGAATCTGG - Intronic
930115253 2:47712587-47712609 ATGGATACACAGAGGGAATCAGG + Intronic
931337510 2:61362290-61362312 ATGTATCCAAAGTGGGATTGTGG - Intronic
932308445 2:70720367-70720389 ATGTCTCCACATGGAGATTCCGG - Intronic
934133501 2:88971704-88971726 ATGTATCCAGAGAGGACATCTGG - Intergenic
935869441 2:107429237-107429259 ATGACTCTACAGGGGGAATATGG + Intergenic
936033574 2:109091619-109091641 AGGTAGCCACAGGGGCAATCCGG - Intergenic
936164400 2:110107252-110107274 ATGCAGCCACCGGGGGAAGCTGG + Intronic
946477200 2:220018424-220018446 AGGTGCCCACAGGGGGAGTCTGG - Intergenic
946508032 2:220322490-220322512 ATGTTACCACTGGGGGAAACTGG - Intergenic
947295083 2:228621827-228621849 ATGTTACCACTGGGGGAAACTGG + Intergenic
1168743807 20:218710-218732 GAGTATCTACAGGGAGAATCTGG + Intergenic
1173197188 20:40925358-40925380 ATGTTACCACTGGGGGAATATGG + Intergenic
1174955973 20:55099108-55099130 ATGTTACCACTGGGGGAAACTGG - Intergenic
1175280785 20:57802895-57802917 ATGTTACCACTGGGGGAAACGGG - Intergenic
1177893327 21:26833274-26833296 ATGAATCCACATGGGGAGTCGGG - Intergenic
1178902236 21:36606813-36606835 CTGCATCCACAGGGGGACACCGG - Intergenic
1180226053 21:46393158-46393180 GTGTGTCCACAGGGGGAGTGCGG + Intronic
1181086178 22:20440465-20440487 ATGTTTCCTCAGGGGTACTCAGG + Intronic
1182235451 22:28872277-28872299 ATGTATACACAGGTGCTATCTGG - Intergenic
1182284206 22:29234399-29234421 ATGGAGTCACAGGAGGAATCTGG - Intronic
1183565935 22:38615496-38615518 AGGGATCCAGAGGGGAAATCTGG - Intronic
1183711769 22:39508629-39508651 TTGTATTTACAGGTGGAATCAGG - Intronic
952313637 3:32213119-32213141 ATGTAACCATCGGGGGAAGCTGG + Intergenic
952531299 3:34264808-34264830 ATGTTTCCACAGGGAGAAGCTGG - Intergenic
952724096 3:36563912-36563934 ATGTTACCACTGGGGGAAACTGG - Intergenic
953464611 3:43108416-43108438 ATGTAACCATTGGGGGAAACTGG + Intergenic
955044334 3:55345693-55345715 ATGTAATCACTGGGGGAAACTGG + Intergenic
956214255 3:66832120-66832142 ATGTCACCACTGGGGGAAGCTGG - Intergenic
956325347 3:68046100-68046122 AAGTATCCTCAGTGGGAATATGG - Intronic
956458140 3:69443922-69443944 ATGTATCTACAGGAGTAATTGGG - Intronic
956731085 3:72197391-72197413 ATGTACCCGCTGGGGGAATCGGG - Intergenic
957616433 3:82533637-82533659 GTGTATCCACATGGGGAAGGAGG + Intergenic
959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG + Intronic
960876302 3:122298401-122298423 ATGTGTCCACTGGGGGAGGCAGG + Intergenic
961190068 3:124952658-124952680 ATGTGTTCACAGGGGGAGTAGGG + Intronic
961520361 3:127464218-127464240 AATTATCCACAGAGGGCATCAGG - Intergenic
961802530 3:129463127-129463149 ATGGATCCACTGGGGGAAACTGG - Intronic
963707290 3:148703185-148703207 GTGTCTCAACAGGGGGAATGAGG - Intronic
966831342 3:184012144-184012166 ATGTTACCACTGGGGGAAACTGG + Intronic
967519598 3:190414604-190414626 GTGTCTACACAGGGGGAATGTGG + Intergenic
967909589 3:194530787-194530809 ATGTTACCACTGGGGGAAGCTGG - Intergenic
971221143 4:24706986-24707008 ATGTAGCCATTGGGGGAAACTGG - Intergenic
971260532 4:25052793-25052815 ATGTTTCCAGTGGGGGGATCTGG + Intergenic
972346273 4:38195092-38195114 ATTCCTCCACAGGGGAAATCTGG - Intergenic
972501043 4:39677973-39677995 AGGTAACCACTGGGGGAAACTGG - Intergenic
975555885 4:75664251-75664273 ATGTATCTACTGGGTAAATCAGG + Intronic
976665097 4:87582020-87582042 ATGTTACCACTGGGGGAAACTGG + Intergenic
978193964 4:105948963-105948985 ATGTATTTACAGGGCTAATCCGG + Intronic
978449814 4:108819888-108819910 TTGTATCCACAGGGGGAAAAGGG - Intronic
981210078 4:142092940-142092962 ATGTCTCCTCAGGTTGAATCTGG + Intronic
989069072 5:37491121-37491143 AGGTATCTACAGGGAGAATGTGG + Intronic
990218330 5:53559523-53559545 ATGTAATCACTGGGGGAAACAGG + Intergenic
991952925 5:71964246-71964268 ATGTAACCATTGGGGGAAACTGG + Intergenic
992128738 5:73669433-73669455 ATGTTTCCATTGGGGGAATTGGG - Intronic
997631063 5:135369310-135369332 ATGAGCCCACAGGGGGAATGAGG + Intronic
999102348 5:149036942-149036964 ATGCATCATCAGGGGGAATCTGG - Intronic
1000494857 5:161969506-161969528 ATGTATCCATTGGGTGAAACTGG - Intergenic
1000549697 5:162645256-162645278 ATGTATCCACAGTGGAAAAGTGG - Intergenic
1001073736 5:168608368-168608390 ATGTGGCCTCAGTGGGAATCTGG + Intergenic
1001294673 5:170490580-170490602 ATGTTACCACTGGGGGAAACTGG + Intronic
1002300791 5:178256387-178256409 ATGTCTCCACAGGGGGAGCCTGG - Exonic
1002830644 6:817371-817393 ATGTTACCACTGGGGGAAACTGG - Intergenic
1003339531 6:5206261-5206283 CTTTATCCACAGGAGGAAGCTGG + Intronic
1004506073 6:16247784-16247806 ATGTATACAGAGAGAGAATCAGG + Intronic
1006181842 6:32158237-32158259 ATGCAACCACTGGGGGAAGCTGG - Intronic
1006214437 6:32428119-32428141 ATGTAACCATTGGGGGAAACTGG - Intergenic
1006722807 6:36169803-36169825 ATGTAACCACTGGGGGAAACTGG + Intergenic
1008601479 6:53100423-53100445 AGATATCCTCAGAGGGAATCTGG + Exonic
1008625566 6:53312639-53312661 ATGTTACCACTGGGGGAAACAGG + Intronic
1010039594 6:71365786-71365808 ATGTGACCACTGGGGGAACCTGG + Intergenic
1011372529 6:86652502-86652524 ATGTTACCACTGGGGGAAACAGG - Intergenic
1011562334 6:88633217-88633239 ATGTATTCAGTGGGGGGATCTGG - Intronic
1013190376 6:107799985-107800007 TTGAATCCACAGTGGGAATGTGG + Intronic
1015389726 6:132668004-132668026 ATGTCTCCACATGTGGAATTTGG + Intergenic
1016629520 6:146212092-146212114 ATGTATTAACTGAGGGAATCAGG + Intronic
1017577593 6:155822333-155822355 ATGTAGCCAGAAGGAGAATCAGG - Intergenic
1018033379 6:159862057-159862079 ATGTATCCACTGGGGGAAACTGG - Intergenic
1018724703 6:166602956-166602978 GTCTATCCACAGTGAGAATCTGG + Intronic
1018830120 6:167435615-167435637 ATGTGTCCGCAGAGAGAATCCGG + Intergenic
1022481504 7:30746370-30746392 ATGTTACCACTGGGGGAACCTGG + Intronic
1022597417 7:31725688-31725710 ATGTTACCACTGGGGGAAACTGG + Intergenic
1027598970 7:80214408-80214430 ATGGATTCACTTGGGGAATCTGG - Intronic
1028924598 7:96344212-96344234 ATGTAACCACTGGGGAAAACTGG - Intergenic
1030289084 7:107854665-107854687 ATGTAGACACAGGTGGAAACTGG - Intergenic
1031149566 7:118037377-118037399 ATGTATCTACAGCCAGAATCTGG - Intergenic
1033669850 7:143481256-143481278 ATGTCACCACTGGGGGAAGCTGG - Intergenic
1033797258 7:144861470-144861492 ATGGATCCACATGGGGAGTATGG + Intergenic
1034396153 7:150826343-150826365 ACCTTTCCACAGTGGGAATCTGG - Intronic
1035867173 8:3097460-3097482 ATGTATCCCCAGGGGTAAGGGGG - Intronic
1037662361 8:20938928-20938950 ATTTATACACAGGAGGAATTGGG + Intergenic
1038813567 8:30877722-30877744 ATGTTTCCACTGGAGGAAACTGG - Intronic
1039595129 8:38785059-38785081 AAGTGTCTACAGGGGGAAGCAGG - Intronic
1040515720 8:48133188-48133210 TTGTACCCACTGGGGGAAACTGG - Intergenic
1040851944 8:51909951-51909973 ATATAGCCACAGTGGGAATTAGG + Intergenic
1042396981 8:68304285-68304307 ATGTATCCAGAAGTGGAATTGGG - Exonic
1043523375 8:81070978-81071000 AAATATCCACTGGGGGAAACTGG + Intronic
1047199469 8:122752713-122752735 ATGTAATCACTGGGGGAAACTGG + Intergenic
1049500143 8:142958572-142958594 ATGTAACCACTGGGGGAACTGGG - Intergenic
1049643025 8:143723843-143723865 GTGGGTCCACAGGGGAAATCTGG + Intergenic
1050119238 9:2291282-2291304 ATATATCCACAGAGGGAAAAGGG - Intergenic
1051681779 9:19614761-19614783 CTGAGACCACAGGGGGAATCAGG + Intronic
1056674574 9:88664233-88664255 ATGTTGCCACTGGGGGAAGCTGG + Intergenic
1056964313 9:91153251-91153273 ATGTATCCACAGGAGCAATTGGG + Intergenic
1057091437 9:92261659-92261681 ATGTGACCACTGGGGGAAACTGG + Intronic
1057146025 9:92760118-92760140 CTGACTCCACAGGGGGAGTCTGG - Intronic
1057172290 9:92970092-92970114 ATGTTTCCACAGGGGCATTGAGG - Intronic
1058834120 9:108846028-108846050 ATGTTACCACTGGGGGAAACTGG - Intergenic
1203767816 EBV:35435-35457 AGGTATGAGCAGGGGGAATCAGG - Intergenic
1186580674 X:10814500-10814522 ATGTTACCATAGGGGGAACCTGG - Intronic
1187737500 X:22320032-22320054 ATGTTTCCACAAAGGGACTCAGG - Intergenic
1188249298 X:27873189-27873211 ATGTTTCCATTGGGGGAAACTGG - Intergenic
1188274922 X:28188464-28188486 ATGCATCCACACAGGGAATCAGG - Intergenic
1189770464 X:44420554-44420576 ATGTAACCACCGGGAGAAACTGG + Intergenic
1190000211 X:46678821-46678843 ATGTAACCATTGGGGGAAACTGG - Intronic
1190404771 X:50075852-50075874 GTATATGCACAGGGGGATTCTGG + Exonic
1192813814 X:74571134-74571156 ATGTAGCCATTGGGGGAAACTGG + Intergenic
1192851641 X:74962632-74962654 ATGTTTCTACTGGGGAAATCTGG - Intergenic
1194597587 X:95877863-95877885 ATGAATACACAGGGAGAATATGG - Intergenic
1196035063 X:111135055-111135077 CTCTAGCCACAGGAGGAATCGGG + Intronic
1199749941 X:150806131-150806153 ATGTTACCACTGGGGGAAACTGG + Intronic