ID: 1138541229

View in Genome Browser
Species Human (GRCh38)
Location 16:57688969-57688991
Sequence ATTGGATGGGCAGAGACCAG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 0, 2: 0, 3: 34, 4: 258}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138541229_1138541235 -5 Left 1138541229 16:57688969-57688991 CCCCTGGTCTCTGCCCATCCAAT 0: 1
1: 0
2: 0
3: 34
4: 258
Right 1138541235 16:57688987-57689009 CCAATCAGAGCCCACCCTCCTGG 0: 1
1: 0
2: 2
3: 41
4: 177
1138541229_1138541241 22 Left 1138541229 16:57688969-57688991 CCCCTGGTCTCTGCCCATCCAAT 0: 1
1: 0
2: 0
3: 34
4: 258
Right 1138541241 16:57689014-57689036 GACCCCCGTGTTCAGAGTGCTGG 0: 1
1: 0
2: 0
3: 6
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138541229 Original CRISPR ATTGGATGGGCAGAGACCAG GGG (reversed) Exonic
900169245 1:1258344-1258366 GTTGGGTGGTCAGAAACCAGTGG - Intronic
900880856 1:5380340-5380362 ACTGGATGGACAAAGGCCAGGGG + Intergenic
901130538 1:6960223-6960245 TTTCAAGGGGCAGAGACCAGAGG + Intronic
901550473 1:9992550-9992572 AGAGGATGAGCAGAGGCCAGGGG + Intergenic
901768059 1:11516218-11516240 GTGGGAAGGGCAGAGACCAGCGG - Intronic
902409296 1:16203478-16203500 ACTGGAAGGGGAGAGGCCAGAGG - Intronic
902754666 1:18541130-18541152 ATTGGATGGGATGAGGCCAGAGG - Intergenic
903269153 1:22177026-22177048 TTTGGATTGGCAGAGACAAAAGG + Intergenic
904210421 1:28883555-28883577 ATTGTATGCCCAGAGCCCAGAGG - Intergenic
904893728 1:33798683-33798705 ATTGGAGGCAGAGAGACCAGTGG + Intronic
905292744 1:36933966-36933988 TTTGCATGGTCAGAGACCACTGG + Intronic
905831037 1:41067658-41067680 GATGAATAGGCAGAGACCAGAGG + Intronic
906488902 1:46252369-46252391 GTTGGATGGGGAGAGACTGGAGG + Intronic
907331238 1:53672979-53673001 CCTGGCTGGGCAGAGACCTGGGG - Intronic
909589275 1:77327873-77327895 ACTGGATGGGGAGAGACTAGAGG - Intronic
913191108 1:116413675-116413697 ATGGGATGGGTAAAGACCAAGGG - Intergenic
915459144 1:156059429-156059451 ATTGGGTAGGCAGAGACCTGGGG - Intergenic
915625440 1:157111552-157111574 ATTAGAGGGGCAGAGGCCAAAGG + Intergenic
915748958 1:158186761-158186783 CTTGGAGGGGCAGGGACCACAGG - Intergenic
916703748 1:167325258-167325280 ATTGGCTGGGGTGAAACCAGTGG + Intronic
916743906 1:167669768-167669790 CTTGCAGGGGCAGGGACCAGAGG + Intronic
917839996 1:178969784-178969806 ATTGGGTGGCCAGAGACGTGCGG + Intergenic
917916728 1:179709641-179709663 ATTGCCTGGGCAGAGAGCTGTGG - Intergenic
918187087 1:182137638-182137660 GTTGGATGGGAAGAGGCCTGAGG - Intergenic
920109544 1:203577512-203577534 ATTTGTTCGGCAGAGAGCAGTGG + Intergenic
920259347 1:204678429-204678451 AATGGATGGCCAACGACCAGTGG + Intronic
921560594 1:216653772-216653794 ATTGGATGGTAAGACACTAGAGG + Intronic
923854464 1:237830674-237830696 CTGAGATGGGCAGGGACCAGTGG - Intronic
1062888198 10:1035631-1035653 AATGGGGGAGCAGAGACCAGGGG - Intergenic
1064414776 10:15139447-15139469 AAGGGATGGGCAGAGACCAATGG + Intronic
1066021157 10:31303794-31303816 AGTGGGTGGTCAGAGACTAGGGG + Intergenic
1066178425 10:32935894-32935916 ATTCTATGGGCTGAGACCATTGG - Intronic
1068259920 10:54566474-54566496 AATGAATCGGCAGAGAACAGAGG - Intronic
1068874896 10:61985413-61985435 ATTGGCTGGTCAGACACCAAGGG - Intronic
1069107316 10:64398798-64398820 ATTGAATAGGCAGAGCACAGAGG - Intergenic
1070444443 10:76482041-76482063 ATTGGACAGGCAGAGACGGGTGG - Intronic
1071427263 10:85571516-85571538 ATGGGAAGTGCAGAGACCATGGG - Intergenic
1073761251 10:106631169-106631191 CTTGGCTGGGCATAGAGCAGAGG - Intronic
1074506470 10:114075338-114075360 ATTGAGTGGGTAGAGGCCAGGGG + Intergenic
1075336082 10:121609662-121609684 ACTGGCAGGGGAGAGACCAGAGG - Intergenic
1076797037 10:132803376-132803398 ACAGCCTGGGCAGAGACCAGGGG - Intergenic
1077631081 11:3811373-3811395 AGTGGAAGAGCAGGGACCAGAGG - Exonic
1077992017 11:7420556-7420578 AGAGGCTGGGCAGAGACCACTGG + Exonic
1078674004 11:13392293-13392315 TTGGGATGGGCAGAAACAAGGGG + Intronic
1084013114 11:66363607-66363629 ACTGGATGGGCAGAGGGCAGTGG - Exonic
1084395344 11:68905661-68905683 ATTGGACGTGGAGAGGCCAGAGG + Intronic
1084659380 11:70538099-70538121 AGATGAGGGGCAGAGACCAGTGG + Intronic
1088577695 11:111287604-111287626 ATTGGATCAGGAGGGACCAGAGG - Intergenic
1089070555 11:115696362-115696384 ATTGGAGGGGCTGAGAGCTGAGG + Intergenic
1089565441 11:119368847-119368869 AAGGGCTGGGCAGAGGCCAGCGG + Intronic
1092147604 12:6225305-6225327 ATATGAGGGGCAGAGACCAAGGG + Intronic
1092488025 12:8919646-8919668 ATGGGAAGGACAGAAACCAGAGG - Intronic
1093063291 12:14629939-14629961 ATTGTATGGGCAAAGGGCAGTGG + Intronic
1093400502 12:18740611-18740633 ATTGAAAGAGCAGATACCAGTGG - Intergenic
1094414804 12:30205152-30205174 AGTGTGTGGCCAGAGACCAGAGG - Intergenic
1094414815 12:30205270-30205292 AGTGTGTGGCCAGAGACCAGAGG - Intergenic
1094604098 12:31935826-31935848 ATTGGCTGGGCACAGCACAGTGG - Intergenic
1096844372 12:54397561-54397583 ATTGGATCTGCAGAGCCCAGTGG + Intronic
1097261017 12:57720318-57720340 AGTGGAGGGGCTGGGACCAGTGG + Intronic
1098455587 12:70669671-70669693 ACTTGAAAGGCAGAGACCAGAGG - Intronic
1100913877 12:99395474-99395496 ATTGGATGTGCAAAGATGAGGGG - Intronic
1101377717 12:104185086-104185108 ATTTCATGGGTAGAGGCCAGGGG + Intergenic
1101438044 12:104680693-104680715 TTTGGGTGGGCACATACCAGAGG - Intronic
1101822815 12:108197046-108197068 GTTGGATGGGTAGATGCCAGTGG - Intronic
1102240791 12:111323231-111323253 CTGAGAAGGGCAGAGACCAGGGG + Intronic
1102921795 12:116796990-116797012 ATTTAGTGGACAGAGACCAGGGG + Intronic
1103798179 12:123519579-123519601 ATGTGCTGGGCAGAGGCCAGGGG - Intronic
1104557461 12:129814178-129814200 GTTGGATTGGCAGTTACCAGAGG + Intronic
1104996084 12:132657644-132657666 ATTGGATGGACTAAGGCCAGGGG - Intronic
1105901498 13:24758276-24758298 GGTGGGTGGTCAGAGACCAGGGG - Intergenic
1106852767 13:33812954-33812976 AGTGTCAGGGCAGAGACCAGGGG - Intergenic
1107181545 13:37467046-37467068 ATTGGCTGGGAGGAGCCCAGAGG - Intergenic
1111090870 13:83445296-83445318 ATTGGATTGGAAGAGACCCATGG + Intergenic
1111979473 13:95001980-95002002 CTTGAATGGGCTGAGGCCAGTGG - Intergenic
1112466632 13:99650923-99650945 ATTGGAAGGTCAGAGACATGGGG - Intronic
1112497555 13:99916645-99916667 TTTGGGTTGGCAGACACCAGAGG + Intergenic
1116492263 14:45518501-45518523 ATGGAATGGGCAGATAGCAGAGG + Intergenic
1117757719 14:58992825-58992847 ATTGGCTGGGAACAGTCCAGGGG - Intergenic
1119931145 14:78548698-78548720 AATGGATGGGCAAACAACAGAGG - Intronic
1120386495 14:83853129-83853151 ATTGGAGTGGCAGAGGCCATCGG + Intergenic
1122183049 14:99969845-99969867 CTTTGATAGGCAGTGACCAGGGG + Intergenic
1122470883 14:101965068-101965090 CCTGGATGGGCAGAGCCCGGCGG + Intronic
1122884924 14:104706693-104706715 ATTGAGTAGGTAGAGACCAGTGG + Intronic
1125790127 15:42358947-42358969 TGTGGATGGGGAGAGACAAGAGG + Intergenic
1127311777 15:57758498-57758520 GTTGGGGGGGCAGAGTCCAGGGG + Intronic
1128126994 15:65200535-65200557 ACTGGATGGGGAGAGATTAGAGG - Intronic
1128220087 15:65962933-65962955 ATTGGATGGGCTGAGATTAGCGG + Intronic
1128383129 15:67127824-67127846 AGTGGATGGCTAGAGGCCAGAGG + Intronic
1128865183 15:71109598-71109620 ATGGGATGGCCAGAGAGCAATGG + Intronic
1129202665 15:74014144-74014166 ATTGGAGCTGGAGAGACCAGAGG + Intronic
1129592960 15:76933442-76933464 ATTGGATAATCAGAGACCAAAGG - Intronic
1130094027 15:80842912-80842934 AGTGGATGGGAAGAGCCAAGAGG + Intronic
1131166196 15:90143744-90143766 CTAGGATGGGCACAGAGCAGAGG - Intergenic
1131264662 15:90908861-90908883 ATTGAATGGGCCGAGCGCAGTGG - Intronic
1132965132 16:2649270-2649292 ATTGGATGTGTAGAGAACAGCGG - Intergenic
1133295702 16:4751226-4751248 CGTGGATGTGCACAGACCAGTGG + Exonic
1133693034 16:8234728-8234750 ATTGAATGGGCAGGGCACAGTGG + Intergenic
1133824092 16:9261627-9261649 ATTGGATGGTGTGTGACCAGAGG - Intergenic
1134269838 16:12723843-12723865 GTGGCATGGGCAGAAACCAGTGG - Intronic
1135502312 16:23007182-23007204 ATTGCATGGGTACAGACCAATGG + Intergenic
1136489990 16:30601322-30601344 ATGGAATGGGCAGGGAGCAGTGG + Intergenic
1137486638 16:48896561-48896583 ATGGGATGGGAAGAGATAAGTGG - Intergenic
1137708468 16:50550428-50550450 ATGGGCTGGGGAGAGGCCAGTGG + Intronic
1138121759 16:54405881-54405903 ATTGGAGTGGCTGAGACAAGGGG - Intergenic
1138356373 16:56384215-56384237 AGTGGGTGGGTAGAGGCCAGAGG - Intronic
1138541229 16:57688969-57688991 ATTGGATGGGCAGAGACCAGGGG - Exonic
1138855073 16:60681149-60681171 GTGGGAGGGGCTGAGACCAGTGG - Intergenic
1139347197 16:66311672-66311694 ATTGGAGTGGCAGAGCACAGTGG + Intergenic
1139959031 16:70707145-70707167 GTTGGAAGGGAAGAGAGCAGAGG - Intronic
1140760562 16:78105123-78105145 ATCTGATGGGCAGAGGCCAGTGG + Intronic
1141647794 16:85376755-85376777 CTTTGCTGGGCAGAGAGCAGGGG + Intergenic
1142972871 17:3624536-3624558 GTTGGAGGGACAGAGACCAGGGG - Intronic
1143326715 17:6103791-6103813 CATGGATGGGCTGAGTCCAGGGG - Intronic
1143556950 17:7667964-7667986 ACTGGATGGAGAGAGGCCAGTGG - Intronic
1143672518 17:8406263-8406285 ATGGGATGGGGTGAGACCTGTGG - Intergenic
1143886565 17:10069274-10069296 ACTGGATGGGCAGACAAAAGGGG - Intronic
1144494174 17:15736434-15736456 ATGGGGTGGGCAGGGAACAGTGG + Intronic
1144906087 17:18640242-18640264 ATGGGGTGGGCAGGGAACAGTGG - Intronic
1145222107 17:21097829-21097851 CTTGGATGGGTAGAAACCAGAGG + Intergenic
1146030470 17:29361814-29361836 ATTTGGGGGGCTGAGACCAGAGG + Intergenic
1146427619 17:32757381-32757403 ATTTGGTGGGTAGAGGCCAGGGG + Intronic
1147621455 17:41870715-41870737 ATCTGATTGGGAGAGACCAGTGG - Intronic
1147656459 17:42093870-42093892 AGTGGATGGGCCGAGTGCAGTGG - Intergenic
1148445193 17:47733362-47733384 CTGGGATGGGCAGGGAGCAGGGG - Exonic
1149636697 17:58176856-58176878 ATTGGATGGGTGAAGCCCAGAGG + Intergenic
1152025975 17:77809498-77809520 ATAGCATGGGCAGAGAAAAGGGG - Intergenic
1152089283 17:78237996-78238018 TTTGGCTGGGCAGTGCCCAGAGG + Intronic
1152417672 17:80173249-80173271 AATGGAGAGGCAGAGAGCAGAGG - Intronic
1152781910 17:82230504-82230526 TTTGGAGGGGCAGCTACCAGAGG + Intronic
1153475420 18:5493928-5493950 ATGGGATATGCAGAGACAAGTGG - Intronic
1154358564 18:13641364-13641386 GTTGGATAGGCAGAGACAAATGG + Intronic
1155422316 18:25668494-25668516 ATTGGAAGGGCAGTGAATAGAGG + Intergenic
1155514867 18:26614488-26614510 GTGGGATGGGCAGAGAGGAGAGG + Intronic
1156339024 18:36194717-36194739 ATCAGATTGGCAGAGATCAGTGG - Intronic
1156484463 18:37456152-37456174 ACTTGATGGGGAGAAACCAGGGG - Intronic
1158063505 18:53376943-53376965 ATTGTCTGGGCAAAGACCATAGG - Intronic
1158676411 18:59523275-59523297 AATGGTTGGGCAGAGCCCAGTGG + Intronic
1158718189 18:59899582-59899604 TGTGGGTGGGGAGAGACCAGAGG - Intergenic
1159880038 18:73850340-73850362 ATATGATGGGCAGAGACCTGGGG + Intergenic
1161321281 19:3642803-3642825 AGAGAATGGGCAGAGAGCAGAGG + Intronic
1161466645 19:4434498-4434520 ATTGGACGGGCAGAGCACAGGGG - Intronic
1161501359 19:4617847-4617869 ACTGGGTGGGCAGTGGCCAGAGG - Intergenic
1161635930 19:5388812-5388834 ATTGGAAGAGGAGAGAACAGAGG + Intergenic
1162860527 19:13503594-13503616 AGGGGATGGACAGAGACCTGGGG - Intronic
1166382813 19:42363495-42363517 GTTGGAGAGGCAGAGGCCAGGGG - Intronic
1167486831 19:49767594-49767616 ATGGAATGGGAAGAGGCCAGAGG + Intronic
925845789 2:8031994-8032016 ATTTGATGGGCAACGTCCAGAGG - Intergenic
926153278 2:10436144-10436166 ATAGGATTGGCAGAGAGCAGGGG + Intergenic
926231428 2:11007058-11007080 ATGGGATGCTCAGAGAACAGAGG + Intergenic
926447082 2:12956395-12956417 ATTTGATGGGTAGAAACTAGGGG - Intergenic
926602456 2:14860651-14860673 ATTAGATTGGCAGTTACCAGAGG + Intergenic
927914666 2:26927453-26927475 ATTGGATGGAGGGACACCAGTGG + Intronic
930938895 2:56989513-56989535 CTTGGATGGGTAGGGGCCAGGGG - Intergenic
932347601 2:71005864-71005886 ACTGGATAGGCAGAGAGAAGGGG - Intergenic
932596776 2:73098679-73098701 CTTGGTTGGGCAGAGACATGGGG - Intronic
933307325 2:80618617-80618639 GTTGGATGTGCAGAGGCCAAAGG + Intronic
935455958 2:103268185-103268207 AAAGGATGGGCAGAGGCCAGGGG + Intergenic
937118834 2:119428092-119428114 ACTGGAGGGGCAGAGAGGAGAGG + Intergenic
943434909 2:187852995-187853017 AATGAATAGGCAGAGAACAGAGG - Intergenic
945312424 2:208330108-208330130 ATTAGATGGGCAGAGATATGAGG - Intronic
945905375 2:215587028-215587050 ATTGAATTGAAAGAGACCAGAGG - Intergenic
946385858 2:219384163-219384185 AGTGCAAGGGCAGAGACCAAAGG + Intronic
946453029 2:219797555-219797577 ACTGGATCTGCAGTGACCAGTGG - Intergenic
946455476 2:219822303-219822325 ATTGGTGGAGCAGAGACTAGGGG + Intergenic
947799843 2:232921934-232921956 AGTGGGACGGCAGAGACCAGAGG + Intronic
948403823 2:237702975-237702997 ATTGTATGGGCAGAGAAAGGAGG + Intronic
948541068 2:238691730-238691752 GCTGGATGGGAAGAGCCCAGCGG + Intergenic
1168979202 20:1990599-1990621 ATTTGCTGTGCAGAGACCAGAGG + Intronic
1169066717 20:2698064-2698086 AGAGGGTGGGCAGAGAGCAGTGG + Intronic
1169459177 20:5779724-5779746 CCAGGATGGGCAGAGACCAATGG - Intronic
1169602343 20:7276011-7276033 ATGGGATGGGCTGAAACCTGTGG + Intergenic
1170738522 20:19031936-19031958 CTTGGATGGATAGAGACCATTGG - Intergenic
1170831774 20:19848992-19849014 AATGGATGTACAGAGACCTGAGG - Intergenic
1171288798 20:23967713-23967735 ATTGTAGGGGCAGAGACAGGCGG + Intergenic
1171360895 20:24585763-24585785 TTTGGTTGGGCAGATAGCAGTGG - Intronic
1173569111 20:44065531-44065553 ACTGGATGGTCAGAGCCAAGGGG + Intronic
1174289484 20:49497580-49497602 ATTACATGGAAAGAGACCAGAGG + Intergenic
1174763323 20:53228567-53228589 ATCCAATGGGCAGAGGCCAGGGG - Intronic
1174777794 20:53361701-53361723 ATTTGGTGGTCAGAGGCCAGAGG + Intronic
1175183515 20:57164951-57164973 ATTGGAAATGCAGATACCAGGGG - Intergenic
1175805598 20:61826822-61826844 ACTGGATGGGCCAAGAGCAGAGG - Intronic
1179353865 21:40640373-40640395 ATGGTAAGGGCAGAGACAAGAGG - Intronic
1181751470 22:24991966-24991988 AGGGGATGGGAAGAGACCGGAGG - Intronic
1182018610 22:27061936-27061958 ATTGGCTGGGTTGAGACCAGAGG - Intergenic
1182089285 22:27583284-27583306 ATTGGAGGGCCAGACACCACTGG - Intergenic
1182436923 22:30336831-30336853 ATTGGAGGAGCAGAGAGCATTGG - Intronic
1182799254 22:33018075-33018097 ATTGGAGGGTTAGAGACAAGAGG + Intronic
1183081551 22:35459778-35459800 ATAGGATGGGCAGAGCCCACTGG - Intergenic
1183988975 22:41585285-41585307 TTTGACTGGGCTGAGACCAGGGG + Intronic
1184099694 22:42335663-42335685 ATAGCAGGGGCAGAGACCTGAGG + Intronic
1184648892 22:45910644-45910666 AGTGGATGTTCAGTGACCAGTGG - Intergenic
949146844 3:711012-711034 AATGAATAGGCAGAGAACAGAGG - Intergenic
949585595 3:5433816-5433838 ATTGGGTGGCCAGAGGCAAGGGG + Intergenic
950528728 3:13540141-13540163 GAGGGATGGGAAGAGACCAGAGG + Intergenic
950577334 3:13840108-13840130 ATTGCAAGGTCAGAGCCCAGAGG - Intronic
950646627 3:14381300-14381322 ATTGAAGGGGCTGAGATCAGAGG - Intergenic
950799719 3:15540348-15540370 ATGAGATGGGTATAGACCAGAGG + Intergenic
950906326 3:16542136-16542158 GTTGGAGAGGCTGAGACCAGAGG - Intergenic
951498656 3:23359015-23359037 ATGGGAGTGGCAGAGACAAGGGG + Intronic
951905130 3:27698748-27698770 AATGAATGGGCAGAGCGCAGAGG + Intergenic
953708952 3:45253328-45253350 ATTGGATGCTGAGAGGCCAGTGG + Intergenic
953772310 3:45787206-45787228 AGTGGATGGAGAGAGGCCAGCGG - Intronic
954625501 3:52019977-52019999 AGTGGAGGGGCAGAGAGAAGCGG + Intergenic
954710659 3:52503701-52503723 ATGGGTAGGGCAGACACCAGTGG + Intronic
955348968 3:58180215-58180237 GTTGGATGGCCAGAGACCAAGGG + Intergenic
956529258 3:70199823-70199845 TTTGGATGGGCTGAGAGAAGGGG - Intergenic
956700345 3:71953266-71953288 ATGGGATGGGCCGAGTGCAGTGG - Intergenic
958721454 3:97848935-97848957 ATGGCAGGGGCAGAGAACAGTGG - Intronic
961603802 3:128078968-128078990 ATTTGAGGGGCAGGAACCAGGGG + Intronic
961821901 3:129579436-129579458 GGGGGAGGGGCAGAGACCAGAGG + Intronic
964340665 3:155705527-155705549 ATTGGCTGGGGAGAGGGCAGAGG - Intronic
968934998 4:3605175-3605197 ATTGGAGGGGCAGGGAGCAGGGG + Intergenic
968936527 4:3614024-3614046 ATGGGAGGGGCAGAGCCCAGGGG - Intergenic
969704074 4:8782612-8782634 CTGGGGTGGGCAGAGGCCAGTGG + Intergenic
971530725 4:27685245-27685267 TTTGCATAGTCAGAGACCAGAGG + Intergenic
971783720 4:31073644-31073666 CGTGGTTGGGCAGAGGCCAGAGG - Intronic
973990970 4:56406762-56406784 ATTGGCTGGGCAGAGAAGAGAGG - Intronic
975847817 4:78543409-78543431 ATTGCATGGGAAGAGTACAGAGG + Intronic
975876098 4:78838562-78838584 TTTGGAAGGGCAGAGAATAGAGG + Intronic
978178682 4:105766413-105766435 ACTGGAAGCCCAGAGACCAGGGG + Intronic
982953852 4:161737069-161737091 CAAGGAAGGGCAGAGACCAGGGG + Intronic
983177441 4:164607491-164607513 ATTAGATGGGCTGAGTGCAGTGG - Intergenic
983871962 4:172833524-172833546 TTTGGAAAGGCAGAGAGCAGAGG - Intronic
986281454 5:6326224-6326246 GCTGGACAGGCAGAGACCAGAGG - Intergenic
992572928 5:78078319-78078341 ATTGGATAGGAAGAGAACAAAGG - Intronic
992752134 5:79871467-79871489 ATTGGTTCAGCAGAGAGCAGGGG + Intergenic
995479539 5:112580904-112580926 ATGGGATGGGCAGAGAGGATGGG - Intergenic
997073664 5:130646281-130646303 CTTGGAGGAGCAGAGACCACAGG + Intergenic
997198892 5:131997810-131997832 CTTGGCTGGGCAGCAACCAGAGG + Intronic
997384934 5:133465182-133465204 ATGGCATGGGCAGAGGCCAGGGG - Intronic
998566503 5:143220532-143220554 GATGGATGGGCAGAGGGCAGGGG + Intronic
1000116978 5:158162486-158162508 TTTGAAAGGGCAGGGACCAGGGG + Intergenic
1000659663 5:163921505-163921527 ATTGGCTGGGAAGTGACCATTGG + Intergenic
1001022905 5:168198747-168198769 ATGCGATGGGCAGAGCACAGAGG - Intronic
1001975149 5:175992778-175992800 ATTGGATGGGGTGAGATCAAGGG - Intronic
1001993288 5:176134524-176134546 AGGGGATGGGGAGAGAACAGAGG - Intergenic
1002131597 5:177085539-177085561 GAGGGATGGGCAGAGATCAGAGG + Intergenic
1002459643 5:179366942-179366964 AGAGGATGGGCAGTGGCCAGGGG + Intergenic
1004162050 6:13222768-13222790 ATCTGGTGGGCAGAGGCCAGGGG + Intronic
1004271360 6:14198984-14199006 GGTGGCTGGGCAGAGACAAGCGG - Intergenic
1005398861 6:25411207-25411229 ATTGGGTGAGCAGACAGCAGGGG - Intronic
1005811195 6:29517742-29517764 ATAGGAAGGGCAGAGGGCAGAGG - Intergenic
1006417241 6:33911915-33911937 ATTGGATGGGCTGAGAGCTTTGG + Intergenic
1007324413 6:41049130-41049152 AAGGGAAGGACAGAGACCAGTGG - Intronic
1008673993 6:53800008-53800030 CTTGAAAGGGCAGAGAGCAGAGG + Intronic
1009515692 6:64614014-64614036 ATTCGAAGGTCACAGACCAGAGG + Intronic
1011620716 6:89239913-89239935 AGTGGAGAGGCAGAAACCAGTGG - Intergenic
1012688669 6:102286315-102286337 ATTGAATGGGCAAAAGCCAGAGG + Intergenic
1013164864 6:107580663-107580685 ATTTGTTGGGCAAAGACCAGAGG + Intronic
1015121500 6:129705950-129705972 ATTGGGTAGGCAGAAACAAGAGG - Intronic
1016141040 6:140610564-140610586 AATAGATGGGCATAGACCTGTGG - Intergenic
1018205829 6:161436279-161436301 ATGGGAGGGACAGAGAGCAGGGG + Intronic
1018388812 6:163327773-163327795 ACAGGGTGGGCAGAGGCCAGAGG + Intergenic
1018541904 6:164890193-164890215 ATTGGATGGGCACAGGAGAGAGG - Intergenic
1018597959 6:165503504-165503526 TCTTGATGGGCAGAGACCTGTGG - Intronic
1019567015 7:1688868-1688890 AATGGATTAGCAGTGACCAGAGG - Intronic
1020033795 7:4951559-4951581 GCTGGATGGGCAGAAACCACAGG - Intronic
1020930317 7:14384812-14384834 ATTTGATAGGCAGAGGCCAGGGG + Intronic
1022657851 7:32337125-32337147 CTTGGAAGGGAGGAGACCAGAGG - Intergenic
1024231618 7:47367763-47367785 AGTGGCTGGGCAGAGGCCTGGGG - Intronic
1026674455 7:72417231-72417253 ATGGGATTGGCAGAGACCTTGGG + Intronic
1027137689 7:75636934-75636956 AGAGGATGGGCAGAGTCCATTGG - Intronic
1027702339 7:81484470-81484492 ACTGGTTAGGCAGAGACCAATGG - Intergenic
1030900270 7:115114852-115114874 ATTGGATGAAGAGAGAACAGTGG + Intergenic
1032906627 7:136374876-136374898 AGGGGGTGGGTAGAGACCAGAGG + Intergenic
1036965585 8:13294089-13294111 AATGAATGGGCAGAGCACAGGGG - Intronic
1037247912 8:16857869-16857891 ATTGAAGTGGCAGAGTCCAGCGG + Intergenic
1037472680 8:19225780-19225802 ATTCCAAGGGCAGAGATCAGGGG + Intergenic
1040464899 8:47685555-47685577 AGTGCATTGGCAGAGATCAGTGG + Intronic
1041748418 8:61233895-61233917 ACTGGATGTGCGGAGACAAGAGG - Intronic
1043673981 8:82925873-82925895 ACTGGATGAGGAGAGACAAGTGG - Intergenic
1044591317 8:93916853-93916875 ATTGGCTGCGCAGTGACGAGTGG - Intronic
1044654431 8:94532719-94532741 ATTTGAAGGGCTGAGACAAGAGG + Intronic
1044888824 8:96810140-96810162 AAGGGATGGGGAGAAACCAGGGG - Intronic
1047881870 8:129203301-129203323 ATTGGATGGGCAGAAACCCCAGG + Intergenic
1048612695 8:136041129-136041151 AATGGATGGCCAGAGACCAAGGG + Intergenic
1049405111 8:142448924-142448946 AGTGGATGGGCAGCACCCAGTGG - Intergenic
1051607484 9:18929612-18929634 ATTGGGTGGTGAGAGAACAGTGG + Intronic
1054455176 9:65426803-65426825 ATTGGAGGAGCAGGGAGCAGGGG - Intergenic
1055402747 9:75941850-75941872 TCTGGATGGTCAGAAACCAGAGG + Intronic
1059160917 9:112034562-112034584 AATGGATAGTCAGAGAGCAGCGG - Intergenic
1060076161 9:120592286-120592308 ACTGGATGGGCAGGCTCCAGGGG - Intergenic
1189303578 X:39970119-39970141 ATTGGATGGAATTAGACCAGAGG - Intergenic
1190118539 X:47641512-47641534 ATAGGAGGGGCAGAGGTCAGCGG + Intronic
1191965304 X:66751107-66751129 ATTGGGTGGGCAGACTCCACAGG - Intergenic
1192334320 X:70204784-70204806 ATTAGATGATCAGAGAACAGGGG + Intronic
1194312950 X:92337374-92337396 AATGGATTGGCAGAAACCAGAGG - Intronic
1195745981 X:108118718-108118740 TTTGGGTGAGCAGAGACAAGAGG - Intronic
1198049649 X:132938352-132938374 ATAGACTGGGCAGAGAACAGTGG + Intronic
1200621218 Y:5451488-5451510 AATGGATTGGCAGAAACCAGAGG - Intronic
1202234217 Y:22691538-22691560 ATTGGATGGGCAGAGATGTGGGG + Intergenic
1202308942 Y:23504628-23504650 ATTGGATGGGCAGAGATGTGGGG - Intergenic
1202561859 Y:26165960-26165982 ATTGGATGGGCAGAGATGTGGGG + Intergenic