ID: 1138541229

View in Genome Browser
Species Human (GRCh38)
Location 16:57688969-57688991
Sequence ATTGGATGGGCAGAGACCAG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 0, 2: 0, 3: 34, 4: 258}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138541229_1138541241 22 Left 1138541229 16:57688969-57688991 CCCCTGGTCTCTGCCCATCCAAT 0: 1
1: 0
2: 0
3: 34
4: 258
Right 1138541241 16:57689014-57689036 GACCCCCGTGTTCAGAGTGCTGG 0: 1
1: 0
2: 0
3: 6
4: 82
1138541229_1138541235 -5 Left 1138541229 16:57688969-57688991 CCCCTGGTCTCTGCCCATCCAAT 0: 1
1: 0
2: 0
3: 34
4: 258
Right 1138541235 16:57688987-57689009 CCAATCAGAGCCCACCCTCCTGG 0: 1
1: 0
2: 2
3: 41
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138541229 Original CRISPR ATTGGATGGGCAGAGACCAG GGG (reversed) Exonic