ID: 1138541684

View in Genome Browser
Species Human (GRCh38)
Location 16:57691454-57691476
Sequence TGCAGGAACCGCAGGTGATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138541684_1138541690 20 Left 1138541684 16:57691454-57691476 CCTCATCACCTGCGGTTCCTGCA No data
Right 1138541690 16:57691497-57691519 GTTGAGCACCCATAAGGCCAAGG No data
1138541684_1138541693 23 Left 1138541684 16:57691454-57691476 CCTCATCACCTGCGGTTCCTGCA No data
Right 1138541693 16:57691500-57691522 GAGCACCCATAAGGCCAAGGGGG No data
1138541684_1138541692 22 Left 1138541684 16:57691454-57691476 CCTCATCACCTGCGGTTCCTGCA No data
Right 1138541692 16:57691499-57691521 TGAGCACCCATAAGGCCAAGGGG No data
1138541684_1138541696 29 Left 1138541684 16:57691454-57691476 CCTCATCACCTGCGGTTCCTGCA No data
Right 1138541696 16:57691506-57691528 CCATAAGGCCAAGGGGGCTATGG No data
1138541684_1138541688 14 Left 1138541684 16:57691454-57691476 CCTCATCACCTGCGGTTCCTGCA No data
Right 1138541688 16:57691491-57691513 TGCCATGTTGAGCACCCATAAGG No data
1138541684_1138541691 21 Left 1138541684 16:57691454-57691476 CCTCATCACCTGCGGTTCCTGCA No data
Right 1138541691 16:57691498-57691520 TTGAGCACCCATAAGGCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138541684 Original CRISPR TGCAGGAACCGCAGGTGATG AGG (reversed) Intergenic