ID: 1138541686

View in Genome Browser
Species Human (GRCh38)
Location 16:57691471-57691493
Sequence GCACTTGGAGCTGCTTTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138541686_1138541690 3 Left 1138541686 16:57691471-57691493 CCTGCAAAAGCAGCTCCAAGTGC No data
Right 1138541690 16:57691497-57691519 GTTGAGCACCCATAAGGCCAAGG No data
1138541686_1138541691 4 Left 1138541686 16:57691471-57691493 CCTGCAAAAGCAGCTCCAAGTGC No data
Right 1138541691 16:57691498-57691520 TTGAGCACCCATAAGGCCAAGGG No data
1138541686_1138541693 6 Left 1138541686 16:57691471-57691493 CCTGCAAAAGCAGCTCCAAGTGC No data
Right 1138541693 16:57691500-57691522 GAGCACCCATAAGGCCAAGGGGG No data
1138541686_1138541696 12 Left 1138541686 16:57691471-57691493 CCTGCAAAAGCAGCTCCAAGTGC No data
Right 1138541696 16:57691506-57691528 CCATAAGGCCAAGGGGGCTATGG No data
1138541686_1138541692 5 Left 1138541686 16:57691471-57691493 CCTGCAAAAGCAGCTCCAAGTGC No data
Right 1138541692 16:57691499-57691521 TGAGCACCCATAAGGCCAAGGGG No data
1138541686_1138541688 -3 Left 1138541686 16:57691471-57691493 CCTGCAAAAGCAGCTCCAAGTGC No data
Right 1138541688 16:57691491-57691513 TGCCATGTTGAGCACCCATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138541686 Original CRISPR GCACTTGGAGCTGCTTTTGC AGG (reversed) Intergenic