ID: 1138541688

View in Genome Browser
Species Human (GRCh38)
Location 16:57691491-57691513
Sequence TGCCATGTTGAGCACCCATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138541685_1138541688 6 Left 1138541685 16:57691462-57691484 CCTGCGGTTCCTGCAAAAGCAGC No data
Right 1138541688 16:57691491-57691513 TGCCATGTTGAGCACCCATAAGG No data
1138541686_1138541688 -3 Left 1138541686 16:57691471-57691493 CCTGCAAAAGCAGCTCCAAGTGC No data
Right 1138541688 16:57691491-57691513 TGCCATGTTGAGCACCCATAAGG No data
1138541684_1138541688 14 Left 1138541684 16:57691454-57691476 CCTCATCACCTGCGGTTCCTGCA No data
Right 1138541688 16:57691491-57691513 TGCCATGTTGAGCACCCATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138541688 Original CRISPR TGCCATGTTGAGCACCCATA AGG Intergenic