ID: 1138543325

View in Genome Browser
Species Human (GRCh38)
Location 16:57701600-57701622
Sequence AGGTGGGTATCGAAGGAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 215}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138543325 Original CRISPR AGGTGGGTATCGAAGGAAGG GGG Intronic
900146283 1:1160257-1160279 AGGAGGGAAGGGAAGGAAGGAGG + Intergenic
901090239 1:6636008-6636030 AGGTGGGCAGCTGAGGAAGGTGG + Intronic
901134781 1:6986119-6986141 AGGTGGGTATCAGAGGACGGAGG + Intronic
901696389 1:11011311-11011333 AGGTGGGAAGGGAGGGAAGGGGG + Intergenic
901739789 1:11334608-11334630 AGGTGAGTATGGGAGGGAGGAGG + Intergenic
902987266 1:20162417-20162439 AGGTGGGCATGGAACCAAGGTGG - Intronic
903214401 1:21835532-21835554 AGCTGGTTATCCAAGGTAGGAGG - Exonic
903291602 1:22317717-22317739 AGGTGAGTGTCCAAGGATGGTGG - Intergenic
905323138 1:37131797-37131819 AAGTGGGGAAGGAAGGAAGGGGG - Intergenic
906013316 1:42550296-42550318 AGGAGGGTATGGAAGCAGGGAGG - Intronic
906197714 1:43939253-43939275 AGGAGGGGAGGGAAGGAAGGAGG + Intergenic
907923507 1:58934599-58934621 TGGGGGGAATGGAAGGAAGGTGG + Intergenic
915004958 1:152627345-152627367 AGGGAGGGATGGAAGGAAGGAGG - Intergenic
915103149 1:153515128-153515150 AGGTGGGTGCAGAGGGAAGGAGG - Intergenic
915298529 1:154938813-154938835 AGGAGGGTAGCGCAGGCAGGTGG - Intergenic
915441012 1:155945531-155945553 AGGTGGGGAAGGAAGGTAGGTGG - Intergenic
916429511 1:164713552-164713574 AGGAGAGGATGGAAGGAAGGGGG - Intronic
919483635 1:198119778-198119800 AGGTGGTTATGGAGAGAAGGAGG - Intergenic
920235352 1:204499742-204499764 AGGTGGGGATTGGAGGTAGGAGG - Intergenic
920540542 1:206774584-206774606 AGATGGGAAACAAAGGAAGGAGG - Intergenic
923145610 1:231195656-231195678 AGGTGGAAATACAAGGAAGGGGG - Intronic
923199260 1:231695453-231695475 AGGTGGGTATAGCCGGAAGTAGG + Intronic
1064614065 10:17134622-17134644 AGGTGGTTTTGGAAGGAGGGAGG - Intergenic
1065933546 10:30500182-30500204 AGGAGGGAAGGGAAGGAAGGAGG + Intergenic
1066540444 10:36441008-36441030 AGGTTGATATAAAAGGAAGGAGG - Intergenic
1066622886 10:37376735-37376757 AGGTGGGTATATAAGAAAGGAGG - Intronic
1068058061 10:52035309-52035331 TGGTGTGTAGGGAAGGAAGGGGG + Intronic
1069904044 10:71721964-71721986 AGCTGGGTTTGGAAGGATGGAGG - Intronic
1070402353 10:76064365-76064387 AGGTGGGTTGAGAAAGAAGGAGG - Intronic
1070689734 10:78515686-78515708 AGGTGGCTTACCAAGGAAGGGGG + Intergenic
1070820047 10:79349132-79349154 AGATGGGTCTAGAGGGAAGGGGG + Intronic
1072634037 10:97165838-97165860 AGGTGGCCTTGGAAGGAAGGAGG - Intronic
1075728641 10:124623411-124623433 AGGTGGTCGTCGAAGGAAGGGGG + Exonic
1075831191 10:125412987-125413009 AGTTGGGCATCTCAGGAAGGTGG + Intergenic
1077128228 11:954247-954269 AGGTGGGAATCCAAGTGAGGTGG - Intronic
1080577252 11:33611150-33611172 AGGTGGGAAAGGAAGAAAGGTGG - Intronic
1081625824 11:44654536-44654558 AGGTGGGGAATGGAGGAAGGGGG - Intergenic
1081845948 11:46240439-46240461 TGGTGGGTTTCTCAGGAAGGAGG + Intergenic
1082082004 11:48019362-48019384 AGGTGGGGTTCGGGGGAAGGTGG - Intronic
1083329345 11:61890458-61890480 AGGTGGGTAACTAAGGAAAAGGG + Intronic
1083355807 11:62065178-62065200 AGGTGGGTATCCAAGTCTGGTGG - Intergenic
1083474316 11:62906162-62906184 CGGTGGGAGTGGAAGGAAGGTGG + Intergenic
1085449386 11:76622854-76622876 AGGTGGGTGTCAGGGGAAGGCGG - Intergenic
1088350715 11:108884416-108884438 AGGTGAGAAACGAAGGAGGGAGG - Intronic
1090609180 11:128454992-128455014 AGCAGGGTATGGATGGAAGGCGG - Intergenic
1090627439 11:128619040-128619062 AGGTGGGGAGTGAAGGAAGGTGG + Intergenic
1090991167 11:131818125-131818147 AGGTGGGTTCTGAAGCAAGGAGG - Intronic
1091282011 11:134387216-134387238 AGGTGGGAAGTGAAGGGAGGGGG - Intronic
1091303527 11:134523105-134523127 GAGTGGGGATGGAAGGAAGGTGG + Intergenic
1091798550 12:3310687-3310709 TGGTGGTAATAGAAGGAAGGTGG - Intergenic
1093545363 12:20338746-20338768 ACTTGGGTTTAGAAGGAAGGTGG + Intergenic
1095765847 12:45894974-45894996 AGGTGGGCAACGCAGGGAGGAGG - Intronic
1095990515 12:48031123-48031145 AGGTGAGCATTAAAGGAAGGCGG + Intergenic
1097928733 12:65160652-65160674 AGGTGGATATCTAAGGGAGAAGG - Intergenic
1099134893 12:78885262-78885284 AGGAGGGAAGGGAAGGAAGGAGG + Intronic
1099356785 12:81646840-81646862 TGTTTGGTATGGAAGGAAGGAGG + Intronic
1100420213 12:94425048-94425070 AGGAGGGGATCGAGGGAAAGGGG + Intronic
1101788625 12:107908788-107908810 AGCTGGATATCAAAAGAAGGAGG - Intergenic
1106499607 13:30315348-30315370 AGGTGGGTATAGGCAGAAGGAGG - Intergenic
1107481580 13:40789843-40789865 AGGTGGGCACTGCAGGAAGGAGG - Intronic
1107590591 13:41899862-41899884 AAGTGGGTATTGATGTAAGGAGG - Intronic
1107969924 13:45631571-45631593 AGTTGGAAATGGAAGGAAGGTGG - Intergenic
1110889825 13:80684820-80684842 GGGTGGGTACAGAAGGAGGGAGG + Intergenic
1112399602 13:99064344-99064366 ATTTGGATATCAAAGGAAGGTGG + Intronic
1113781165 13:112978363-112978385 AGGTGGGTGTGGAAGGCAGGAGG + Intronic
1115850715 14:37588062-37588084 GGGTGGGGGTCGCAGGAAGGCGG + Intergenic
1117464006 14:55974334-55974356 TGGTGGGTGTCTAAGGGAGGAGG + Intergenic
1118765046 14:68904037-68904059 TGTTGGGTAGGGAAGGAAGGAGG - Intronic
1118776037 14:68974616-68974638 AGGTGCATCTCAAAGGAAGGCGG - Intronic
1121447486 14:93988078-93988100 AGGAGGGGATGGGAGGAAGGGGG + Intergenic
1121795648 14:96733178-96733200 AGGTGGGTAAAGATGGCAGGAGG - Intergenic
1121843621 14:97154867-97154889 AGGTGGGGCTGGAAGGAAGTGGG + Intergenic
1124651563 15:31477881-31477903 AGGTGGGTAGGGAGGGAGGGTGG + Exonic
1125584543 15:40810719-40810741 AGGTGGCTATCGATGAAAGCTGG + Exonic
1125911701 15:43445701-43445723 AGGTGAATATGGAAGTAAGGGGG - Intronic
1126549897 15:49916913-49916935 AGGTAGGTGTTGAAGGAAGGAGG - Exonic
1127602859 15:60555694-60555716 AGGTGGGAAGAAAAGGAAGGTGG + Intronic
1128334318 15:66776331-66776353 AAGTGGGTGCAGAAGGAAGGAGG - Intronic
1130175912 15:81570620-81570642 AGGTGGGGAAAGAAGGATGGAGG - Intergenic
1130844883 15:87735147-87735169 AGGTGGGGAGGGAAGGGAGGAGG + Intergenic
1131786182 15:95913492-95913514 AGGTGGGTATGGAAGCCCGGAGG - Intergenic
1131864084 15:96688321-96688343 AGGTGGGTACAGAAGGCATGAGG + Intergenic
1133008785 16:2898750-2898772 GGGTGGGGATGGAAGGATGGAGG - Intronic
1134052493 16:11146538-11146560 GGATGGGTATAGAAGGATGGAGG + Intronic
1135254441 16:20929762-20929784 AGGTGGGGATGTAGGGAAGGTGG - Intergenic
1138543325 16:57701600-57701622 AGGTGGGTATCGAAGGAAGGGGG + Intronic
1139480509 16:67227943-67227965 AAGTGGGCATAGAAGCAAGGAGG - Intronic
1140914591 16:79482885-79482907 AGGTAGGGAGGGAAGGAAGGAGG - Intergenic
1144350278 17:14388595-14388617 AGGTGGGGATAGAAGGAAGAGGG + Intergenic
1146946134 17:36874884-36874906 AGGTGGGGATAGGAGGGAGGAGG - Intergenic
1147170232 17:38614214-38614236 ATGTGTGTAAGGAAGGAAGGGGG - Intergenic
1148205812 17:45779125-45779147 AGCTGGGTATTGAAGGAAGTGGG - Intergenic
1150646097 17:66978409-66978431 AGATGGGTCTCAGAGGAAGGGGG + Intronic
1150713752 17:67553954-67553976 TGGTAGTTATCGATGGAAGGTGG + Intronic
1151606806 17:75142642-75142664 AGGGGGGGATGGAGGGAAGGGGG + Intronic
1152062079 17:78084478-78084500 AGGGGAGGATAGAAGGAAGGAGG + Intronic
1152320819 17:79608202-79608224 AGGCGGATGTCGAGGGAAGGTGG - Intergenic
1152614971 17:81333812-81333834 AGTTGGGTACAGGAGGAAGGTGG + Intergenic
1153591063 18:6674546-6674568 TGGTGGGGACTGAAGGAAGGGGG + Intergenic
1156757922 18:40551154-40551176 AGGTGGGTTTAAAAGAAAGGTGG + Intergenic
1157082021 18:44535704-44535726 AGGTGGGTTTTGAGGGAAAGAGG + Intergenic
1157721839 18:49931371-49931393 AGATGGGTGTGGAAAGAAGGTGG - Intronic
1160398236 18:78587986-78588008 AGGTGTGTGCAGAAGGAAGGGGG + Intergenic
1161046337 19:2136755-2136777 AGGTGGTGAGCGAGGGAAGGGGG + Intronic
1164400867 19:27901340-27901362 AGGTAGGTATCTAAGGGAAGAGG + Intergenic
1165833743 19:38742550-38742572 AGGTGAGGATGGAAGGAGGGAGG + Intronic
1165912346 19:39237078-39237100 AGGTGGGAGTAGAGGGAAGGGGG + Intergenic
1167276559 19:48543580-48543602 AGGGGGGTATCGGAGGGTGGTGG + Intergenic
1168705063 19:58465900-58465922 AGGTAGGTATAGAGGGAGGGAGG + Intergenic
925199185 2:1952715-1952737 AGGAGGGAAGGGAAGGAAGGAGG - Intronic
925199239 2:1952874-1952896 AGGAGGGAAGGGAAGGAAGGAGG - Intronic
925199256 2:1952927-1952949 AGGAGGGAAGGGAAGGAAGGAGG - Intronic
925833070 2:7915408-7915430 AGGTGGGGAGTGGAGGAAGGAGG - Intergenic
926002954 2:9348895-9348917 ACGTGGGTATCCATGGAAGGCGG - Intronic
926627181 2:15101993-15102015 AGCTGGGTCTTGAAGGCAGGAGG - Intergenic
926643846 2:15266742-15266764 AAGTAGGTAGAGAAGGAAGGAGG - Intronic
927641797 2:24850095-24850117 AGGTGGGTGTCGAAGGTGTGGGG - Intronic
927692483 2:25218017-25218039 AGGTGATTATCTCAGGAAGGTGG + Intergenic
930517363 2:52424734-52424756 AGGAGGGCAAGGAAGGAAGGAGG + Intergenic
930696528 2:54417126-54417148 AAGTGGGGATCCAAGGAGGGAGG + Intergenic
932022724 2:68104053-68104075 AGGTGGGAGTGGAAGGAAGAAGG + Intronic
932595793 2:73092830-73092852 AGGTGGGGCTGGAAGGGAGGTGG - Intronic
933213275 2:79596337-79596359 AGGAGGGCATCAAAGGAAGAAGG + Intronic
933628878 2:84633828-84633850 TTGTGGGAATCGGAGGAAGGGGG + Intronic
934527056 2:95058547-95058569 AGGTGTGTGTCGAAGGCTGGGGG + Intergenic
937589752 2:123598642-123598664 AGGTGGTAATTGGAGGAAGGGGG + Intergenic
938560529 2:132468713-132468735 AGGTGGTTACAGATGGAAGGTGG + Intronic
939010266 2:136838269-136838291 AATTGGGTATAGAGGGAAGGAGG + Intronic
939654141 2:144801841-144801863 GGGTGGGTATATAAGGAAGTAGG + Intergenic
940656148 2:156489889-156489911 AGGAGGGTAGTGAAGGAAGGAGG - Intronic
945152013 2:206801521-206801543 AGATGGGAATCGATGGTAGGAGG - Intergenic
945867401 2:215191572-215191594 AGATAGGTTTCAAAGGAAGGTGG + Intergenic
947590127 2:231380686-231380708 AGGTGGGTTTTGAAGGAAGATGG - Intergenic
1168949368 20:1786158-1786180 AGGTGGGTAAGGAAGGAAGCAGG + Intergenic
1171406783 20:24917149-24917171 AGGTGGGCAGGGATGGAAGGTGG - Intergenic
1172267586 20:33630094-33630116 TGGTGGGTGGCGCAGGAAGGGGG + Intronic
1172750277 20:37245905-37245927 AGGTGGGTCTGGGAGGAAGGAGG + Intergenic
1173133765 20:40420955-40420977 AGGTGGGAATTCAAGGAAGTAGG + Intergenic
1173438819 20:43057252-43057274 GGGTGGGGAATGAAGGAAGGAGG + Intronic
1173603072 20:44309935-44309957 GGGTGGGTGAGGAAGGAAGGTGG + Intronic
1174547174 20:51334303-51334325 AGGAGGGAAGAGAAGGAAGGAGG + Intergenic
1178529831 21:33366668-33366690 AGGCTGGTATGGAAAGAAGGAGG - Intergenic
1181067214 22:20312601-20312623 AGGAGGGTAGGGAAGGCAGGAGG + Intergenic
1182048942 22:27298730-27298752 AGGTGGGTATGGGAGTGAGGAGG + Intergenic
1182471297 22:30549909-30549931 AGGTGGGGATCCAGGCAAGGTGG + Intergenic
1182674762 22:32030300-32030322 AGGTGAGGCTCAAAGGAAGGTGG + Intergenic
949826232 3:8168594-8168616 AGAGGGGTATGGAATGAAGGTGG - Intergenic
949930109 3:9071713-9071735 AGGTAGGAAGAGAAGGAAGGAGG + Intronic
951313293 3:21157289-21157311 AGGTTAGTATCCAAGGAATGTGG - Intergenic
951357007 3:21679690-21679712 AGGAAGGGATGGAAGGAAGGAGG + Intronic
951896986 3:27618906-27618928 AGGTTGGTAGGGAGGGAAGGTGG - Intergenic
952992537 3:38844220-38844242 AGGTGTGCATGGAAGGGAGGAGG + Intergenic
953904795 3:46863241-46863263 AGGTGGGTATGGAAGCTGGGTGG - Exonic
953911228 3:46894008-46894030 AGGTGGGGGTCAAAGGAAGAGGG + Exonic
954413903 3:50383638-50383660 AGCTGGGGATATAAGGAAGGGGG - Intronic
954466501 3:50658266-50658288 AGGTGGGTTTGGAAGGAAGATGG + Intergenic
955001254 3:54929741-54929763 AGGAGGGATTGGAAGGAAGGAGG - Intronic
955088146 3:55722703-55722725 AGGTGGGCATGGAAAGAAGTAGG - Intronic
956201507 3:66710921-66710943 AGGAAGGGATGGAAGGAAGGAGG - Intergenic
956881365 3:73514191-73514213 AGCTGGGTCTCTAAGGTAGGAGG + Intronic
959531842 3:107441931-107441953 AGCTGGGTAACGATGGAAGTGGG + Intergenic
962735466 3:138321697-138321719 AGCTGGGTATAGGAGGAATGAGG + Intronic
963337077 3:143987682-143987704 AGTTGGATATTAAAGGAAGGAGG - Intronic
963727930 3:148942574-148942596 AGGTGGGTACCAGAGGGAGGAGG - Intergenic
967214339 3:187197786-187197808 AGGTGAGTAGCCCAGGAAGGTGG + Exonic
977555910 4:98487151-98487173 AGGGGGGGATGGAGGGAAGGAGG + Intronic
978040200 4:104051122-104051144 AGGTGTGAATCAAAGGAAGGAGG - Intergenic
985273548 4:188216612-188216634 AAGGGGGTAAGGAAGGAAGGAGG - Intergenic
985802915 5:2017462-2017484 AGGAGAGTGTCGAACGAAGGGGG - Intergenic
986251483 5:6062186-6062208 AGGTGGGCATGGAAGGAAAGGGG - Intergenic
990700325 5:58467956-58467978 AGTTGGGTATGGAAGGAAGAGGG - Intergenic
990980024 5:61593910-61593932 AGGTGGGTATAGAAGGATGGTGG - Intergenic
993002544 5:82396250-82396272 AAGTCAGTATCAAAGGAAGGAGG + Intergenic
994120910 5:96111530-96111552 AGGTGAGTCTTGAAGGATGGAGG - Intergenic
995770425 5:115663801-115663823 AGGTGGGTATTTCAGGATGGTGG - Intergenic
997516042 5:134490669-134490691 AGCTGGGTAAGGAGGGAAGGCGG - Intergenic
998116716 5:139543433-139543455 ACGTGGGTATAGAGGGAAGCTGG - Intronic
998543778 5:143008052-143008074 AAGTGGGAAGAGAAGGAAGGAGG + Intronic
998999684 5:147906966-147906988 AGGAGGGTATCTGAGGAAGAAGG - Intergenic
999252522 5:150190921-150190943 AGGGGGCTATCGGAGGCAGGAGG + Intronic
999622892 5:153490448-153490470 AGGTGAGGATGGGAGGAAGGGGG + Intronic
1000819318 5:165964359-165964381 AGGTGGATCACGAAGGCAGGTGG - Intergenic
1001545951 5:172570704-172570726 AGGGAGGGATGGAAGGAAGGAGG + Intergenic
1003385984 6:5668016-5668038 CGGTGGGTATTAAAGGAAAGTGG - Intronic
1005259596 6:24043550-24043572 AGGTGGGAGTCTAAGGAAGATGG - Intergenic
1006443672 6:34067357-34067379 AGGGAGGGAGCGAAGGAAGGAGG - Intronic
1006520187 6:34566866-34566888 GGGTGGGCAATGAAGGAAGGTGG + Intergenic
1007208010 6:40168353-40168375 AGGAGGGTATTCTAGGAAGGAGG - Intergenic
1010176502 6:73033717-73033739 GGGTGGGTATGGGGGGAAGGGGG - Intronic
1013030182 6:106325441-106325463 AGGTAGGTGTGGTAGGAAGGAGG - Intronic
1013542916 6:111129251-111129273 AAGTGGGCAAAGAAGGAAGGGGG + Intronic
1013566176 6:111366042-111366064 AGGTGGGTAATGAGGGAATGAGG + Intronic
1016547358 6:145239116-145239138 AGGGAGGTAGGGAAGGAAGGAGG - Intergenic
1017034716 6:150256929-150256951 AAGTGGGTATCCAAGGGAGATGG - Intergenic
1017281601 6:152631730-152631752 AGGTGGGTATAGGTAGAAGGAGG + Intronic
1018365068 6:163111603-163111625 AAGTGGGTTTCAAAGGGAGGGGG - Intronic
1021093730 7:16511697-16511719 AGGAGGGTATCCATGGAAAGGGG + Intronic
1022623241 7:32006701-32006723 AGCTGGGTATGGAAGAAACGTGG + Intronic
1022702608 7:32775835-32775857 AGGTGGGTCTGTAAGGCAGGAGG - Intergenic
1026589295 7:71681518-71681540 CTGTGGGTATCCTAGGAAGGTGG - Intronic
1033929360 7:146504714-146504736 ATGTGGGCATCTAAGGAATGTGG + Intronic
1034264930 7:149776244-149776266 GGGTGGTTATTGAAGTAAGGAGG - Intergenic
1037389596 8:18379864-18379886 GGGTGGGTGTCAGAGGAAGGGGG + Intergenic
1037588946 8:20297010-20297032 AGGAGGGGAGCGAAGGGAGGCGG - Intronic
1038001590 8:23396372-23396394 AGGTGGGAAGGGAAGGAGGGAGG + Intronic
1040072667 8:43201169-43201191 AAGTGGGGAACGAGGGAAGGAGG - Exonic
1040866336 8:52052298-52052320 GGGTGGGGAGGGAAGGAAGGGGG - Intergenic
1041347930 8:56920692-56920714 AGGTGGGGATTGAAGGTGGGAGG + Intergenic
1042372762 8:68010763-68010785 AGGTGTGTAGGGGAGGAAGGTGG + Intronic
1044325194 8:90850905-90850927 AGGTGAGTCTTGAAGGATGGGGG + Intronic
1045511263 8:102813684-102813706 AGCTAGGTATCTTAGGAAGGTGG + Intergenic
1046294988 8:112206259-112206281 AGCTGGGTGTGGAAGGAATGGGG + Intergenic
1047207155 8:122811700-122811722 AGGGGGGAAGAGAAGGAAGGTGG + Intronic
1047671697 8:127154942-127154964 AGGTGGGTAACATAGGAAAGAGG + Intergenic
1047951459 8:129939346-129939368 AGGTGCCAATGGAAGGAAGGGGG + Intronic
1048279676 8:133095909-133095931 AGGTGGGTGAGGAAGGCAGGAGG - Intronic
1048280403 8:133101508-133101530 GGGTGGGTATCAAAGGACAGAGG - Intronic
1049042063 8:140119911-140119933 AGATGTGTATAGAAGGAAGTAGG - Intronic
1049654915 8:143793177-143793199 GGGTGGGGATCAAAGGCAGGCGG - Intronic
1050255093 9:3785904-3785926 AGGAGGGGAGGGAAGGAAGGAGG - Intergenic
1050559857 9:6823823-6823845 TGGTGCGTACTGAAGGAAGGAGG - Intronic
1055742086 9:79401255-79401277 AGGAGTGGATAGAAGGAAGGAGG - Intergenic
1055851783 9:80640473-80640495 AGGTGCTTTTCCAAGGAAGGAGG - Intergenic
1055955058 9:81765713-81765735 AGGTGGATATTTTAGGAAGGGGG - Intergenic
1058552384 9:106128764-106128786 AGGTGGGTATTGAATGTAGAAGG - Intergenic
1059769585 9:117413793-117413815 AGGTGGGTAGAAAGGGAAGGCGG + Intronic
1060399648 9:123340740-123340762 AGGTGGGGATGGAAAGAAGAAGG + Intergenic
1060944680 9:127563007-127563029 AAGTGGTTATCGCAGGACGGCGG + Intronic
1061306445 9:129735792-129735814 TGGTGGGTATGGAAGGGAGGTGG - Intergenic
1188734462 X:33695667-33695689 ATGTGTGTATTGAAGGGAGGAGG - Intergenic
1190162742 X:48045603-48045625 AGGTGGTAAGGGAAGGAAGGAGG + Intronic
1192095526 X:68206806-68206828 AGGTGGCTATGGAAGGAGGGCGG - Intronic
1192674331 X:73179743-73179765 AGGTGTGTATAGAAGGAGTGGGG + Intergenic
1193369136 X:80672376-80672398 AGGTGAGGAAGGAAGGAAGGAGG + Exonic
1195202536 X:102564761-102564783 AGGTGGGGAAGGAGGGAAGGTGG - Intergenic
1195217205 X:102713342-102713364 AGGTGGGGATGGAAGGTGGGGGG - Intronic
1200963858 Y:9018941-9018963 AGGTGGGTGTCAGAGGAAGGTGG + Intergenic
1202149251 Y:21829841-21829863 AGGTGGGTATCAGAGGAAGATGG - Intergenic