ID: 1138544625

View in Genome Browser
Species Human (GRCh38)
Location 16:57708741-57708763
Sequence AGTATTGGCAAGGATGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 366
Summary {0: 1, 1: 5, 2: 6, 3: 39, 4: 315}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138544625_1138544632 23 Left 1138544625 16:57708741-57708763 CCATCCACATCCTTGCCAATACT 0: 1
1: 5
2: 6
3: 39
4: 315
Right 1138544632 16:57708787-57708809 CTATTGTAGTGGACATGTAATGG 0: 1
1: 0
2: 0
3: 13
4: 124
1138544625_1138544630 12 Left 1138544625 16:57708741-57708763 CCATCCACATCCTTGCCAATACT 0: 1
1: 5
2: 6
3: 39
4: 315
Right 1138544630 16:57708776-57708798 TTCCATTTTAGCTATTGTAGTGG 0: 1
1: 0
2: 10
3: 102
4: 534

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138544625 Original CRISPR AGTATTGGCAAGGATGTGGA TGG (reversed) Intronic
900303765 1:1992082-1992104 AGCACTGGCAAGGCTATGGAAGG + Intronic
902379337 1:16045287-16045309 AGTACAGGCAGGGATGCGGAGGG + Intronic
902659178 1:17889570-17889592 AGTAGTGGCCAGGGGGTGGATGG + Intergenic
903879167 1:26497108-26497130 AGGATGAGGAAGGATGTGGAAGG - Intergenic
904896582 1:33822561-33822583 AGGCTTGGCAAGGAAGGGGATGG - Intronic
904974247 1:34443556-34443578 AGTATTGGCCATGATGAAGATGG - Intergenic
906866675 1:49428597-49428619 AGAATTGAGAAGGATCTGGATGG - Intronic
907901655 1:58746968-58746990 AGTGTTTACAAGGATGTGGGTGG - Intergenic
908189997 1:61692562-61692584 AGTCATGGCAAGAATGGGGAAGG + Intronic
908539929 1:65112551-65112573 AGTATTGGCCAGGGTGAGGGTGG + Intergenic
909662361 1:78098141-78098163 AGTATTGGAATGGATTTGGAGGG + Intronic
913960890 1:143337496-143337518 AGGATGGGCAAGGATGGGCAAGG - Intergenic
914055244 1:144163068-144163090 AGGATGGGCAAGGATGGGCAAGG - Intergenic
914123902 1:144803293-144803315 AGGATGGGCAAGGATGGGCAAGG + Intergenic
915159437 1:153907003-153907025 AGTGTTGGCAGGGACGTGGAGGG + Intronic
915770389 1:158416342-158416364 AGGATTGGCATGGATGTGGCTGG - Intergenic
918427782 1:184427818-184427840 AGTACAGGAAAGTATGTGGAGGG - Intronic
918606360 1:186431759-186431781 AGTAATGGCAAAGATGTGGAAGG + Intergenic
919418426 1:197340742-197340764 AGTTTTGGCAGGGATGGGGGTGG + Intronic
921480849 1:215663058-215663080 AGAAATGGCAAGGATGAGGAGGG + Intronic
923156969 1:231287828-231287850 AATATAGGGAAGGATGTGCATGG + Intergenic
923871511 1:237999407-237999429 AGTATTGGCTGGAATATGGAAGG + Intergenic
1062946178 10:1464042-1464064 AATGCTGACAAGGATGTGGAGGG + Intronic
1062962219 10:1581122-1581144 TGTATTGGCGAGGATATAGAGGG - Intronic
1063913033 10:10851951-10851973 AGTGTTGGCAAGTATGGGGAGGG + Intergenic
1066134522 10:32430902-32430924 AGTATTGGCAATGATGAGAAAGG - Intergenic
1067029328 10:42869897-42869919 AGGATGGGCAAGGATGGGCAAGG - Intergenic
1067051043 10:43021299-43021321 AGGCTTGGCAAAGGTGTGGAGGG + Intergenic
1070413635 10:76168454-76168476 AGTAGTGGCAAAGCTGAGGATGG - Intronic
1071591263 10:86875488-86875510 AGAATTTGCAAGAATGTTGATGG + Intronic
1071672418 10:87621035-87621057 GGTTTGGGCAAGGATGTGCATGG + Intergenic
1072098526 10:92206525-92206547 AGTATTTGAGAGGATGTGGTAGG - Intronic
1075680368 10:124326880-124326902 AGTATTGGAAAGGTGGTGGGAGG - Intergenic
1076987997 11:253243-253265 AGTGGTGACAAGGATGTGGATGG - Intergenic
1077630592 11:3808655-3808677 AGTATGGGCATGGATGTGCTGGG + Intronic
1077998061 11:7470979-7471001 ACTCTTTGTAAGGATGTGGAAGG - Intergenic
1078008066 11:7547448-7547470 AGCAGTGGGAAGGATTTGGAGGG + Intronic
1078537822 11:12189220-12189242 AGTAGAGGCAAGGACCTGGAAGG - Intronic
1079266577 11:18938811-18938833 AGTATTTACAAAGATGTGCAAGG - Intronic
1080013537 11:27481711-27481733 AATATTGGGTAGGATGTGGAGGG + Intergenic
1080325489 11:31067446-31067468 AGAGTTGGCAAGAATGTGAAGGG + Intronic
1080405187 11:31972323-31972345 GGTAATGGCAAGGAAGTGGGGGG + Intronic
1080607977 11:33879848-33879870 AGTACTGGTGAGGATCTGGAGGG + Intronic
1080830624 11:35890396-35890418 AGTTCTAGCAAGGATGTGAAGGG - Intergenic
1080853948 11:36095342-36095364 GTCATTGGCAAGAATGTGGAGGG - Intronic
1081465761 11:43315160-43315182 AGTATTGACAATAATGGGGAGGG - Intronic
1085524421 11:77156013-77156035 AGCAATGGCAAAGATGTGGGGGG - Exonic
1086231147 11:84571347-84571369 AGAAGAGGCAAAGATGTGGAAGG - Intronic
1086823884 11:91471004-91471026 AGTATTAACAAGAATGTGGTAGG - Intergenic
1086900916 11:92366656-92366678 ACCATTGTCAAGCATGTGGAAGG - Intronic
1087802965 11:102524037-102524059 AGGCTTTGCAAGTATGTGGAAGG + Intronic
1087905505 11:103692230-103692252 ACTATTGGCAAGGCTGAGGTGGG - Intergenic
1087942324 11:104113322-104113344 TGCATTGGCAAGGATGGGGGAGG + Intronic
1088854070 11:113730832-113730854 AGTATTTGCAAGCATGAGAAAGG + Intergenic
1088923208 11:114276765-114276787 AGTATTCGCAGGGGTGAGGATGG - Intronic
1088978334 11:114835839-114835861 AGTGTTGTCAAGGGTGTGGAGGG + Intergenic
1089457474 11:118633996-118634018 AGTGATGGCAATGGTGTGGAGGG + Intronic
1091679599 12:2517406-2517428 AGTATTGGCATTGCTGTAGAAGG - Intronic
1092116460 12:6012100-6012122 AGGATTTGCATGGATGAGGATGG - Exonic
1093763230 12:22934018-22934040 AGTAGTGGCAAAGTTGTGGGGGG - Intergenic
1093796882 12:23322823-23322845 AGTTTTGGGAAAGATGTGAAGGG + Intergenic
1094053716 12:26247252-26247274 AATATTGGGAAGGATGGTGAGGG + Intronic
1094299145 12:28941364-28941386 AGTATGTGCAAGAATGTGAATGG + Intergenic
1094832676 12:34307623-34307645 AATATTGGCACGGCAGTGGAGGG + Intergenic
1095299144 12:40561917-40561939 AAAATTGGCATGGATGGGGAGGG + Intronic
1095381579 12:41600891-41600913 AGTGTTGGCAAAGACATGGAGGG - Intergenic
1095722495 12:45415761-45415783 AGGAAGGGCAAGGCTGTGGAGGG - Intronic
1096634634 12:52950320-52950342 AGTATTTGCGAAGATCTGGAGGG - Exonic
1096712325 12:53466397-53466419 AGTATTTGGAGGGATGGGGAAGG + Intronic
1097989120 12:65816258-65816280 AAAGCTGGCAAGGATGTGGATGG + Intergenic
1099620837 12:85001055-85001077 ATGATTAGCGAGGATGTGGAGGG + Intergenic
1101738295 12:107480219-107480241 AGTATAGGTAGGTATGTGGAAGG + Intronic
1101922587 12:108944850-108944872 AGTGTCGGCAAGGGTATGGAAGG - Intronic
1103742055 12:123097558-123097580 AGTGATGGCATGGATGGGGAGGG + Intronic
1103935918 12:124476449-124476471 AGCAAGGACAAGGATGTGGAAGG + Intronic
1104579508 12:130000210-130000232 ACTATGGGCAAGGAGGTGGAGGG - Intergenic
1106090494 13:26588695-26588717 GGTGTTGGCCAGGATGGGGAGGG - Intronic
1106404007 13:29457783-29457805 AATGTTGGCAAGAATGTAGAGGG - Intronic
1106633870 13:31506480-31506502 TCTATAGGCAAAGATGTGGATGG + Intergenic
1107179270 13:37439453-37439475 CATGTTGGCGAGGATGTGGATGG - Intergenic
1107608837 13:42092091-42092113 AGTTTTGGCAAGGATGTAAGGGG + Intronic
1110357274 13:74581878-74581900 AGTATTGGCAAGGATGAAACAGG + Intergenic
1115019516 14:28659358-28659380 AGTATTGGCAAGGATGAAAAGGG + Intergenic
1116005009 14:39283335-39283357 ACTACTGGCAGGGATGTAGATGG - Intronic
1116144894 14:41052587-41052609 AGTCTTGGCAAGCATGCTGAAGG - Intergenic
1116240827 14:42340397-42340419 AGTGTTGCCAAAGGTGTGGAAGG + Intergenic
1117695578 14:58358995-58359017 AGTGTTGGCAAGAATATGAAGGG - Intronic
1118451738 14:65909049-65909071 AGTGCTGGTAAGGGTGTGGAAGG - Intergenic
1118537313 14:66782470-66782492 AGTAATAGGAAGGATCTGGAAGG - Intronic
1118640912 14:67791757-67791779 AGTATTAGAAAGGCTGGGGAGGG + Intronic
1119105869 14:71923252-71923274 AGAATTGTCCAGGATGGGGATGG + Intergenic
1121729943 14:96179503-96179525 AGTGCTGGCAAGGCTCTGGATGG - Intergenic
1122634548 14:103123860-103123882 AGTCCTGGGCAGGATGTGGAAGG - Exonic
1123107093 14:105846730-105846752 AATACTGCCTAGGATGTGGAGGG - Intergenic
1202839455 14_GL000009v2_random:108138-108160 AGTACTTGCCAGGAGGTGGAAGG + Intergenic
1202908830 14_GL000194v1_random:98294-98316 AGTACTTGCCAGGAGGTGGAAGG + Intergenic
1124343754 15:28907540-28907562 GCTGTTGGCCAGGATGTGGAAGG + Intronic
1124906569 15:33874040-33874062 AGTATTGGGAAGGATGGGGAGGG - Intronic
1127917682 15:63468565-63468587 AGTTCTGGCAATGAGGTGGAAGG + Intergenic
1128538985 15:68511821-68511843 TGTATTGGCAAGGAGGTCGTTGG + Intergenic
1129138914 15:73579032-73579054 AGTATTGGGAAGGCTGAGGCAGG + Intronic
1129707783 15:77804620-77804642 AGTGTGTGCAAGGATGTGCAGGG + Intronic
1130117866 15:81021258-81021280 AGTCTTGGGAAAGATGGGGAGGG - Intronic
1130644625 15:85713407-85713429 AAGAATTGCAAGGATGTGGATGG - Intronic
1133167388 16:3957837-3957859 AGGATCGGGAAGGATGTGAAAGG - Intronic
1134179035 16:12032822-12032844 GGAGTTGGCAAGGATGTGGAAGG - Intronic
1134762831 16:16729190-16729212 AGTATTTGCAAAGAAGTGAAAGG - Intergenic
1134983221 16:18629958-18629980 AGTATTTGCAAAGAAGTGAAAGG + Intergenic
1135305781 16:21366560-21366582 GGAGTTGGCAAGGATGTGGAAGG - Intergenic
1136302525 16:29345714-29345736 GGAGTTGGCAAGGATGTGGAAGG - Intergenic
1136643003 16:31583340-31583362 ATTGTTGGCAGGGACGTGGATGG - Intergenic
1138544625 16:57708741-57708763 AGTATTGGCAAGGATGTGGATGG - Intronic
1138732857 16:59215169-59215191 AGTGTTGGCAAGGATGTGGAGGG - Intergenic
1139176696 16:64698227-64698249 GGAATTGGCAAGAATGAGGAAGG - Intergenic
1140038612 16:71390260-71390282 ACCATTGGCAAGGTGGTGGATGG - Exonic
1140519345 16:75567934-75567956 AGTGTGGGCAAGGAGGTGGGTGG - Intronic
1140660898 16:77190791-77190813 AGTATTGGTTAGGATTTGGCGGG + Intergenic
1141070260 16:80948210-80948232 TGCACTGGCAAGGATGTAGAGGG - Intergenic
1141100915 16:81196930-81196952 AGTATTTGCAATGATGCTGACGG - Intergenic
1141138672 16:81483111-81483133 AGTATTGGTATGAATGGGGAGGG + Intronic
1141405686 16:83790906-83790928 AGTATTAGCAAGAATGTAAAAGG + Intronic
1141415715 16:83871528-83871550 AGTGTTAGCAAGGATGCAGAGGG - Intergenic
1142576539 17:912466-912488 AGTGTTGGCAAGGATGTAGACGG - Intronic
1144186583 17:12802286-12802308 AGTTTTGGGAAGGGTGGGGATGG + Intronic
1145268676 17:21392758-21392780 AGTATAGACAGGGAGGTGGATGG + Intronic
1145974606 17:28976928-28976950 AGTGCTGGCAGGGATGGGGATGG - Intronic
1147508404 17:41043854-41043876 AGTATGAGCAAAGGTGTGGAGGG - Intergenic
1149630438 17:58117407-58117429 AGTAATGGCAATGATGATGATGG + Intergenic
1150530249 17:65973605-65973627 AGTTTTGGGAAAGATGTGGAGGG + Intronic
1151984362 17:77532547-77532569 TCTATCAGCAAGGATGTGGAGGG - Intergenic
1152384563 17:79963718-79963740 AGTGTCGGTGAGGATGTGGAGGG - Intronic
1153116201 18:1659474-1659496 AGTTAGGGCAAGGAAGTGGAGGG + Intergenic
1157652063 18:49343281-49343303 AGAATGAGCAAGGATGGGGAGGG - Intronic
1159714316 18:71802812-71802834 AGTATTGACAAGAATTTGAAAGG - Intergenic
1159772709 18:72566169-72566191 GGTGTTGGCCAGGATATGGAGGG + Intronic
1162088699 19:8263523-8263545 AGTATTGGAGAGAATGTGGGGGG + Intronic
1162493006 19:11005675-11005697 AGGCTTGGCAGGGAGGTGGAAGG - Intronic
1163605922 19:18275182-18275204 AGTATAGGGAAGGTTTTGGAGGG - Intergenic
1163939884 19:20481805-20481827 AATATTGGAAAGGAGGTGGGAGG + Intergenic
1164901580 19:31930595-31930617 GAGATTGGCAAGGAGGTGGAAGG - Intergenic
1165984423 19:39755475-39755497 AAGATTGGCAAAGCTGTGGATGG - Intergenic
1166274893 19:41746353-41746375 AGTAAGGGCATGGCTGTGGAGGG + Intronic
1166598164 19:44069839-44069861 AATGTTGGTGAGGATGTGGAAGG - Intergenic
1202633586 1_KI270706v1_random:22420-22442 AGTACTTGCCAGGAGGTGGAAGG - Intergenic
1202652297 1_KI270707v1_random:17647-17669 AGTACTTGCCAGGAGGTGGAAGG + Intergenic
1202694726 1_KI270712v1_random:115745-115767 AGGATGGGCAAGGATGGGCAAGG - Intergenic
926348285 2:11969805-11969827 GATGTTGGCAAGGATGTGGGAGG - Intergenic
926452214 2:13018989-13019011 AGGATTGTCAATGCTGTGGAAGG + Intergenic
926610483 2:14941807-14941829 AGAATAATCAAGGATGTGGAAGG - Intergenic
926662952 2:15488554-15488576 AATATTATCAAGGATTTGGAGGG - Intronic
928069871 2:28203940-28203962 AGTATTGGCAAGGATGTAGGAGG - Intronic
929351830 2:40965624-40965646 AGGATGGGAAAGGAAGTGGATGG - Intergenic
930158554 2:48129754-48129776 AGTGTTGGCAAGCATGTGTTGGG + Intergenic
932278586 2:70470373-70470395 AGTCTTAGCAAGGATGTATAAGG + Intronic
933153031 2:78937566-78937588 AGGATTGGCAAGGATGTTACAGG - Intergenic
934275897 2:91572793-91572815 AGGATGGGCAAGGATGGGCAAGG - Intergenic
934926418 2:98384777-98384799 GGTGTGGGCAAGGATGTGGGTGG + Intronic
937286383 2:120755239-120755261 AGTATTACCTAGGATGTGGTAGG - Intronic
937389421 2:121470811-121470833 AATGTTGGCAATGGTGTGGAAGG - Intronic
938402019 2:131001527-131001549 AGTATTGGTGAGGATGTACAGGG + Intronic
939273971 2:139975804-139975826 AGTCTGGGCAAGGCTGGGGAGGG + Intergenic
940723731 2:157310395-157310417 AGTATTGTCAAGGATTTGTAAGG - Intronic
941355268 2:164483189-164483211 AGTATTGTTAAGGGTGTGGGGGG - Intergenic
943952699 2:194150641-194150663 GGTATTGGCAATGGTCTGGATGG + Intergenic
945112382 2:206372891-206372913 AGTGTTGGTGAGGATGTGGAGGG - Intergenic
945800801 2:214427899-214427921 TGTATTGGAAAGGAAATGGATGG - Intronic
946889353 2:224259382-224259404 AGTAGTGGCAAGGATGTGTGGGG + Intergenic
947849263 2:233271906-233271928 ATTCTTGGCCAGGATGTAGAAGG - Intronic
948639263 2:239364066-239364088 TGTGTTGGTAAGGATGTGGTTGG + Intronic
1169848154 20:10018618-10018640 GGTGTTGGTGAGGATGTGGATGG - Intronic
1170448489 20:16456388-16456410 ATTTTTAGCAAGGATATGGAGGG - Intronic
1170785379 20:19462823-19462845 AGCATTGCTAGGGATGTGGAAGG - Intronic
1173070503 20:39759980-39760002 AGTCTTGGCAGGGATTTGAATGG - Intergenic
1174280608 20:49436178-49436200 AGTGCTGGCAAGGATGTAGAGGG + Intronic
1174838827 20:53882553-53882575 GTTATTTGCAACGATGTGGATGG - Intergenic
1174871098 20:54183128-54183150 AGTGTTGGGGAGGATGTAGAGGG - Intergenic
1174902925 20:54520077-54520099 AACTGTGGCAAGGATGTGGAGGG - Intronic
1175032373 20:55968725-55968747 CGTGTTGGTAAGGATGTGGAGGG - Intergenic
1175380970 20:58563989-58564011 AGTGTTGACGAGGATGTGGAAGG + Intergenic
1175735781 20:61386097-61386119 AGTAGTGACAAGGGTGTGTAGGG + Intronic
1176599852 21:8782006-8782028 AGTACTTGCCAGGAGGTGGAAGG - Intergenic
1176628190 21:9112999-9113021 AGTACTTGCCAGGAGGTGGAAGG + Intergenic
1176645801 21:9348283-9348305 AGTACTTGCCAGGAGGTGGAAGG - Intergenic
1178586064 21:33872153-33872175 AGTGTTGGCAAAGATCTGGGTGG + Intronic
1179375612 21:40847534-40847556 AGTAGCAGCAAGGATTTGGAAGG - Intergenic
1180367127 22:11950870-11950892 AGTACTTGCCAGGAGGTGGAAGG + Intergenic
1180378953 22:12120469-12120491 AGTACTTGCCAGGAGGTGGAAGG - Intergenic
1180418573 22:12792848-12792870 AGTACTTGCCAGGAGGTGGAAGG + Intergenic
1180567876 22:16690586-16690608 AGGATTCGCATGGATGAGGATGG - Intergenic
1180668770 22:17536478-17536500 GGGATTGGCAAGGAGCTGGAAGG - Intronic
1180860884 22:19081588-19081610 AGAGTTGGAGAGGATGTGGATGG + Intronic
1181878663 22:25959944-25959966 AGCAGTGGGAAGGATGTTGATGG + Intronic
1181898320 22:26130722-26130744 AGTGTTGGCGAGGATGTGGAGGG - Intergenic
1183812435 22:40268480-40268502 AGTATTGAAAAGAATGAGGAAGG + Intronic
1185203516 22:49523177-49523199 AGTCATGCCAAGGGTGTGGAGGG + Intronic
949263922 3:2135132-2135154 AGCATTGAAAAGGATGTGGCAGG + Intronic
951069238 3:18306946-18306968 ATTATGGGCCAGGATGTTGAAGG - Intronic
951419024 3:22462007-22462029 ATGTTTGCCAAGGATGTGGAAGG - Intergenic
952546232 3:34422524-34422546 AGTATTGGGGTGGATGAGGATGG + Intergenic
953000163 3:38924867-38924889 AGGAGTAGCAAGGATGAGGATGG - Intronic
953003159 3:38953102-38953124 GGAATTGGCAGGGATATGGATGG + Intergenic
953488231 3:43323456-43323478 AGTGCTGGCAAGGGTGTGAATGG + Intronic
954288280 3:49635063-49635085 AGAATTGGATTGGATGTGGAGGG + Intronic
954767629 3:52934186-52934208 AGTGTTGGCAAGGAAGTAGAGGG + Intronic
955497780 3:59553759-59553781 AGAAATGGAAAGGAGGTGGATGG + Intergenic
955694650 3:61623677-61623699 AATATTGACAATGCTGTGGAGGG + Intronic
955822653 3:62912480-62912502 AGCATAAGCAAAGATGTGGAGGG + Intergenic
956314437 3:67918499-67918521 AATAATGGCAAGGAAGTGGCTGG - Intergenic
956754799 3:72373867-72373889 AGTCTTGGAAAGGATCTGGAAGG - Exonic
957094399 3:75765205-75765227 AGTACTTGCCAGGAGGTGGAAGG + Intronic
957887638 3:86309745-86309767 AGTGTTAGTAAGGATGTGGAGGG - Intergenic
958155845 3:89754875-89754897 CATGTTGGCAAGGATGTGGTGGG + Intergenic
958539639 3:95454242-95454264 GCTATTGGGAAGGATGAGGAAGG - Intergenic
959612860 3:108314495-108314517 AAGATTGGCAGGGATGGGGAGGG + Intronic
960102504 3:113759800-113759822 AGTACTGGCAAGGGTGTGGGGGG - Intronic
960440476 3:117681175-117681197 AATATTTGCAATGATGTGCAAGG - Intergenic
962684673 3:137835836-137835858 AGTATTTCCAGGGATGTGGCAGG + Intergenic
963621992 3:147622066-147622088 AGTGTTGGAAAGGATGTTAAAGG + Intergenic
963822974 3:149919882-149919904 AGCGTTGGCACGGAAGTGGAGGG - Intronic
964018706 3:151980153-151980175 GGTATTGGGATGGATGAGGATGG - Intergenic
964751382 3:160057140-160057162 AGTATAGGGAAGGATGTACATGG + Intergenic
966216012 3:177503421-177503443 AGCTTTGGCAAGGATGTACATGG + Intergenic
966728090 3:183126345-183126367 AGGACTGGGAAGGAAGTGGAGGG + Intronic
967605869 3:191445862-191445884 AGAAATGGCATGGATATGGATGG - Intergenic
968035556 3:195544668-195544690 AGTATGGGAATGGATGTGGATGG + Intergenic
1202741084 3_GL000221v1_random:56782-56804 AGTACTTGCCAGGAGGTGGAAGG + Intergenic
968623640 4:1615903-1615925 GGGATGGGCAAGGCTGTGGATGG + Intergenic
969074459 4:4566813-4566835 ATTATTTGCAAAGATGTGGCAGG - Intergenic
969153442 4:5189799-5189821 AGTGCTGACGAGGATGTGGAGGG - Intronic
970058395 4:12001151-12001173 AGAGTTTGGAAGGATGTGGAGGG - Intergenic
970682820 4:18530792-18530814 AGTATTGGCAAGGATGCATTAGG - Intergenic
971057921 4:22934594-22934616 AGAAGTGGCTAGGATGTGTAAGG + Intergenic
971589522 4:28449606-28449628 AGTTTTGTCAAGGATGTTGTAGG - Intergenic
973363216 4:49184429-49184451 AGTACTTGCCAGGAGGTGGAAGG - Intergenic
973397878 4:49612431-49612453 AGTACTTGCCAGGAGGTGGAAGG + Intergenic
973877832 4:55239429-55239451 AGTATGGGCAAAGATTTGAAAGG - Intergenic
974232481 4:59135118-59135140 AGTATTGGCAATTATGAGTAAGG - Intergenic
975981632 4:80167470-80167492 AGTGTTGGCAAAGATATGGTAGG - Intergenic
976515777 4:85964573-85964595 AGAAGAGGCAAGGAGGTGGAAGG + Intronic
977648345 4:99439863-99439885 AGTATTTGCAAGGATGGGCGAGG + Intergenic
977797418 4:101183277-101183299 AGTATTGGCAAGAAGGGGAAAGG + Intronic
977855870 4:101891450-101891472 AGTCTTGGCATGGAATTGGAGGG + Intronic
978283208 4:107042068-107042090 AGTTATGGCAATAATGTGGAAGG + Intronic
978775694 4:112504610-112504632 AGTATTTGCGAGGAGCTGGAGGG + Intergenic
978839364 4:113191609-113191631 AACATTGGCAGGGCTGTGGATGG + Intronic
978981645 4:114954896-114954918 AGCAGTAGCAAGGATGTGGGAGG - Intronic
980206499 4:129725579-129725601 GGTATGAGGAAGGATGTGGAAGG - Intergenic
980673340 4:136040291-136040313 AGTAATAACAAAGATGTGGAGGG - Intergenic
981322748 4:143411556-143411578 AGGATTGGCAAGGCAGTGTACGG + Intronic
981476276 4:145190408-145190430 AGTGTTGGAGAGGATGTGAAGGG - Intergenic
981840381 4:149104793-149104815 AGTATTGGTAAGGTGGGGGAGGG - Intergenic
982155842 4:152520093-152520115 AGAATTGGCAAGGAAGGAGAGGG - Intronic
982600094 4:157438211-157438233 TGTCTTTGCAAGGACGTGGATGG + Intergenic
984015516 4:174421341-174421363 AGTAGTTGCAAAGATATGGAAGG - Intergenic
984231045 4:177099387-177099409 ATTTTTAGCAAGAATGTGGAAGG + Intergenic
984265538 4:177494868-177494890 AGTATTGGCAAATATGAAGAGGG + Intergenic
985272844 4:188210443-188210465 AGTGTTGCCCAGTATGTGGAGGG - Intergenic
1202760573 4_GL000008v2_random:105948-105970 AGTACTTGCCAGGAGGTGGAAGG - Intergenic
985700622 5:1369736-1369758 AGGAATGACAAGGATGTGGCTGG - Intergenic
986755772 5:10834689-10834711 AGGGATGGCAAAGATGTGGAAGG - Intergenic
987264256 5:16235775-16235797 AGTAGTGGCAATGGGGTGGAGGG - Intergenic
988999164 5:36743199-36743221 AGAATTGCCATGGAGGTGGAAGG - Intergenic
991219993 5:64202611-64202633 AGTATTGGCAAAGATGTAACTGG - Intronic
992081526 5:73238078-73238100 AGTGTTGGCAGGGATATGAAGGG + Intergenic
992245103 5:74812808-74812830 AATGTTGGTGAGGATGTGGAGGG + Intronic
993702173 5:91131560-91131582 GCTACTGGCAAGGTTGTGGAGGG - Intronic
994293577 5:98061529-98061551 AGTGTTGGTAAAGATGTGGAAGG + Intergenic
995669654 5:114587826-114587848 AATTGTGGCAATGATGTGGAAGG + Intergenic
996799110 5:127382951-127382973 AGTGTTGCCAAGGATGTGAAAGG + Intronic
996905503 5:128595320-128595342 AGGATTGGCAAGGAGCAGGAAGG + Intronic
997103916 5:130996650-130996672 ATTATTTGCAAAGATGTGGCAGG + Intergenic
997270835 5:132536386-132536408 AGTCTTGGCAGGGAAGTGTAAGG + Intergenic
997359315 5:133284528-133284550 GATAATGGCAAGGATGTAGAGGG - Intronic
998094736 5:139390822-139390844 AGCAGTGGCAGGGATGGGGATGG - Exonic
999873772 5:155779785-155779807 AGTGTTGGCAAGGATGCAGGAGG - Intergenic
1001405022 5:171470131-171470153 AGTATTGAAAAGAATGTGGTCGG + Intergenic
1002004421 5:176220874-176220896 AGTATTGGTGAGGTTGTGGTAGG + Intergenic
1002221950 5:177689751-177689773 AGTATTGGTGAGGTTGTGGTAGG - Intergenic
1002685586 5:181006937-181006959 AGTGTTGGTGAGGATGTGGAGGG + Intergenic
1003829401 6:9990446-9990468 AGTGTCGGCAAGGATGAAGAGGG + Intronic
1005400481 6:25427696-25427718 AGTGTTGGGGAGGATGTGGAGGG - Intronic
1006420312 6:33929651-33929673 AGTGTTGGTGAGGATGTGGAAGG + Intergenic
1006464625 6:34185196-34185218 CGTGTTGTCAAGGATGTGGTAGG + Intergenic
1008142085 6:47843706-47843728 AGAAAAGGCAAGGATGTAGAGGG - Intergenic
1008178420 6:48297214-48297236 TGTATTGACAAGGTTGTGGTTGG + Intergenic
1008504626 6:52217782-52217804 AGTTTTGGCAAGGATATGAGAGG + Intergenic
1009051414 6:58281089-58281111 TGTATTTTCAAGGGTGTGGATGG - Intergenic
1010075661 6:71794203-71794225 AGGACTGGCCAGGATGTAGATGG - Intergenic
1010190975 6:73196248-73196270 AGTATTGGCAAGCCTGGGGTTGG - Exonic
1010516356 6:76776476-76776498 AGTATTGGAAAGTCTGAGGACGG - Intergenic
1011160904 6:84389391-84389413 AGTACAAGCAAGGATGGGGATGG - Intergenic
1011947391 6:92923297-92923319 AGTATTTACCAGGATTTGGAGGG - Intergenic
1012150111 6:95739301-95739323 AGTGTTGGCTAGAATTTGGAGGG + Intergenic
1012218766 6:96622214-96622236 AGTATTGTTACGGATGTAGAGGG + Intergenic
1012351276 6:98253895-98253917 AGTGTTGGCAAGGATGTGGAGGG - Intergenic
1013913104 6:115302012-115302034 AGTTTTGGCAAGGACGTGAAGGG - Intergenic
1014604918 6:123461477-123461499 TGTTGTGGCAAAGATGTGGAAGG - Intronic
1017454328 6:154586906-154586928 AGTATTTTCTAGGATGAGGAAGG + Intergenic
1018336353 6:162794108-162794130 AGTGTTGGTGAGGATATGGAGGG - Intronic
1019108551 6:169690555-169690577 AGTGCTGGGAAGGAGGTGGATGG - Intronic
1019694349 7:2436808-2436830 GGTGTTTGCAGGGATGTGGAGGG + Intergenic
1021018461 7:15565439-15565461 AGTGTTAGCAAGAGTGTGGAGGG - Intergenic
1021340985 7:19462339-19462361 AGTGTTGGCAAGGATGTGGAGGG - Intergenic
1021668885 7:23014841-23014863 AGTCTTGAGAAGGATGTGGTAGG - Intergenic
1022013353 7:26328336-26328358 AGAATTGTCTAGGGTGTGGATGG + Intronic
1023242626 7:38163831-38163853 AGTATGTGCAAGGAAGTGAAGGG + Intergenic
1024642131 7:51338663-51338685 AGTGTTGGAGAGGTTGTGGAGGG + Intergenic
1025152068 7:56564562-56564584 ACTATAGGCTAGGATGTGGGAGG - Intergenic
1028572079 7:92301331-92301353 AGTGATGGCAAAAATGTGGAAGG - Intronic
1029058783 7:97775274-97775296 ATCATTGGCAAAGATGTGGAGGG - Intergenic
1032000944 7:128265001-128265023 AGAAAAGGCAAGGATGTGGAGGG - Intergenic
1033544508 7:142388121-142388143 AGTATTTGCAAAGGTGTGGCAGG + Intergenic
1034389332 7:150772049-150772071 AGTGTTGGTGAAGATGTGGAGGG + Intergenic
1034479628 7:151309303-151309325 ACGATTGGCAAGGAGGTGGGAGG - Intergenic
1036959550 8:13228940-13228962 AGTGTTGGTAAGGATGTGGAGGG + Intronic
1036988791 8:13568156-13568178 AGTTTGGGCCAGGATGTTGATGG + Exonic
1037296063 8:17401674-17401696 ACTATTGGCATAGATATGGAAGG + Intronic
1038347088 8:26742465-26742487 GGGCTAGGCAAGGATGTGGAGGG - Intergenic
1038824018 8:30981112-30981134 AGTATTGGTGGGGATGTTGAAGG + Intergenic
1039294182 8:36131431-36131453 AGTCTTGGCAAGGAAATAGAAGG - Intergenic
1040750877 8:50705233-50705255 AGTATTGGCAAGCATTAGGCAGG - Intronic
1042023392 8:64396136-64396158 AATGTTGTCAAGGATGTTGATGG + Intergenic
1042675385 8:71315349-71315371 GGTAATGGCAAGGCTGTGGATGG + Intronic
1043383757 8:79729249-79729271 AGAATTGGCAATGAATTGGAGGG + Intergenic
1043694288 8:83201049-83201071 ATTGTTTGCAAGGCTGTGGATGG - Intergenic
1044497079 8:92899382-92899404 AGTATTGGGGAGGGGGTGGAAGG - Intronic
1045145070 8:99334216-99334238 AATATTGGCAAAGATATGAATGG - Intronic
1045873995 8:106957972-106957994 GGTTTTGGCAAAGATGTGGTAGG - Intergenic
1046377193 8:113399186-113399208 AGTATTGGCAAGAATGTGGAGGG + Intronic
1046528597 8:115414448-115414470 AGTTTTGGCAAGGATTTGGTAGG + Exonic
1047175828 8:122539535-122539557 AGGATTGCCTAGGATGGGGAGGG - Intergenic
1047441871 8:124885773-124885795 AGAAGTGGCAAGGATGGGGGAGG - Intergenic
1048433877 8:134397089-134397111 ATTCTTGGCATGGATGGGGAGGG + Intergenic
1049333273 8:142067103-142067125 AGCGCTGGCAAGGATGTGGGGGG + Intergenic
1050564551 9:6868537-6868559 AGTATAGGGGAGGATGTGCATGG - Intronic
1050694239 9:8261205-8261227 AGGATGGGCAGGGAGGTGGAGGG + Intergenic
1052278898 9:26710163-26710185 AGTGTTGGTAAGGATGGTGAAGG - Intergenic
1053150983 9:35742642-35742664 AGAGTTGGCATGTATGTGGAGGG + Intronic
1053192649 9:36086005-36086027 TGTATTGGCAAAGATGGAGACGG - Intronic
1055460256 9:76512777-76512799 AGCATTGGCAAGAATGTGGTAGG - Intergenic
1057314851 9:93961509-93961531 AGTCCTGGCAAGGTGGTGGAGGG - Intergenic
1057415699 9:94860386-94860408 AGCAGTGGCAAGGGTGGGGACGG + Intronic
1058103452 9:100942306-100942328 AGAATTGTCAAGGATGTGGGGGG - Intergenic
1058549338 9:106097216-106097238 GATACTGGCAAGGTTGTGGAGGG + Intergenic
1058807402 9:108605654-108605676 AGTACTGGCAAGAAATTGGAAGG - Intergenic
1059934553 9:119296390-119296412 CGTGTTAGCAAGAATGTGGATGG + Intronic
1060042442 9:120310884-120310906 AGTACTGTAAAGGATGTGGGTGG - Intergenic
1060457499 9:123812586-123812608 AGTATTAATAAGAATGTGGAAGG - Intronic
1062366971 9:136214931-136214953 AGAACTCGCAAGGATGTGCATGG - Intronic
1203482949 Un_GL000224v1:23676-23698 AGTACTTGCCAGGAGGTGGAAGG - Intergenic
1203709723 Un_KI270742v1:86712-86734 AGTACTTGCCAGGAGGTGGAAGG + Intergenic
1203541342 Un_KI270743v1:90833-90855 AGTACTTGCCAGGAGGTGGAAGG - Intergenic
1186306176 X:8261025-8261047 AGAAGTGGGAAGGATGTGGCGGG + Intergenic
1186932820 X:14413489-14413511 AGTATTGGCAAGGATGTGAATGG - Intergenic
1188263809 X:28045562-28045584 AATGCTGGCGAGGATGTGGAGGG - Intergenic
1189013813 X:37074940-37074962 AGTTTTGGCAAGGATGTTTAGGG + Intergenic
1193135729 X:77969043-77969065 GGCATTGCCAAGCATGTGGAGGG - Exonic
1194073526 X:89359003-89359025 AGTGTTGGCAACCATGTTGAAGG + Intergenic
1194609196 X:96019779-96019801 ACTATTGGCAAGGATGTAATTGG + Intergenic
1195970730 X:110470392-110470414 AGTATTGGCTAAGAGGTGAAAGG - Intergenic
1199263219 X:145800001-145800023 GGTATGAGCAAGCATGTGGAGGG - Intergenic
1201164688 Y:11198284-11198306 AGTACTTGCCAGGAGGTGGAAGG + Intergenic
1201794110 Y:17876102-17876124 AGTATTTACAAAGATGTGGGTGG - Intergenic
1201807444 Y:18029883-18029905 AGTATTTACAAAGATGTGGGTGG + Intergenic
1202355491 Y:24043915-24043937 AGTATTTACAAAGATGTGGGTGG - Intergenic
1202515287 Y:25626194-25626216 AGTATTTACAAAGATGTGGGTGG + Intergenic