ID: 1138546654

View in Genome Browser
Species Human (GRCh38)
Location 16:57723432-57723454
Sequence GGCACTGCCTCCTTTAAATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 154}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138546654_1138546660 15 Left 1138546654 16:57723432-57723454 CCACATTTAAAGGAGGCAGTGCC 0: 1
1: 0
2: 1
3: 9
4: 154
Right 1138546660 16:57723470-57723492 CACCTGTAATCCAAGCGCTTTGG 0: 2
1: 1294
2: 80704
3: 222326
4: 293276
1138546654_1138546663 19 Left 1138546654 16:57723432-57723454 CCACATTTAAAGGAGGCAGTGCC 0: 1
1: 0
2: 1
3: 9
4: 154
Right 1138546663 16:57723474-57723496 TGTAATCCAAGCGCTTTGGGAGG 0: 17
1: 5002
2: 323478
3: 273215
4: 203630
1138546654_1138546661 16 Left 1138546654 16:57723432-57723454 CCACATTTAAAGGAGGCAGTGCC 0: 1
1: 0
2: 1
3: 9
4: 154
Right 1138546661 16:57723471-57723493 ACCTGTAATCCAAGCGCTTTGGG 0: 2
1: 1413
2: 85899
3: 329778
4: 267375
1138546654_1138546666 29 Left 1138546654 16:57723432-57723454 CCACATTTAAAGGAGGCAGTGCC 0: 1
1: 0
2: 1
3: 9
4: 154
Right 1138546666 16:57723484-57723506 GCGCTTTGGGAGGCCAACATGGG 0: 3
1: 141
2: 3632
3: 44946
4: 156098
1138546654_1138546665 28 Left 1138546654 16:57723432-57723454 CCACATTTAAAGGAGGCAGTGCC 0: 1
1: 0
2: 1
3: 9
4: 154
Right 1138546665 16:57723483-57723505 AGCGCTTTGGGAGGCCAACATGG 0: 2
1: 241
2: 5964
3: 74767
4: 162031

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138546654 Original CRISPR GGCACTGCCTCCTTTAAATG TGG (reversed) Intronic
905091818 1:35436194-35436216 GGCACTGCCACCCTTAAGTCAGG - Intronic
906630714 1:47365183-47365205 GGCACTTCCTCCCATTAATGTGG - Intronic
907928979 1:58981517-58981539 AGAACTGTCCCCTTTAAATGGGG - Intergenic
911681698 1:100723954-100723976 GGCAATACTCCCTTTAAATGTGG - Intronic
915182557 1:154075129-154075151 GGCTCTGATTCCTTTAAATGGGG + Intronic
915470110 1:156120905-156120927 GGCACAGCTTCCTTTCAATCCGG - Intronic
915646030 1:157273376-157273398 GGCACTGCCTCCTCTGAGTGTGG - Intergenic
916626733 1:166566266-166566288 GTCACTGCCTCCTTCAAAACAGG - Intergenic
917810202 1:178651105-178651127 GGCAGTGACCCCTTTAAATGTGG + Intergenic
917886903 1:179395167-179395189 GGCACAAGCTCTTTTAAATGCGG + Exonic
918643268 1:186870598-186870620 GGTTCTGCCTTCTTCAAATGTGG + Intronic
918643287 1:186870828-186870850 GGTTCTGCCTTCTTCAAATGTGG + Intronic
921070799 1:211656079-211656101 CTCACTGCCCCCTTCAAATGGGG - Intergenic
1064607952 10:17063742-17063764 GGCAGGGCCTCCTGAAAATGTGG - Intronic
1065537150 10:26726315-26726337 AGCACTACCTCCTTTTCATGTGG + Intronic
1068699924 10:60009030-60009052 GGGTCTGCCACCTTCAAATGTGG - Intergenic
1069792446 10:71031640-71031662 GTGACTGCCTCCTTTGAAGGAGG - Intergenic
1077572480 11:3352255-3352277 GGGTCTGCCTCCTTCAACTGTGG - Intronic
1077790884 11:5438623-5438645 GTTTCTGCCTCCATTAAATGAGG + Intronic
1079974929 11:27078868-27078890 GGCATCGCCTCTTTTAAATATGG - Intronic
1083468135 11:62862838-62862860 GGCACTGCCTCAATTAATAGAGG + Intronic
1083617792 11:64035215-64035237 GGCACTGCCCCCTTAATAGGTGG + Intronic
1084337950 11:68472126-68472148 GGCATTGCTTCATTTAACTGGGG + Intronic
1085119123 11:73955983-73956005 GGCAATGCCTCCTCTTACTGCGG - Intronic
1086762937 11:90656346-90656368 GGCACTGCTAGCTTTGAATGCGG - Intergenic
1090011397 11:123048775-123048797 GGCCATGCTTCCTTTAAAGGAGG - Intergenic
1092718571 12:11417249-11417271 GGCACTGCATTCTTTAGAAGAGG - Intronic
1095811116 12:46373553-46373575 GGCACTGCCTTGTCTGAATGCGG + Intergenic
1096098901 12:48957112-48957134 AGCTCTGCGTCCTTCAAATGCGG + Intronic
1097836441 12:64277608-64277630 GGCCCTGGCTTCTTTTAATGTGG - Intronic
1099604165 12:84780662-84780684 GACACAGCCTCCTTTATCTGGGG - Intergenic
1100543007 12:95575816-95575838 GCTACTGCGTACTTTAAATGTGG - Intergenic
1105057105 12:133112072-133112094 GCCCCTGCCTCCTTTCAATCTGG + Exonic
1105903245 13:24776748-24776770 GGAACTGCCTCCTTCAGAGGGGG - Intronic
1112383656 13:98917893-98917915 GGAGATGCCCCCTTTAAATGGGG + Intronic
1117798216 14:59416463-59416485 GGCACTTCTTTTTTTAAATGAGG + Intergenic
1124384937 15:29199295-29199317 GGTACTTCTTCCTTGAAATGAGG + Intronic
1124839123 15:33225531-33225553 GGCTCTTCCTCCATGAAATGAGG + Intergenic
1125424929 15:39539149-39539171 GGCCCTGCCTCCTTTGCACGAGG + Intergenic
1126845730 15:52759064-52759086 GCCACTGCCACCTTTATATCTGG + Intronic
1129313018 15:74725543-74725565 GGCACTGCCACCTTTATAGGCGG + Exonic
1129671075 15:77607912-77607934 GGCACGGCCTCCTTTCTTTGTGG - Intergenic
1130743397 15:86625165-86625187 GGCTCTGCCTCCTTCAAGTTGGG + Intronic
1131859753 15:96639991-96640013 GGAAATGCCTCCTACAAATGTGG + Intergenic
1132058899 15:98674449-98674471 TCCATTGCCTCCTTTATATGAGG + Intronic
1133335877 16:5006495-5006517 GACACTGCCTCCCTTGAAGGGGG - Intronic
1133659833 16:7905494-7905516 TTCACTTCCTCCTATAAATGGGG - Intergenic
1134440565 16:14297319-14297341 GGCACAGCCTCCTTCTGATGGGG + Intergenic
1134838833 16:17384597-17384619 GGCACTGTCTACTTCAGATGTGG + Intronic
1135176571 16:20235016-20235038 GGCACTTTCTCTTTTAAGTGAGG + Intergenic
1136662026 16:31771645-31771667 GTCACTGCCTCCCTTGGATGGGG - Intronic
1137795226 16:51211696-51211718 GTCACAGCCTCCTTTAGATAGGG + Intergenic
1138546654 16:57723432-57723454 GGCACTGCCTCCTTTAAATGTGG - Intronic
1139236130 16:65341263-65341285 GGCACTGCAGACTTTACATGGGG - Intergenic
1140670177 16:77269961-77269983 CTCACTGCCTCCTTTAGCTGGGG + Intronic
1141257023 16:82411883-82411905 ACCTCTGCCTCTTTTAAATGTGG + Intergenic
1142100801 16:88270025-88270047 AGCACTGCCTCCTGTAGACGGGG + Intergenic
1143834705 17:9681801-9681823 GGCACAGGGTCCTTTAAATATGG - Intronic
1146796478 17:35784813-35784835 GACTCTGCCTCCTTGAAGTGGGG - Intronic
1148688504 17:49513668-49513690 GGCACCGCCTTCTCTAAATGAGG + Exonic
1149033007 17:52104754-52104776 AGCACTGACTCCTTGAATTGTGG + Intronic
1152178578 17:78803560-78803582 GGCCCTCCCTCCTGTACATGGGG + Exonic
1155885819 18:31206966-31206988 GGCACTGCTTCCTTTTTGTGTGG - Intergenic
1159879376 18:73844201-73844223 GGACCTGCCTCCACTAAATGGGG + Intergenic
1161538675 19:4836138-4836160 GGCATTGCTACCTTAAAATGTGG + Intergenic
1163832199 19:19552474-19552496 GGCACTCCCTCCTTTCCCTGGGG + Intergenic
1163851718 19:19668239-19668261 GGGGCTGCCTCCTCTAACTGTGG - Intergenic
1164770575 19:30805591-30805613 GGCACTGCCTCCTTAGAACCAGG - Intergenic
1165393638 19:35552003-35552025 GTGGCTGCCCCCTTTAAATGGGG - Intronic
1168309861 19:55454981-55455003 GGCATTACCTCCTTGAACTGGGG + Exonic
927637975 2:24829797-24829819 GTCACGGCCTCCTCTAATTGTGG - Intronic
931230088 2:60366719-60366741 AGCACTGCATTTTTTAAATGGGG - Intergenic
937577019 2:123436074-123436096 GGAACTGACTTTTTTAAATGAGG - Intergenic
938029777 2:127981906-127981928 GGGGCTGCCTCCTCTAACTGTGG + Intronic
945346373 2:208722992-208723014 CCCTCTGCCTCCTTTCAATGTGG - Intronic
947042954 2:225944853-225944875 GGCACAGCCTCATTTACCTGTGG - Intergenic
947480482 2:230495007-230495029 GTCACTGATTCCCTTAAATGTGG + Intronic
947790625 2:232865970-232865992 AGCACTGTCTCCTTTTAGTGGGG + Intronic
948748600 2:240113568-240113590 GGCAGTGCATCCTACAAATGAGG + Intergenic
949067712 2:242003442-242003464 GGCACTGCCCTCCGTAAATGGGG + Intergenic
949067720 2:242003488-242003510 GGCACTGCCCTCTGTAAATGGGG + Intergenic
949067782 2:242003832-242003854 GGCACTGCCCTCCGTAAATGGGG + Intergenic
1169895579 20:10502156-10502178 GGCACTTACCCCTTTAAGTGAGG + Intronic
1170073595 20:12395372-12395394 GGCACTGACAATTTTAAATGGGG - Intergenic
1172844170 20:37919879-37919901 GGCACTTCCTCTGTGAAATGGGG + Intronic
1173356784 20:42300406-42300428 AGCTCTGGTTCCTTTAAATGGGG - Intronic
1173639958 20:44594686-44594708 GGCTCTGTCTCCTTGCAATGGGG + Intronic
1174388792 20:50204411-50204433 GGCAGTGGTTCCTTAAAATGTGG - Intergenic
1175834827 20:61986547-61986569 GGCATTGCTTCCTTTGACTGGGG - Intronic
1181333019 22:22109023-22109045 TGCACGGCCTCATTTATATGAGG + Intergenic
949194319 3:1287318-1287340 CGCACTGCCTCCTCCAATTGTGG + Intronic
953129551 3:40124916-40124938 TGCACTGCCTCTTCTATATGAGG - Intronic
954083064 3:48223800-48223822 GGCATCTCCCCCTTTAAATGTGG + Intronic
957539249 3:81547157-81547179 GACTCTGCCTCCCTTAAATTGGG - Intronic
958834361 3:99126934-99126956 GGAACTGTCTTATTTAAATGTGG + Intergenic
959505385 3:107151334-107151356 GGCACTGCCTCCTCTTCTTGTGG - Intergenic
960676954 3:120204395-120204417 GACACTGCCGGCTATAAATGGGG - Intronic
967908036 3:194517870-194517892 GGCACCACCTCCTTTCAGTGAGG + Intergenic
968285476 3:197506036-197506058 GGCACTTCCTCCTGAAACTGGGG + Intergenic
968521998 4:1038243-1038265 GGCACTGCCTACTTTAAAGGAGG + Intergenic
968676263 4:1882211-1882233 AGCCCTGTCTCCTTGAAATGTGG + Intronic
969704595 4:8784862-8784884 GGCTCTGCCTCCTGTCACTGTGG + Intergenic
970504137 4:16709830-16709852 GGGAATGACTCATTTAAATGGGG + Intronic
970828666 4:20308583-20308605 GTCACTGCCTCTGTAAAATGGGG + Intronic
973173267 4:47172381-47172403 GGCACTACTTCCTGTAAATATGG - Intronic
977499495 4:97821493-97821515 GGCACTGCCTACTGGAAATGTGG - Intronic
979679506 4:123444306-123444328 GTCACTGTCCCCTTTAAAGGGGG + Intergenic
985569608 5:637851-637873 GGCACTGCCTCCCTAATGTGGGG + Intronic
985879895 5:2630424-2630446 GGCACAGACTACTTTTAATGAGG - Intergenic
987061044 5:14244337-14244359 GGCATTGTCTGCTGTAAATGGGG + Intronic
987288095 5:16479895-16479917 GGCACTGCTACCTTTCGATGGGG - Intronic
987390812 5:17373823-17373845 GGGACTGCCTCCTTTAGAATGGG + Intergenic
991731839 5:69597200-69597222 GAGGCTGCCTCCTTTAGATGGGG - Intergenic
991808271 5:70452338-70452360 GAGGCTGCCTCCTTTAGATGGGG - Intergenic
991863113 5:71030667-71030689 GAGGCTGCCTCCTTTAGATGGGG + Intergenic
992728966 5:79638909-79638931 GCCTCTGCCTTCTTAAAATGAGG + Intronic
994123067 5:96138999-96139021 GACACTTTCTCCTTTAAATTAGG - Intergenic
995624729 5:114063934-114063956 GGCATTGCCTCTGTTACATGTGG - Intergenic
999723583 5:154417026-154417048 GGCCCTGCCTCCCTTGAAAGAGG - Exonic
1000203544 5:159035490-159035512 TGTACTGCCTCCTTCAAATATGG - Intronic
1000967439 5:167675193-167675215 GGCTGTGCCTCCTTTGAATTTGG + Intronic
1001351416 5:170970455-170970477 TGCACTGCATACTTTATATGTGG + Intronic
1002665535 5:180821019-180821041 GGCAATGCTTCCTTTAATTTGGG + Intergenic
1003632365 6:7799193-7799215 GGCACTCCAGCCTTAAAATGAGG - Intronic
1005246396 6:23890543-23890565 GACCCTGCCTACTTGAAATGTGG - Intergenic
1006299995 6:33188923-33188945 GGCACTTCCTCCTGAAAGTGTGG + Intronic
1009300816 6:62017172-62017194 GGCACAGCCTCCTATAGGTGTGG - Intronic
1009591834 6:65682707-65682729 GGCTCTGACTTCTTTGAATGTGG - Intronic
1014484836 6:121985428-121985450 TTCACTGCCTCCTTTGACTGGGG + Intergenic
1017656268 6:156632971-156632993 GGCCCTGCCTCACTTAAATAAGG + Intergenic
1018085255 6:160295907-160295929 GGCACTGCCTTCTTTAAGCCAGG - Intergenic
1019183095 6:170204764-170204786 GGCCCGGCCTGCCTTAAATGGGG - Intergenic
1019183104 6:170204786-170204808 GGCCCGGCCTGCCTTAAATGGGG - Intergenic
1019183113 6:170204808-170204830 GGCCCAGCCTGCCTTAAATGGGG - Intergenic
1023994465 7:45150861-45150883 TGCACTGCATCCTTGAAATTAGG - Intergenic
1026204069 7:68240183-68240205 GGCACTGCCTCCTCTAGAGTGGG + Intergenic
1026437961 7:70416524-70416546 GGCATTGCCTGCTTGAAAAGAGG + Intronic
1026651845 7:72222630-72222652 AGCACTGACTCCTCCAAATGAGG - Intronic
1027943966 7:84722575-84722597 CGCACTGCCTCCTTTGGCTGGGG - Intergenic
1028608657 7:92683490-92683512 AGCACTGCCTTCCTTAAATGGGG + Intronic
1030533028 7:110733797-110733819 GGCCCTTCCTCCATTATATGAGG + Intronic
1033317871 7:140313352-140313374 GAAACTGCCTCCTCTAGATGGGG - Intronic
1034959462 7:155355942-155355964 GGCACTGCCTCCTGCAATTCAGG - Intergenic
1038259022 8:25977373-25977395 GGCCCTACCCCCTTTAACTGGGG - Intronic
1039599560 8:38823394-38823416 GGTACTTCCTCCCCTAAATGTGG + Intronic
1041352418 8:56961112-56961134 GTCACTGCCTCTACTAAATGTGG + Exonic
1048290070 8:133174613-133174635 GACACTGTCTCCTTTCAAAGTGG + Intergenic
1048493988 8:134920293-134920315 GGCACTGACTCCAATGAATGAGG - Intergenic
1050101178 9:2121253-2121275 GGCACAGCCTTCTTTTAATTTGG + Intronic
1050206095 9:3197834-3197856 GGAGATGCCTCCTTCAAATGTGG - Intergenic
1051172078 9:14329015-14329037 GCAACTGCCCCCTTTAGATGGGG + Intronic
1051895231 9:21979618-21979640 GGCACTTCCTTCTATGAATGAGG + Intronic
1053110266 9:35453670-35453692 GGCACTGGCTCCTTTGCCTGTGG + Intergenic
1055381863 9:75716121-75716143 GAAACTGCCTCCGTCAAATGCGG - Intergenic
1055934186 9:81589643-81589665 GGCACTTCCTCTATAAAATGGGG + Intronic
1057530509 9:95841594-95841616 TTCACTGGCTCCTCTAAATGTGG + Intergenic
1058568814 9:106318071-106318093 GGCAATGCCCCGTTTAATTGGGG + Intergenic
1058836506 9:108862551-108862573 GGCACTGGCTACTGTAAATGTGG + Exonic
1187278838 X:17840691-17840713 GGCTCTGCCATCTTTAACTGTGG + Intronic
1192356325 X:70407520-70407542 GGCACTGACTCCACTAAAGGGGG + Intronic
1198805301 X:140488334-140488356 GGCACTACCTCCTTTAGTTCTGG + Intergenic
1199982158 X:152927149-152927171 GGCACCACCTGATTTAAATGAGG + Intronic
1200342547 X:155413417-155413439 GGTACTGCCTCCTTTAATGCTGG + Intergenic
1201641748 Y:16186321-16186343 GGCTCTGCTAGCTTTAAATGTGG - Intergenic
1201661067 Y:16399000-16399022 GGCTCTGCTAGCTTTAAATGTGG + Intergenic