ID: 1138546654

View in Genome Browser
Species Human (GRCh38)
Location 16:57723432-57723454
Sequence GGCACTGCCTCCTTTAAATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 154}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138546654_1138546661 16 Left 1138546654 16:57723432-57723454 CCACATTTAAAGGAGGCAGTGCC 0: 1
1: 0
2: 1
3: 9
4: 154
Right 1138546661 16:57723471-57723493 ACCTGTAATCCAAGCGCTTTGGG 0: 2
1: 1413
2: 85899
3: 329778
4: 267375
1138546654_1138546663 19 Left 1138546654 16:57723432-57723454 CCACATTTAAAGGAGGCAGTGCC 0: 1
1: 0
2: 1
3: 9
4: 154
Right 1138546663 16:57723474-57723496 TGTAATCCAAGCGCTTTGGGAGG 0: 17
1: 5002
2: 323478
3: 273215
4: 203630
1138546654_1138546666 29 Left 1138546654 16:57723432-57723454 CCACATTTAAAGGAGGCAGTGCC 0: 1
1: 0
2: 1
3: 9
4: 154
Right 1138546666 16:57723484-57723506 GCGCTTTGGGAGGCCAACATGGG 0: 3
1: 141
2: 3632
3: 44946
4: 156098
1138546654_1138546660 15 Left 1138546654 16:57723432-57723454 CCACATTTAAAGGAGGCAGTGCC 0: 1
1: 0
2: 1
3: 9
4: 154
Right 1138546660 16:57723470-57723492 CACCTGTAATCCAAGCGCTTTGG 0: 2
1: 1294
2: 80704
3: 222326
4: 293276
1138546654_1138546665 28 Left 1138546654 16:57723432-57723454 CCACATTTAAAGGAGGCAGTGCC 0: 1
1: 0
2: 1
3: 9
4: 154
Right 1138546665 16:57723483-57723505 AGCGCTTTGGGAGGCCAACATGG 0: 2
1: 241
2: 5964
3: 74767
4: 162031

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138546654 Original CRISPR GGCACTGCCTCCTTTAAATG TGG (reversed) Intronic