ID: 1138551471

View in Genome Browser
Species Human (GRCh38)
Location 16:57751197-57751219
Sequence TCAGAGCCACGACTGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 196}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138551471_1138551479 24 Left 1138551471 16:57751197-57751219 CCTTCCTCCAGTCGTGGCTCTGA 0: 1
1: 0
2: 0
3: 17
4: 196
Right 1138551479 16:57751244-57751266 TTCTCTCTCCCCCACAGCTCTGG 0: 1
1: 0
2: 3
3: 46
4: 418
1138551471_1138551480 25 Left 1138551471 16:57751197-57751219 CCTTCCTCCAGTCGTGGCTCTGA 0: 1
1: 0
2: 0
3: 17
4: 196
Right 1138551480 16:57751245-57751267 TCTCTCTCCCCCACAGCTCTGGG 0: 1
1: 0
2: 3
3: 54
4: 476

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138551471 Original CRISPR TCAGAGCCACGACTGGAGGA AGG (reversed) Intronic
901916534 1:12504721-12504743 CCAGAACCACTTCTGGAGGAGGG - Intronic
904577710 1:31515725-31515747 TCAGGGTCAGGAGTGGAGGAAGG + Intergenic
904834350 1:33325135-33325157 TCATAACCACGCCTTGAGGAAGG + Intronic
905791348 1:40791405-40791427 TCAGAGCCTCCACTGGGGGCAGG - Intronic
906661153 1:47583312-47583334 GCAGAGCCAGGGCTGGGGGAAGG - Intergenic
908358899 1:63348470-63348492 TCATAGCCACTACAGGAAGAAGG + Intergenic
910296409 1:85650363-85650385 TCAGAGCCAAGTGTGTAGGATGG + Intronic
910989369 1:93039127-93039149 TTTGAGTCACAACTGGAGGATGG + Intergenic
913597193 1:120389520-120389542 GCAGCGCCAGGACTGGAAGAAGG - Intergenic
914001362 1:143697694-143697716 GCAGCGCCAGGACTGGAAGAAGG + Intergenic
914090131 1:144489786-144489808 GCAGCGCCAGGACTGGAAGAAGG + Intergenic
914308477 1:146444436-146444458 GCAGCGCCAGGACTGGAAGAAGG - Intergenic
914593632 1:149128697-149128719 GCAGCGCCAGGACTGGAAGAAGG + Intergenic
914760189 1:150592481-150592503 TCAGAGCCAAGATTGCAGTAGGG + Intergenic
915467048 1:156104014-156104036 TCACAGCCCCCACTGAAGGAGGG + Intronic
917869588 1:179229602-179229624 GCGGAGCCGCGACAGGAGGAGGG - Intronic
919400092 1:197103437-197103459 TCAGAGCATGGACTGCAGGAAGG - Exonic
920302291 1:204996543-204996565 GGAGAGCCAAGACCGGAGGAGGG + Intronic
920372696 1:205489555-205489577 ACAGAGCCAGGACTGGAACATGG - Intergenic
920447496 1:206029864-206029886 GCAGAGCCAGGACTGGAGCCAGG - Intergenic
920977957 1:210803647-210803669 TCAGAGCCATGACTAGAGACGGG - Intronic
921182041 1:212638869-212638891 TCAGAGTCAAGACAGGAGAAAGG - Intergenic
922661639 1:227435491-227435513 TCAGAGCCACGATAGAAAGAGGG + Intergenic
923746854 1:236709460-236709482 TCTGAGCCATGACTGCAGGCTGG + Intronic
924592853 1:245419995-245420017 TGGTAGTCACGACTGGAGGAGGG - Intronic
1063300534 10:4845670-4845692 TGAGAGCCACGACGGCAGAAGGG - Intronic
1067158911 10:43806183-43806205 TCAGAGCAATGCCTGGAGGAAGG - Intergenic
1069411050 10:68153736-68153758 TCAGAGCCACCAGTGATGGATGG + Intronic
1069603952 10:69728322-69728344 TAAGAACCAGGACTGGAGGAAGG - Intergenic
1069616002 10:69806455-69806477 GCAGAGCCGGGATTGGAGGATGG + Intronic
1070778365 10:79123425-79123447 TCACAGCCATGCCTGGAGCATGG + Intronic
1073323125 10:102627751-102627773 TCTGAGCCAGGGCTGGAAGAGGG - Intronic
1075064512 10:119280454-119280476 TCAGAACCACCTATGGAGGATGG - Intronic
1076559624 10:131352971-131352993 TCAGGACCACATCTGGAGGAGGG + Intergenic
1078280662 11:9897824-9897846 ACAGAGCCACAACTGGAGTCTGG + Intronic
1078357894 11:10646491-10646513 TCTGAGCCAAAACAGGAGGAAGG + Intronic
1078605888 11:12775260-12775282 TCAGAGCCACAAATGATGGAAGG + Intronic
1079185080 11:18229426-18229448 GCAGAGCCAGGACTGCAGGCTGG - Intronic
1079190290 11:18271478-18271500 GCAGAGCCAAGACTGCAGGCTGG + Intergenic
1081964740 11:47162632-47162654 TCCCAGCCAAGACTGGAGGCAGG + Intronic
1081998022 11:47377258-47377280 TCAGAGCCACCCCAGGAGGCTGG - Intronic
1083013046 11:59422389-59422411 ACAGAGCCAGGACTGGAGGGAGG + Exonic
1083014956 11:59443717-59443739 ACAGAGCCAGGACTGGTGGGAGG - Exonic
1083484402 11:62974383-62974405 TCAGGGCCAAGGCTAGAGGATGG + Intronic
1084455363 11:69265116-69265138 TCACAGCCACGACTGAGGGCTGG + Intergenic
1084649696 11:70481965-70481987 TCAGAACCACCACTGGGGGGGGG - Intronic
1085228290 11:74942468-74942490 TCAGGGCCAGCACTGGGGGAAGG + Intronic
1085468639 11:76741667-76741689 TCAGACACAGGTCTGGAGGAGGG - Intergenic
1087576025 11:99990946-99990968 ACAGAGCTAGGGCTGGAGGAGGG + Intronic
1090394327 11:126408734-126408756 TCACAGACACGCCTGGAGCATGG - Intronic
1093915185 12:24794237-24794259 TCAGAGCCACTACTGTGGGGAGG + Intergenic
1095088477 12:38083603-38083625 CCAGAGCCATGACTGGAAGGTGG + Intergenic
1096693893 12:53336846-53336868 CCAGAGCAAGGCCTGGAGGAAGG + Intronic
1097407461 12:59208034-59208056 TCAGAGGCAAGGCGGGAGGAGGG + Intergenic
1097677736 12:62621183-62621205 TCACGGGCAAGACTGGAGGAAGG - Intergenic
1104716775 12:131020772-131020794 TGAGAGCCACACCTAGAGGAGGG - Intronic
1104960556 12:132486721-132486743 TCAGACCCACGACGGGAGGGAGG - Intergenic
1107879409 13:44820132-44820154 GCAAAGCCAAGAATGGAGGAGGG + Intergenic
1114062243 14:19028160-19028182 TCAGAGCCACTTCTGCAGGCAGG + Intergenic
1114100017 14:19371833-19371855 TCAGAGCCACTTCTGCAGGCAGG - Intergenic
1116476605 14:45347742-45347764 CCAGAGCAACTACTGGAAGAGGG - Intergenic
1118899828 14:69977262-69977284 ACAGGGTCAGGACTGGAGGAGGG + Intronic
1119262169 14:73244412-73244434 TGAGAGCCAGGCCTGGAGGGCGG - Intronic
1119422690 14:74516968-74516990 TCACAGCCAGCCCTGGAGGATGG + Intronic
1119920210 14:78439763-78439785 TCAGAGCTAGGACTGGAGCTGGG + Intronic
1119931520 14:78552011-78552033 TCAGAACCACCACTGGAGGCAGG - Intronic
1120305485 14:82764329-82764351 TAAGAGCCAAGCCTAGAGGAAGG - Intergenic
1122561968 14:102622139-102622161 CCAGAGGTAGGACTGGAGGAGGG + Intronic
1122763659 14:104049755-104049777 TCAGAGCCAGGGCTGGCCGAGGG + Intronic
1123076477 14:105669787-105669809 TCAGAGACGCTCCTGGAGGAGGG + Intergenic
1127845466 15:62866597-62866619 ACAGAGCCAGGACTAGAGGTTGG - Intergenic
1133703675 16:8333069-8333091 GCAGAGCCAGGACTAGAGGTTGG - Intergenic
1135397078 16:22139356-22139378 TCTCAGCCACGACTGGAGTGTGG - Intronic
1138551471 16:57751197-57751219 TCAGAGCCACGACTGGAGGAAGG - Intronic
1138817197 16:60215984-60216006 TAAGAGGCAGGAGTGGAGGAAGG + Intergenic
1140736014 16:77898472-77898494 TCACAGCTATAACTGGAGGAGGG - Intronic
1141181060 16:81753776-81753798 CCACAGCCATGACTGTAGGATGG + Intronic
1141650912 16:85392733-85392755 TCACAGCCAGGACTTGTGGAAGG + Intergenic
1142333877 16:89474153-89474175 TCAGAGGCTCGAGTGGGGGATGG - Intronic
1142887011 17:2919232-2919254 TCTGAGCCAGACCTGGAGGAAGG + Intronic
1143269694 17:5666393-5666415 CCAGTGCCATGACTGGAGGTGGG - Intergenic
1143888695 17:10086003-10086025 TCAGAGGCATGACTGGATGTTGG + Intronic
1146467866 17:33100962-33100984 TCAGAAACACCACTGGAGGCAGG - Intronic
1146689778 17:34865388-34865410 ACATAGCCATGACTGGAGGCTGG - Intergenic
1149974677 17:61253611-61253633 TCAGACCCAGGATTGGAGGAGGG + Intronic
1150141862 17:62737079-62737101 TCACACCCACCACTGTAGGAGGG - Exonic
1150996797 17:70327939-70327961 TCAGAAGCAAGACTGGAGTAAGG + Intergenic
1153660108 18:7318442-7318464 TCAGAGCTACGACTGGATCCAGG + Intergenic
1155347559 18:24873798-24873820 TTAAAGAGACGACTGGAGGAAGG - Intergenic
1157274839 18:46303210-46303232 GCAGAGACATGACTGGAGGCTGG - Intergenic
1157336059 18:46738396-46738418 TCAGAGCCAGGATTAGAGGAAGG + Intronic
1160726662 19:620652-620674 CCATAGCCACGGATGGAGGATGG + Intronic
1160764584 19:801757-801779 GCAGTGCCAGGACCGGAGGAAGG - Intronic
1162552674 19:11366235-11366257 TCAGAGCCACAATTGAGGGAGGG - Intergenic
1162718540 19:12648341-12648363 TCGGAGCCACTAATGGAGAACGG - Exonic
1163587872 19:18173684-18173706 TCAGAGGAAGGAGTGGAGGAGGG + Exonic
1163617743 19:18339954-18339976 TGACAGCCAGGACAGGAGGAGGG + Intergenic
1163781466 19:19251473-19251495 TCACAACCACGACAGGAGTAAGG + Exonic
1164841604 19:31397316-31397338 TCAGAGCCCAGGCTGTAGGATGG + Intergenic
1165308947 19:35019180-35019202 TCAGCGTCACGTCTAGAGGAGGG - Exonic
1165394144 19:35555142-35555164 TCCGAGCCACGCCAGGGGGAGGG - Intronic
1165843842 19:38805593-38805615 TCAGGGCCAGGACAGGAGGGTGG - Intronic
1166738201 19:45098454-45098476 TCACCGGCAGGACTGGAGGAGGG - Intronic
1167345004 19:48939842-48939864 TCAGAGTCAAGACTGCAGGTGGG + Intronic
925054425 2:846246-846268 ATAGAGCCACTGCTGGAGGATGG - Intergenic
926005573 2:9371132-9371154 ACAGTGCCAAGGCTGGAGGAGGG - Intronic
926061258 2:9806562-9806584 TCAGAGGCAGGACTGGAGTTGGG - Intergenic
927686921 2:25177654-25177676 GCAGAGTCAAGAGTGGAGGAAGG + Intergenic
931765530 2:65452755-65452777 TCAGAGGCTTGAATGGAGGATGG + Intergenic
932805356 2:74778408-74778430 GCAGAGCCTGGAGTGGAGGAAGG - Intergenic
933750535 2:85600044-85600066 GCAGGGCCAGGGCTGGAGGAAGG - Intronic
933822750 2:86129291-86129313 TAACAGCCAGGACTGGGGGATGG + Intronic
935668468 2:105535033-105535055 GCAGAGGCAGGACTGGAGGTTGG - Intergenic
937908236 2:127062988-127063010 TCAGACCCACCACTGGGGGCGGG + Intronic
938479606 2:131648345-131648367 TCAGAGCCACTTCTGCAGGCAGG + Intergenic
945004991 2:205395493-205395515 TCAGAGACACGAGTGGGGGTTGG - Intronic
945788984 2:214279469-214279491 TCTGAGCCACAACTCGAGAAAGG + Intronic
946432645 2:219633793-219633815 TCAGAGCCAGGGCTGGAGCCAGG + Intronic
947793941 2:232882706-232882728 TCGGGGCCACGACGGGAGGAGGG + Intronic
1168886543 20:1263368-1263390 TCACAGACACCACTGCAGGATGG + Intronic
1169867772 20:10218988-10219010 CCAGAGCCACGACCTGGGGAGGG - Intronic
1171108520 20:22458918-22458940 TCAGAGCCACACCGAGAGGAAGG - Intergenic
1172117287 20:32580695-32580717 TGAGAGCCAGGACTGGAACAGGG - Intronic
1172261593 20:33570984-33571006 ACAGAGCCAGGACTGGGGAAAGG - Intronic
1172277409 20:33687093-33687115 TTAGGGCCACGAATTGAGGATGG - Intergenic
1173326377 20:42037370-42037392 TCAGAGCCAACACTGTAGGGAGG + Intergenic
1173670223 20:44793691-44793713 CCAGAGGCCTGACTGGAGGAGGG + Intronic
1174442242 20:50565353-50565375 GCAGAGCCATGGCTGGAGGAGGG + Intronic
1179892883 21:44345768-44345790 TCAGAGCCAGGCCTGGGAGAAGG + Intergenic
1180480734 22:15750786-15750808 TCAGAGCCACTTCTGCAGGCAGG + Intergenic
1181594137 22:23903385-23903407 TCTGAGGCATGAATGGAGGAGGG + Intergenic
1181625537 22:24119899-24119921 TCACAGCCAGGAATGGAGGGAGG + Intronic
1184779511 22:46639960-46639982 GCAGAGCCACCACTGCAGGCTGG - Intronic
1185150345 22:49160596-49160618 ACAGAGCCACGCCTGGCGGGGGG - Intergenic
1185382599 22:50516997-50517019 GCAGGGCCAGGACAGGAGGAGGG + Intronic
950456764 3:13097344-13097366 CCAGAGCCACGTCTGGAAGCAGG - Intergenic
950747560 3:15102528-15102550 GCAGAGCCTTGCCTGGAGGATGG + Intergenic
950938440 3:16867178-16867200 GCAGAGCCAAGACTGGAGCAAGG - Intronic
951541966 3:23790319-23790341 TCAGAGCCTTGACTGAAGGGTGG + Intergenic
952873671 3:37923871-37923893 TCAGAGCCATGATAGCAGGAAGG + Intronic
956166943 3:66404366-66404388 TCGGAGGGAAGACTGGAGGAGGG - Intronic
956544889 3:70389961-70389983 ACAGAGCAATGACTGAAGGAAGG + Intergenic
960874983 3:122287062-122287084 TCAGAGGCATGACTGCAGGGGGG - Intergenic
961000588 3:123371623-123371645 TCTCAGCCAGGCCTGGAGGATGG + Intronic
961460184 3:127045231-127045253 GCTGAGCCCTGACTGGAGGAAGG - Intergenic
962209512 3:133465432-133465454 TCCTAGCCAAGAATGGAGGAGGG - Intronic
962282688 3:134064253-134064275 TCTGAGCCACTTCTGCAGGAAGG + Intergenic
962368732 3:134803492-134803514 TCAGAAGCAGGACTGGAGGTCGG + Intronic
963282645 3:143400796-143400818 TCAGAGCCAAGACTAGAGTTAGG + Intronic
966593460 3:181705227-181705249 TCTGAGCCAGGACTGGAAGAGGG + Intergenic
969790846 4:9493368-9493390 TAAGAGCCAGGAGTGGAAGAGGG - Intergenic
971393226 4:26205051-26205073 GCAGAGTTACGACTGCAGGATGG + Intronic
976572990 4:86635009-86635031 TCAGAGACAGAACTGGAGAATGG - Intronic
980043712 4:127965909-127965931 TCAGAGCCAGGACTGAAGGTGGG + Exonic
981694157 4:147542467-147542489 GCAGAGGCATGACTGGGGGAAGG - Exonic
982431285 4:155324605-155324627 TCAGAGCCAACACTGGAGTATGG - Intergenic
990533181 5:56694233-56694255 TCAGAGCCACTACTTGAAAAGGG - Intergenic
994525908 5:100904288-100904310 TGAGGGCAACGACTGGAGGATGG - Intergenic
998186101 5:139981274-139981296 TCCAAGCCACCTCTGGAGGAAGG - Intronic
1000286643 5:159832672-159832694 ACAGAGTCCCAACTGGAGGAAGG - Intergenic
1002453621 5:179333054-179333076 TCAGAGCCCCGGCAGAAGGAAGG - Intronic
1004058325 6:12163834-12163856 TCAGAGCCAGTCCTGGTGGATGG - Exonic
1004142851 6:13036756-13036778 GCAGAGCCATGGCTGGAGGTAGG - Intronic
1005841486 6:29747510-29747532 GCAGGGCAAGGACTGGAGGATGG + Intergenic
1005862012 6:29908862-29908884 TCAGACACACGACCGGCGGAAGG - Intergenic
1006609638 6:35286433-35286455 TGGGAGGCAGGACTGGAGGATGG + Intronic
1011017329 6:82771482-82771504 TCAGTACCAGGACTGAAGGAGGG - Intergenic
1015081332 6:129228789-129228811 TTAGAGCCACAGCTGGAGAAAGG - Intronic
1015569149 6:134604181-134604203 CCAGGCCCACGACTGGAGCAAGG + Intergenic
1017255778 6:152331541-152331563 TCTGAGCCATATCTGGAGGAGGG + Exonic
1019609417 7:1929425-1929447 TCAGAGCCAGCACGGGAGGCCGG + Intronic
1020116460 7:5479207-5479229 TCATAGACAGGACTGGGGGAAGG - Intronic
1022390617 7:29940775-29940797 TCAGAGCCAAGGTTGGTGGACGG - Exonic
1023771388 7:43559761-43559783 TCAGAACCACACCTGGAGGGTGG + Intronic
1023839385 7:44087938-44087960 TCAGAGCCAGGAGGGGAGGCCGG - Intergenic
1023856525 7:44187601-44187623 TCAGGGCCAAGAGTGGAGCAAGG - Intronic
1025606754 7:63044906-63044928 TCAGAGACTAGAGTGGAGGATGG - Intergenic
1025806190 7:64836601-64836623 TCAGTACCTCCACTGGAGGATGG - Intergenic
1026819653 7:73538166-73538188 TCACAGCCAAGAATGGTGGAAGG + Intronic
1027304409 7:76877296-76877318 TCAGAGCCTAGATTGTAGGAAGG + Intergenic
1030647240 7:112075286-112075308 AGAGAGGCAAGACTGGAGGAGGG + Intronic
1031160005 7:118155172-118155194 TCAGGGCCAGGATTGGAGGTAGG + Intergenic
1034303813 7:150035946-150035968 TCAGAGCCAGGGCGGGAAGAGGG + Intergenic
1038537968 8:28368166-28368188 CCAGAGCCAGGACTGGAGGGAGG + Intronic
1044924643 8:97199817-97199839 TCACAGCCAAGGCTGCAGGATGG - Intergenic
1045010451 8:97954208-97954230 AGAGAGCCACCACTGGGGGAGGG - Intronic
1048699867 8:137076902-137076924 TCAGAGACATCACTGGTGGAAGG + Intergenic
1048767721 8:137862850-137862872 TCAGAGCCCCACCTGGTGGAGGG - Intergenic
1049578998 8:143402396-143402418 TCAGAGCCAAGCCTGGAGCGGGG - Intergenic
1051497610 9:17742242-17742264 TCAGAGCCACCCCTAGAGGATGG + Intronic
1054971017 9:71086917-71086939 TCAGGGCCAGGACTAGAGAAAGG - Intronic
1057346691 9:94258096-94258118 ACAGAGCCACTGCTGGGGGATGG - Intergenic
1057521734 9:95765717-95765739 GCAGAGACACGACTGGAGTGAGG + Intergenic
1057774904 9:97999780-97999802 CCAGAGGCAGGACTGGAGGCAGG + Intronic
1059284108 9:113158108-113158130 TCAGAGCCACTACTAGATCAAGG + Intronic
1059378204 9:113902171-113902193 TCAGAGCCACACAGGGAGGAAGG - Intronic
1059833243 9:118122173-118122195 TCAGAGACAAGACAGGAGGGAGG + Intergenic
1060536415 9:124392522-124392544 TCAGAGCCACCCTTTGAGGAAGG - Intronic
1060815533 9:126633167-126633189 ACAGATCCAAGCCTGGAGGACGG - Intronic
1061879292 9:133560729-133560751 TCAGAGTCCCAGCTGGAGGAGGG + Intronic
1061887483 9:133599113-133599135 CCAGAGGCAGGACAGGAGGAGGG - Intergenic
1062204255 9:135327059-135327081 GCACAGCCAGGACTGGAGGCTGG - Intergenic
1188937161 X:36190817-36190839 TTAGAGCCACCACTGAGGGAAGG + Intergenic
1189012563 X:37061044-37061066 TCAGGGCCAAGACTGGAGACAGG - Intergenic
1189036241 X:37496078-37496100 TCAGTCCCAAGACAGGAGGAAGG + Intronic
1189037745 X:37509620-37509642 TCAGTCCCAAGACAGGAGGAAGG + Intronic
1189366929 X:40396006-40396028 TAAAAGCCACTCCTGGAGGAAGG + Intergenic
1191723165 X:64251784-64251806 TCAGAGCCATGCCAGAAGGAAGG - Intergenic
1196717689 X:118826199-118826221 CCAGAACCACCACTGGTGGAAGG - Exonic
1197769732 X:130082450-130082472 GGAGAGCCCCGACTGGAGGAGGG + Intronic
1200046883 X:153407972-153407994 CCAGAGCCAAGACTTGAGGTTGG + Intergenic
1200114915 X:153765772-153765794 GCAGAGCAGCGCCTGGAGGAAGG - Intronic
1201772001 Y:17624319-17624341 CCAGAGCCATGACTGGAAGGTGG - Intergenic
1201829554 Y:18281667-18281689 CCAGAGCCATGACTGGAAGGTGG + Intergenic