ID: 1138551658

View in Genome Browser
Species Human (GRCh38)
Location 16:57752017-57752039
Sequence AGGCCAGGAGGTACTCGTTG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 1, 2: 2, 3: 9, 4: 119}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138551658_1138551664 -6 Left 1138551658 16:57752017-57752039 CCCCAACGAGTACCTCCTGGCCT 0: 1
1: 1
2: 2
3: 9
4: 119
Right 1138551664 16:57752034-57752056 TGGCCTCCGGCAGCTCTGACAGG 0: 1
1: 0
2: 1
3: 12
4: 153
1138551658_1138551669 5 Left 1138551658 16:57752017-57752039 CCCCAACGAGTACCTCCTGGCCT 0: 1
1: 1
2: 2
3: 9
4: 119
Right 1138551669 16:57752045-57752067 AGCTCTGACAGGTGAGGAGGAGG 0: 1
1: 1
2: 5
3: 43
4: 391
1138551658_1138551668 2 Left 1138551658 16:57752017-57752039 CCCCAACGAGTACCTCCTGGCCT 0: 1
1: 1
2: 2
3: 9
4: 119
Right 1138551668 16:57752042-57752064 GGCAGCTCTGACAGGTGAGGAGG 0: 1
1: 0
2: 3
3: 35
4: 332
1138551658_1138551670 12 Left 1138551658 16:57752017-57752039 CCCCAACGAGTACCTCCTGGCCT 0: 1
1: 1
2: 2
3: 9
4: 119
Right 1138551670 16:57752052-57752074 ACAGGTGAGGAGGAGGAGCGAGG 0: 1
1: 0
2: 5
3: 89
4: 740
1138551658_1138551666 -1 Left 1138551658 16:57752017-57752039 CCCCAACGAGTACCTCCTGGCCT 0: 1
1: 1
2: 2
3: 9
4: 119
Right 1138551666 16:57752039-57752061 TCCGGCAGCTCTGACAGGTGAGG 0: 1
1: 0
2: 0
3: 8
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138551658 Original CRISPR AGGCCAGGAGGTACTCGTTG GGG (reversed) Exonic
900252144 1:1676405-1676427 GGGACAGGATGTACTTGTTGAGG + Exonic
900262554 1:1739263-1739285 GGGACAGGATGTACTTGTTGAGG + Exonic
900680518 1:3913767-3913789 AAGCCAGGAGGTTCTCGTTTTGG + Intergenic
900886654 1:5420067-5420089 AGGCTGGGAGGTTCTCGATGAGG - Intergenic
903023289 1:20409606-20409628 AGACCAGAAGGAACTCGGTGTGG + Intergenic
903184843 1:21623032-21623054 AGGCCTGGTGCTACTCTTTGGGG + Intronic
904545640 1:31268889-31268911 AGGCCAGGAGTCTCTTGTTGAGG + Intronic
905610624 1:39347358-39347380 AGTCCAGGAGGCACTTGTTCTGG + Intronic
906766900 1:48441914-48441936 ATACCAGGAGCTACTCCTTGAGG + Intronic
908187189 1:61663789-61663811 AGGCCAGGAGGTGGAGGTTGCGG - Intergenic
914811823 1:151034243-151034265 AGGCGAGGAGGTAGTGGGTGAGG + Exonic
915513486 1:156399954-156399976 AGGCCAGGAGGCACACTGTGGGG - Intergenic
916114789 1:161477427-161477449 ATGCCAGGTGCTACTCCTTGAGG + Intergenic
918600605 1:186354979-186355001 AGCCCAGGAGGCAGTGGTTGCGG - Intronic
1064100364 10:12458492-12458514 AGGCCAGGAGGTAGAGGCTGTGG - Intronic
1064151407 10:12868788-12868810 AACCCAGGAGGTACAAGTTGCGG - Intergenic
1069617613 10:69816179-69816201 AGGCCAGGTGGTAGTCATGGAGG + Intronic
1069809721 10:71149165-71149187 AGGTCAGGAGGTACTGATAGAGG + Intergenic
1070690693 10:78522699-78522721 AGGGCAGGAGGTAGGAGTTGAGG + Intergenic
1070708297 10:78657576-78657598 GACCCAGGAGGAACTCGTTGGGG + Intergenic
1074066010 10:110014602-110014624 AGCCCAGGAGGTAGATGTTGCGG - Intronic
1076584346 10:131535073-131535095 AGGCCTGGAGGTCGTCTTTGAGG - Intergenic
1077668903 11:4139410-4139432 AACCCAGGAGGTAGACGTTGTGG - Intergenic
1077693539 11:4371935-4371957 ATGCCAGGAGATACTATTTGGGG + Intergenic
1079310430 11:19360750-19360772 AGAGCAGGAGGCACTCTTTGTGG + Intronic
1080587732 11:33696817-33696839 TGGGCTGGAGGTACACGTTGGGG - Intergenic
1080947486 11:36990664-36990686 AGCCCAGGAGGTAATCAATGAGG - Intergenic
1082786266 11:57318726-57318748 TGGCCAGGAGGTGCTTCTTGGGG - Intronic
1085418719 11:76337390-76337412 AGCCCAGGAGGTCCAGGTTGTGG - Intergenic
1091108160 11:132942541-132942563 AGGCCAGAAGGTACATGATGAGG - Intronic
1091962857 12:4713357-4713379 AGCCCAGGAGGTAGACGTTGTGG - Intronic
1092489921 12:8935836-8935858 AACCCAGGAGGCACTGGTTGCGG - Intronic
1092678861 12:10954543-10954565 AGACCAGGAGGTAGAGGTTGTGG - Intronic
1100529863 12:95453158-95453180 ATACCAGGAGCTACTCCTTGAGG - Intergenic
1101319509 12:103661126-103661148 AGGCCAGGAGGTCCTCATTGAGG + Intronic
1103528390 12:121582591-121582613 AGGCCAGGAACTCCTCGTGGAGG - Intergenic
1108758182 13:53529645-53529667 AGGCCTGGAGGTTCACTTTGGGG - Intergenic
1116837552 14:49785806-49785828 AGCCCAGGAGGTAGACGTTGTGG + Exonic
1120788420 14:88557631-88557653 AGCCCAGGAGGCACAGGTTGTGG + Intergenic
1122496387 14:102159018-102159040 AGGCCAGGAGTTAAAGGTTGCGG - Intronic
1125731827 15:41896739-41896761 AGGACAGGAGGGACTCATGGAGG - Exonic
1132338288 15:101062784-101062806 AGGCCAGGTGGTCCTAGGTGTGG - Intronic
1138551658 16:57752017-57752039 AGGCCAGGAGGTACTCGTTGGGG - Exonic
1139691546 16:68645165-68645187 AGGCCAGGAGGGGTTCGCTGGGG + Exonic
1141206561 16:81937680-81937702 AGGCCAGGAGTTTCTAGGTGGGG - Intronic
1141772658 16:86100564-86100586 AGGCCAGGTAGTAAGCGTTGTGG - Intergenic
1142742120 17:1937323-1937345 CGTCCTGGAGGTACTCGATGTGG + Exonic
1147604003 17:41763690-41763712 AGACCAGGAGGCAATTGTTGAGG + Intronic
1147906174 17:43824609-43824631 AGGCCAGGAGGTGATCTTTTGGG - Intronic
1151568383 17:74913200-74913222 ATACCAGGAGCTACTCCTTGAGG + Intergenic
1152641151 17:81449799-81449821 AAGCCAGGAGGTGCTCGGAGGGG - Intronic
1152753369 17:82076798-82076820 AGGACAGGAGGTGCTGGCTGTGG - Intergenic
1203166357 17_GL000205v2_random:100388-100410 AGGCCAGGAGGTCCTGTTAGAGG - Intergenic
1153938551 18:9954630-9954652 ATGCCAAGAGGTATTCCTTGGGG + Intronic
1157481161 18:48054657-48054679 ATGCCAGGCGGTTCTCGTGGTGG - Intronic
1161221775 19:3121155-3121177 AGACCAGGTTGTACTCCTTGAGG - Exonic
1162063522 19:8111064-8111086 AGGCCCGGTGGTCCTCGGTGGGG + Exonic
1162731244 19:12720396-12720418 AGCCCAGGAGGTAGAGGTTGTGG - Intronic
1165737353 19:38185128-38185150 AGGCCAGGAGGACCTGTTTGAGG - Intronic
1167083014 19:47290140-47290162 AGGCCAGGTGGTTCACGCTGTGG + Intronic
1167092654 19:47355191-47355213 CGCCCAGGAGGAAATCGTTGTGG - Exonic
1167955445 19:53060270-53060292 AGCCCAGGAGGTAAAAGTTGTGG - Intergenic
928008200 2:27582507-27582529 AGGCCTGAAGCTACTCGATGAGG + Exonic
928175393 2:29030196-29030218 AGGCCAGGAGGCACTGGTTGCGG + Intronic
928966853 2:36984682-36984704 AGGTTAGTAGGTACACGTTGGGG + Intronic
929769951 2:44883481-44883503 AGGCCAGCAGGTACTGGGGGAGG - Intergenic
933735455 2:85490302-85490324 AGCCCAGGAGGTGCAGGTTGTGG - Intergenic
937284209 2:120739625-120739647 AGGCCAGGTGGACCTCGCTGTGG + Intronic
938338010 2:130516486-130516508 AGGCCAGGAAGGACTCTTTGGGG - Intergenic
938351828 2:130604252-130604274 AGGCCAGGAAGGACTCTTTGGGG + Intergenic
946377985 2:219325428-219325450 AGGCCAGGAGATACGGGATGGGG + Intergenic
947736959 2:232460104-232460126 AGGCCAGGAGGTACTGCTGAGGG + Intergenic
947841501 2:233210697-233210719 AGGCCAGGAGGAACTAGATGAGG + Intronic
948767137 2:240228284-240228306 GGGCCAGGAGGTGCTGGCTGTGG + Intergenic
1171947955 20:31395321-31395343 AGGCCAGGAGATACGGGATGAGG + Intergenic
1172291451 20:33780096-33780118 TGGCCAGGAGGGCCTCTTTGGGG + Intronic
1173988460 20:47280946-47280968 AGGTCAGGAGGTAGTGGTGGGGG - Intronic
1174571626 20:51506213-51506235 TGGCGATGAGGTGCTCGTTGGGG + Intronic
1174589246 20:51632175-51632197 AGGTCAGGAGGTCCAGGTTGAGG - Intronic
1174622355 20:51885461-51885483 AGGCCAGGAGGCAGAGGTTGCGG + Intergenic
1174962351 20:55172816-55172838 AGCCCAGGAGGTCCAGGTTGCGG - Intergenic
1176405398 21:6358708-6358730 AGGCCAGGAGGTCCTGTTAGAGG + Intergenic
1176431759 21:6630395-6630417 AGGCCAGGAGGTCCTGTTAGAGG - Intergenic
1177150023 21:17445967-17445989 AGCCCAGGAGGTAGAGGTTGCGG - Intronic
1183151237 22:36039087-36039109 AGCCCAGGAGGTTAACGTTGAGG + Intergenic
1184295334 22:43520138-43520160 AGCCCAGGAGGTGGTGGTTGTGG - Intergenic
1184354923 22:43973436-43973458 TGGCCAGGAGGTACCTGGTGCGG - Intronic
952940607 3:38441598-38441620 ATACCAGGAGCTACTCCTTGAGG - Intergenic
954300413 3:49698128-49698150 CAACCAGGAGGTACACGTTGGGG + Exonic
954333372 3:49902565-49902587 GGGCCAGGAAGTACTATTTGGGG - Exonic
954334660 3:49909255-49909277 AGGCCAGGAGGTTCTCGTTGGGG + Exonic
957018894 3:75101523-75101545 TGGCCAGGTGGTACTTGCTGTGG - Intergenic
961145264 3:124587781-124587803 AGCCCAGGAGATCCTGGTTGTGG - Intronic
964387220 3:156160871-156160893 AGGCCCGGAGGTAGTCATTGTGG + Intronic
964422729 3:156521217-156521239 AGTCCCGGAGCTACTCCTTGAGG - Intronic
964492235 3:157249230-157249252 TGGCCAGGAGGCAGTCCTTGAGG + Intergenic
964784816 3:160384737-160384759 AGGACTGAAGGTGCTCGTTGGGG - Intronic
967655580 3:192044186-192044208 TAGCCAGGCAGTACTCGTTGTGG + Intergenic
967682020 3:192375045-192375067 AGGGCAGTAGGTACTTTTTGTGG - Intronic
968852296 4:3091032-3091054 AACCCAGGAGGTACAGGTTGCGG + Intronic
973046186 4:45536280-45536302 ATACCAGGAGCTACTCCTTGAGG + Intergenic
975780819 4:77838104-77838126 AGACCAGGAGGTAGAGGTTGCGG - Intergenic
977310894 4:95385976-95385998 ATGCCAGGAGATACTGGTTGGGG - Intronic
994753191 5:103764161-103764183 TGGACAGGAGCTACTCATTGTGG - Intergenic
1006613457 6:35309786-35309808 TGTCCAGGATGTACTTGTTGAGG - Exonic
1008944106 6:57078141-57078163 AGGCAAGGATGTCCTCTTTGAGG - Intergenic
1018396233 6:163379944-163379966 AGGCAAGGAGGTCCTTGATGAGG - Intergenic
1020147731 7:5657487-5657509 AACCCAGGAGGTAGTGGTTGCGG + Intronic
1020453295 7:8344742-8344764 AGGGCAGGAGCTTCTCCTTGGGG + Intergenic
1020832511 7:13109825-13109847 AGGCAAGGAGGTGCTTTTTGAGG + Intergenic
1023545512 7:41314440-41314462 AGTCCAGGAGGTAGAGGTTGTGG - Intergenic
1025992285 7:66505158-66505180 AGACCAGGTTGTACTCCTTGAGG + Intergenic
1027174082 7:75892351-75892373 ATGCCAGGAGGTACCAGTTCTGG + Intergenic
1031403963 7:121360755-121360777 AGGCCAGGAGGTGGAGGTTGCGG + Intronic
1040467965 8:47712805-47712827 AGTCCTGGAGGCACTCGCTGGGG + Exonic
1044435032 8:92151738-92151760 AACCCAGGAGGTTCTGGTTGCGG - Intergenic
1044735691 8:95275786-95275808 AGCCCAGGAGGTAGAAGTTGCGG - Intergenic
1046752266 8:117938382-117938404 AGGCCAGGAGGTAAAGGTTGCGG + Intronic
1050130540 9:2407168-2407190 TGGAAAGGAGCTACTCGTTGCGG + Intergenic
1051418799 9:16870765-16870787 AGGCCCGGAGGAACTCGGAGGGG - Intronic
1052057463 9:23921020-23921042 ATACCAGGAGCTACTCCTTGAGG - Intergenic
1053006890 9:34610872-34610894 AGGCCAGGGGGTGCTCCTGGGGG + Exonic
1056733193 9:89183235-89183257 AGGCCAGGGGATACTCTCTGTGG - Intergenic
1061251108 9:129427008-129427030 AGTCCAGGAGGTAGAGGTTGCGG + Intergenic
1061848380 9:133400702-133400724 AGGCCAGGAGACACTCCTGGTGG + Intronic
1062495197 9:136828255-136828277 TGGACAGGAGGTGCTAGTTGGGG - Intronic
1203439780 Un_GL000195v1:178313-178335 AGGCCAGGAGGTCCTGTTAGAGG + Intergenic
1187314857 X:18183718-18183740 TGGCCTGGAGGTACCCATTGTGG + Intronic
1188766955 X:34105546-34105568 AGTCCAGGAGGTAGAGGTTGCGG - Intergenic
1188794190 X:34441920-34441942 TGGCCAGTAGGGACTCTTTGTGG + Intergenic
1194296557 X:92133442-92133464 AAGCCAGGAGGTAGAGGTTGTGG - Intronic
1199464110 X:148116536-148116558 AAGCCAGGAGGAACTTCTTGTGG + Intergenic