ID: 1138553964

View in Genome Browser
Species Human (GRCh38)
Location 16:57761625-57761647
Sequence CTGGAGAAGGCTTCCTGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 0, 2: 6, 3: 42, 4: 274}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138553964 Original CRISPR CTGGAGAAGGCTTCCTGGGT TGG (reversed) Intronic
901929278 1:12586407-12586429 CAGGAGAAGGCTGGCTGGGTGGG - Intronic
902191174 1:14764311-14764333 CAGGAGAAGGCTTATTGGGAAGG - Intronic
902407301 1:16191782-16191804 CTGGAGATGGCGTCTGGGGTGGG - Intergenic
902888958 1:19427562-19427584 TTGGAGAAGGAATCCTGGGCCGG + Intronic
902915390 1:19635789-19635811 CTAGAGAAGGCTTGCTGGGCCGG - Intronic
902921900 1:19671240-19671262 CTGGAGGGGTCTTCATGGGTTGG + Intronic
903492866 1:23743175-23743197 CTGGAGAGGTCTTCCAGGCTTGG + Exonic
904679795 1:32221447-32221469 TTGGGGAAGGCTTCCTGGAGGGG - Intronic
905171765 1:36113934-36113956 ATGAGGAAGGCTTCCAGGGTAGG + Intronic
906692536 1:47802073-47802095 GTGAGGAAGGCTTCCAGGGTAGG - Intronic
907088897 1:51706162-51706184 CTGGTGAAGGCTTCTAGGCTTGG + Intronic
907239154 1:53071086-53071108 CTCCAGAAGCCTTCCTGGGTTGG - Intronic
907559005 1:55371324-55371346 CTGAAGAAAGCTTCCTGTGTTGG - Intergenic
909555789 1:76952359-76952381 TTGGAGAAGGCTCCTTTGGTAGG + Intronic
909906221 1:81198996-81199018 CTAGATAAGGCTTCCTGACTTGG - Intergenic
912528567 1:110303562-110303584 CAAGAGAAAGCTTCCTGGGCTGG + Intergenic
912631044 1:111247126-111247148 CTGGATAAACCATCCTGGGTGGG - Intergenic
913091583 1:115479796-115479818 GTGGGGAAGGCTCCCTGTGTGGG - Intergenic
914577131 1:148983280-148983302 ATTCAGAAGGCTTCCTTGGTTGG - Intronic
914879536 1:151536877-151536899 CTGGAGAAGGACTCCTGGTATGG + Exonic
915103410 1:153516434-153516456 CTGGAGAAGGGGTCCTGGAGTGG - Intergenic
916885138 1:169060122-169060144 ATGGAGAGGACTTCCTGGGGTGG - Intergenic
920390303 1:205595999-205596021 ATGGAAAGGCCTTCCTGGGTAGG + Intronic
921159411 1:212462720-212462742 CTGGGGGAGGCTTGCTGGGGTGG - Intergenic
924038348 1:239958209-239958231 CTGGAGGAGGCTGTGTGGGTTGG - Intergenic
924405695 1:243743334-243743356 CTGGAGAAGACTTCCCTGGAAGG + Intronic
1065974525 10:30830750-30830772 CTGGAGAGGGCTGCATGCGTGGG - Intronic
1067841087 10:49679898-49679920 CTGGGGAAGACTTCCTGGAGAGG - Intronic
1069551456 10:69367211-69367233 CTGGAGAATGCTTCCTAGGCTGG + Intronic
1069694460 10:70376643-70376665 CTGGAGGGGGATGCCTGGGTGGG - Intronic
1069755986 10:70774682-70774704 TTGGAGAAGACTTCCTGGACAGG - Intronic
1069773370 10:70913103-70913125 GTGGAGGAGGCTTTCTGGGAGGG + Intergenic
1069884048 10:71612316-71612338 TTGGAGAAGGTTGCCTAGGTCGG + Intronic
1069909959 10:71752932-71752954 CTTGAGAAAACTTCCTGGGCCGG - Intronic
1070769656 10:79074834-79074856 CTGGGCCAGGCTTCCTGGGGAGG - Intronic
1071566696 10:86674873-86674895 CAGGAGCAGCCTGCCTGGGTGGG - Intronic
1072093768 10:92156184-92156206 CTGGAGAAGGCTTCCTGGAAAGG + Intronic
1073460982 10:103665765-103665787 CTGGAGGAGTCTGCCTGAGTGGG + Intronic
1074039459 10:109773742-109773764 CTAGAGAAGGCGTTCTGGGAAGG - Intergenic
1074403431 10:113161116-113161138 ATGGAGAAGGGTTCTGGGGTAGG + Intronic
1075557549 10:123444385-123444407 CTGGAAAAGTCTTGCTTGGTTGG + Intergenic
1075924026 10:126236015-126236037 CTGGAGAGGGCATCTTGGGCAGG + Intronic
1076879357 10:133232233-133232255 TTGGAAAATGCTTCCTGGGCAGG - Intergenic
1077112607 11:868641-868663 CTGGGGAGGGGGTCCTGGGTCGG - Exonic
1077638595 11:3861008-3861030 CTGCAGAGGGCTTCCTGGAAAGG + Intronic
1077998763 11:7476158-7476180 CTGGAGAAGGCTTGCTGGCCAGG - Intergenic
1079729284 11:23920515-23920537 GTGGTGAATGCTTCCTGGCTTGG + Intergenic
1079932512 11:26582468-26582490 CTGGTGAAAGTTTCCTGGGAAGG + Intronic
1081857401 11:46312496-46312518 CTTCAGAGGGCTTCCTTGGTGGG + Intronic
1083264718 11:61541405-61541427 GGGGAGGGGGCTTCCTGGGTGGG + Intronic
1084582453 11:70032451-70032473 CTGGAGAGGACTCCCTGGGTGGG + Intergenic
1085454245 11:76656773-76656795 GAGGAGATGGCTTCCTGTGTGGG + Intergenic
1086457125 11:86970026-86970048 CTGGAGAAGGCTACTATGGTGGG - Intergenic
1086668362 11:89513948-89513970 CTGGTGAAGGCTTTCTTGTTGGG - Intergenic
1087642045 11:100765385-100765407 CTGGAGCTGGCGCCCTGGGTTGG + Intronic
1087897288 11:103600812-103600834 CTGGAGTTGGCTTCCAAGGTTGG + Intergenic
1088904428 11:114143463-114143485 CTGGGGAAGGCTTCTAGGGATGG + Intronic
1089014153 11:115153225-115153247 GTGGAGAAGGCATCCCGGCTGGG - Intergenic
1089538587 11:119175489-119175511 CTGGGGAAGGCTTGGTGGCTGGG + Intronic
1089598387 11:119597586-119597608 CTGGAGAAGCCTTCGTGAGTGGG + Intergenic
1089691889 11:120192002-120192024 CAAGAGAAAGGTTCCTGGGTGGG + Intergenic
1089904515 11:122024723-122024745 CGGGAGGAGGCTTGCTGGGTAGG - Intergenic
1092121363 12:6046302-6046324 CTTGAGAAAGCTTCTTGGATGGG - Intronic
1093027847 12:14260785-14260807 CTGGAGGAGGCTTGCGGGGGTGG - Intergenic
1094300391 12:28958165-28958187 CTGGACAAAGATTCCAGGGTTGG - Intergenic
1095954824 12:47799932-47799954 GTGGAGAAGCCTTCCTGGAGAGG + Intronic
1096648929 12:53052606-53052628 CTGGGGAACCCCTCCTGGGTGGG + Intronic
1098751187 12:74294242-74294264 CTGGACAGGGGCTCCTGGGTGGG + Intergenic
1099671159 12:85694685-85694707 CTGGAGAAGGAATCCTAAGTTGG - Intergenic
1101398573 12:104369045-104369067 ATGGAGAAGTCTTGCTGGGTCGG + Intergenic
1101702968 12:107192821-107192843 TTGGATCAGGCTACCTGGGTTGG + Intergenic
1102027800 12:109723473-109723495 CAGGAGAAGGGTGGCTGGGTGGG - Intronic
1102806764 12:115788403-115788425 CTGGGGCAGGTATCCTGGGTGGG + Intergenic
1103884952 12:124193418-124193440 TTGGAGAAGGCTTCCTAAGAAGG + Intronic
1103913013 12:124362525-124362547 CTGGGGCAGGCTTTCTGGGGAGG - Intronic
1104930537 12:132337183-132337205 CAGGAGAAGGTTCCCTGGGACGG - Intergenic
1105513942 13:21074722-21074744 CTGGAGAAGTCTGGCTGGGAAGG + Intergenic
1105806979 13:23958310-23958332 CTGGAGAAGATTTGCTTGGTGGG - Intergenic
1106117568 13:26830514-26830536 CTGGCCAAGGCTTCCCGGGAGGG + Intergenic
1110032244 13:70630455-70630477 CTAGAGAAAAATTCCTGGGTTGG + Intergenic
1112586103 13:100720388-100720410 CAGCAGATGGCTTCCTGGGCTGG - Intergenic
1112896588 13:104306742-104306764 CTGGAAAAGGATTCCTGGAATGG - Intergenic
1119420133 14:74503421-74503443 CAGGAGAAGGGTACCTGGGCTGG - Intronic
1119921415 14:78449911-78449933 ATGGAGAAGGATTCCTTAGTGGG - Intronic
1120679490 14:87463249-87463271 CAGTAGAAGACTTCATGGGTGGG - Intergenic
1120755763 14:88242780-88242802 CTGGTGAAGGCTTTGTGGCTTGG - Intronic
1121149068 14:91614267-91614289 CTAGAGAAGACTACCTGGATTGG - Intronic
1121336936 14:93083376-93083398 CTGGGGAGGGCCTCTTGGGTGGG - Intronic
1122283115 14:100635953-100635975 CTGGAGCAGGCACCCTGGGTTGG - Intergenic
1122528001 14:102402921-102402943 CTGGTGAAGGCTTCGTGTCTAGG - Intronic
1124954004 15:34348072-34348094 GTGGAGGTGGCTCCCTGGGTGGG - Exonic
1126141749 15:45444950-45444972 CTTGAAAAGGTTTACTGGGTGGG + Intronic
1126155005 15:45557778-45557800 CTGGTGAAGGGTTGTTGGGTGGG - Intergenic
1126989401 15:54355094-54355116 CTGGTGAAGGCCTTCTTGGTGGG - Intronic
1128228222 15:66017579-66017601 CTGGGGGAGGCATCCTGGGAGGG - Intronic
1128578607 15:68793034-68793056 TTGGAGAAGGCTTCCTGGGAAGG - Intronic
1131028104 15:89162404-89162426 CTGGAAGAGGCTTACTTGGTTGG - Intronic
1131305368 15:91238479-91238501 CTGGAAAAGTCTTCCAGGGGTGG - Intronic
1133025389 16:2986978-2987000 CTGGGGATGGCTTCATGTGTGGG + Intergenic
1133841754 16:9416463-9416485 CTGGGGAAGGCTTCATGGGGAGG + Intergenic
1134086134 16:11358703-11358725 CTGGTGAAGGCTTCCTCTGGTGG + Intergenic
1134219768 16:12344757-12344779 CTGGAGAAGGCTTTCTGTGCTGG + Intronic
1134263750 16:12674923-12674945 CTGGAGAAAGCCTCCTGGGTGGG - Intronic
1134385531 16:13768599-13768621 CTGGATCAGACTGCCTGGGTTGG + Intergenic
1134389283 16:13804329-13804351 GAGGAGAAGACTGCCTGGGTTGG - Intergenic
1135235641 16:20753171-20753193 CTGGAAAAGGCTGGCTGGGTGGG + Intronic
1135913483 16:26582097-26582119 GTGGAGAAGGACTCCGGGGTTGG + Intergenic
1137387442 16:48054852-48054874 CTGGAGAAGGCTTCCAAGGATGG - Intergenic
1138553964 16:57761625-57761647 CTGGAGAAGGCTTCCTGGGTTGG - Intronic
1140235031 16:73151364-73151386 TTGGAGAAGGCTTCCTCGTTGGG + Intergenic
1140869883 16:79096537-79096559 CTAGAGAAGGCTTCCTCCGAAGG - Intronic
1141046859 16:80723188-80723210 CTTGAGATGGCTTCTTGGGGCGG - Intronic
1142105266 16:88299161-88299183 CTGGAGGAGGCAGCTTGGGTGGG + Intergenic
1142303972 16:89275300-89275322 CTGGAGGAGGCCTCCAGGGCAGG - Intronic
1142367196 16:89656921-89656943 CTGGGCAAGGGGTCCTGGGTCGG + Intronic
1142367302 16:89657177-89657199 CGGGAGAAGGGGTCCCGGGTCGG + Intronic
1143597540 17:7924252-7924274 ATGGAGTAGGCCTCCTGGGTTGG + Exonic
1143782662 17:9237562-9237584 CTGCAGAAGGCACCCTGGGCTGG - Intronic
1146541780 17:33702363-33702385 CAGGAGGAGGCTTCCTGTGGAGG + Intronic
1147437058 17:40422983-40423005 TCAGAGAAGGCTCCCTGGGTAGG - Intergenic
1147704961 17:42420172-42420194 TTGGAGAAAGTTTCCTGGGATGG - Intronic
1147788697 17:42999019-42999041 GTGGAGAAGGCTTTATGCGTTGG - Intronic
1147912317 17:43862970-43862992 CTGGAGAAGGGGTCGGGGGTGGG + Exonic
1148204597 17:45771939-45771961 CTGGTGAAGGCTTCCTAGAGGGG + Intergenic
1150641771 17:66954168-66954190 CTTTAGAAGGCTTCCTGGGAGGG - Intergenic
1150648148 17:66992653-66992675 CTGGTGGAGGCTTCCTGAGAAGG + Intronic
1151557077 17:74852013-74852035 CTGTAGAAGGCCTCCCGGGCAGG + Exonic
1151785110 17:76271621-76271643 CTGGAAGATGCTTCCTGGGAGGG - Intergenic
1152046934 17:77942925-77942947 CTGTCAAAGGCTTCCTGGCTGGG + Intergenic
1152134225 17:78494543-78494565 CCGGAGAAGCCTGCCTGGCTGGG - Intronic
1152552949 17:81038881-81038903 TTGGAGTCGCCTTCCTGGGTGGG + Intronic
1152614612 17:81332000-81332022 CTGGAGCAGGTGGCCTGGGTGGG + Intergenic
1156456928 18:37299994-37300016 CTGGAGAAGGATTCCTGGAAGGG - Intronic
1156569736 18:38239655-38239677 CTGGGGCAGGCTCCCTGGGGTGG + Intergenic
1157519375 18:48334852-48334874 TTAGAGAAGGATCCCTGGGTTGG + Intronic
1158367103 18:56748712-56748734 CAGGATAAGACTTCATGGGTAGG - Intronic
1158422202 18:57305075-57305097 ATGGAGAAGTTTTCCTGGGAAGG + Intergenic
1158845518 18:61438351-61438373 GTGGAGAAGGGTTCCTGGAGAGG + Intronic
1159023906 18:63165779-63165801 CTAGAGAAGGCTTGCAGGGGAGG + Intronic
1160978587 19:1806290-1806312 CCGGGGAAGGCTTCCTGAGGGGG - Intronic
1161235606 19:3196588-3196610 CTGGAGGGGGCTTCCTGGGAGGG - Intronic
1161929063 19:7323907-7323929 CTGGACAAGGTTTCCTGGCCAGG + Intergenic
1162439226 19:10682439-10682461 CTCCAGATGGCTTCCCGGGTGGG + Intronic
1162716834 19:12639703-12639725 CTGAAGAAGGCTTCCTGGCTTGG - Intronic
1163197603 19:15733996-15734018 CTGGAGTATGGTTTCTGGGTAGG + Intergenic
1163223883 19:15941004-15941026 CTGGAGTATGGTTTCTGGGTAGG + Intergenic
1164727117 19:30473445-30473467 CTCAAGAAAGCTTCCTGGGGTGG - Intronic
1165900598 19:39167596-39167618 CTGGCCAAGGCTCCCAGGGTTGG - Intronic
1166071926 19:40392997-40393019 CAGGAGCAGCCTTCCTGGGTGGG + Intergenic
1168366437 19:55792052-55792074 ATGGAGAAGGGTGCCTGGGCCGG - Intronic
925266224 2:2568470-2568492 CTGGACAAAGCTACCTGGGTGGG + Intergenic
925412357 2:3647346-3647368 CTGGAGAATGCCTCGGGGGTGGG + Intergenic
927032202 2:19132586-19132608 CTGGAGAAGGTGTCCTGGGCAGG - Intergenic
927308357 2:21599661-21599683 CTGGGGAAGGCTTCCTGGAAGGG - Intergenic
927612394 2:24554612-24554634 CTGGAGCAGGATTTCTGGCTGGG - Intronic
928177807 2:29046869-29046891 ATGGAGAAGGCTTTCCGGGCAGG - Intronic
929928172 2:46232138-46232160 TTAGGGAAGGCTTCCTGGGAGGG - Intergenic
931345684 2:61443884-61443906 ATGGAGGAGGCTTCGTGTGTGGG + Intronic
932758408 2:74424310-74424332 ATGGGGAAGGCTTCCTGGAGAGG - Intronic
932836659 2:75044305-75044327 GAGGAGAGGGCTTCCAGGGTTGG + Intergenic
933249159 2:80009038-80009060 TTGGAGAAGGCATCTTGGGTGGG + Intronic
933607091 2:84394614-84394636 GTGTAGAAGGCTTCCTGTGAAGG - Intergenic
933795382 2:85915312-85915334 CTGGAGGAGGAGTCCTGAGTGGG + Intergenic
933840570 2:86282956-86282978 CAGGCAAAGGCTTTCTGGGTGGG - Intronic
934927320 2:98390765-98390787 CTGGAGCAGGCCTGCTGGGAAGG - Intronic
935420946 2:102868358-102868380 CTTGAGAAGGCCACCTGGGGAGG + Intergenic
935602835 2:104940134-104940156 CTGGAAAAGGCATCCAAGGTGGG + Intergenic
937373838 2:121321774-121321796 CAGGAGTAGGCATACTGGGTGGG - Intergenic
938560856 2:132470752-132470774 CACGGAAAGGCTTCCTGGGTGGG + Intronic
939988380 2:148854748-148854770 CTGGGAAAGGCTGTCTGGGTGGG - Intergenic
940738519 2:157480480-157480502 GTGGTGAATGCTGCCTGGGTTGG - Intronic
940851176 2:158689593-158689615 CTGGAGGGGGATTCCTGGCTGGG - Intergenic
940985223 2:160045773-160045795 TAGGAGATGGCTTGCTGGGTGGG + Intronic
942507738 2:176661347-176661369 CTGGGTAAGGCTTCCTGACTGGG + Intergenic
942590772 2:177544373-177544395 TTGGAAAAGGCTTCCTGGAAAGG - Intergenic
943579522 2:189668614-189668636 CTGGAGAAGGCTTGCAGGTGGGG - Intronic
943731132 2:191305136-191305158 CTAGACAAGGCTTCCCAGGTGGG - Intronic
944379085 2:199086394-199086416 CTTGAGAGGGCTTCTAGGGTGGG - Intergenic
946526652 2:220527908-220527930 CTGGAGGAAGCTTCCTGGGTAGG - Intergenic
947641926 2:231711744-231711766 CTGGAGAAGGGTCTCTGGGGTGG + Intronic
948107715 2:235428413-235428435 CAGGAGAATGCTTCCTTGGTTGG - Intergenic
1169135316 20:3193831-3193853 CCTGGGAAGGCTTCCTGGGGAGG + Intronic
1169498412 20:6135852-6135874 CTGGTGAAGGGGTCCTGGGCAGG + Intergenic
1171207757 20:23294467-23294489 CTGGTGAAGGCATCCGGTGTGGG - Intergenic
1172257842 20:33535545-33535567 CAGGAGAAGGCTTCTTTGTTAGG + Intronic
1172623727 20:36335792-36335814 CTGGAGAAGGCTTCCCAGAGGGG - Intronic
1172788031 20:37482382-37482404 CATGAGGAGGCTGCCTGGGTGGG - Intergenic
1173519304 20:43687131-43687153 ATGGAGGAGGGTTCCTGGGTGGG + Intronic
1174450292 20:50615956-50615978 CTGGCCAAGGCTATCTGGGTGGG + Intronic
1174563710 20:51449273-51449295 CTGCAGAAGGCGTCCCGGGCTGG + Intronic
1175304307 20:57965486-57965508 CTGGAGCAGGCTCACTGGGACGG - Intergenic
1175653718 20:60750823-60750845 CTGGTGAAGGCATCCTGAGATGG + Intergenic
1175701828 20:61144288-61144310 ATGGCGAAGATTTCCTGGGTGGG - Intergenic
1175872661 20:62215833-62215855 ATGGAGGCGCCTTCCTGGGTTGG - Exonic
1176019083 20:62953442-62953464 CTGTAGGAGGCTCCCTGGGCAGG + Intronic
1176027325 20:62992752-62992774 CTGGAGACTGCTGCCTGTGTGGG - Intergenic
1179658953 21:42862623-42862645 CTAGAGCAGGCTTCTGGGGTGGG + Intronic
1180593019 22:16956628-16956650 CAGGAGAAGGCCACCTGTGTGGG - Intergenic
1181535674 22:23541987-23542009 CTGGAGAGGGCAACCGGGGTGGG - Intergenic
1181661288 22:24351064-24351086 GTGGAGAAGGCCTCGAGGGTTGG - Intronic
1182061999 22:27405058-27405080 CTGCAGAGGGGTTCCTGGGTTGG + Intergenic
1183020545 22:35022902-35022924 CTGGAGGATGCTTGCTGTGTGGG - Intergenic
1183330127 22:37214969-37214991 CTGGAGAAGGCTGCCAGAGCAGG - Intergenic
1183374409 22:37454619-37454641 CGGGGGTAGGCGTCCTGGGTTGG - Intergenic
1183740808 22:39667431-39667453 GGGGAGAGGGCTTCCTGAGTAGG + Intronic
1184207549 22:43014799-43014821 CTGGAGAAGACATCTTGGGGAGG - Intronic
1185263836 22:49886978-49887000 CTGAAGAAGGCGTCCTGGCCGGG + Exonic
950364448 3:12473169-12473191 CTGGAGGCCACTTCCTGGGTGGG - Intergenic
953032835 3:39189315-39189337 TTGGAGAAGGATTCCTTGGGTGG + Exonic
953434156 3:42865427-42865449 CTGGAGAAGGCATACAGGATGGG - Exonic
957529984 3:81428648-81428670 TTGGGGAAGAATTCCTGGGTGGG - Intergenic
957822928 3:85401424-85401446 CTGCAGATGGCTTGGTGGGTGGG + Intronic
957970575 3:87376584-87376606 CTGGATAAAGCTTCATGGGCAGG + Intergenic
960589276 3:119349855-119349877 CAGGAGAATGCTTTCTGGGCAGG + Intronic
961013323 3:123449549-123449571 CGGGAGAAGCCTGCCTGCGTCGG - Exonic
961714751 3:128850538-128850560 CTGGACAAGGCCTCCAGGCTGGG + Intergenic
961804486 3:129479543-129479565 CTGGCCTAGGCTGCCTGGGTGGG + Intronic
962006232 3:131352619-131352641 CTGGAGAATTATTCCTGGCTGGG + Intergenic
962111731 3:132457777-132457799 CTGGAAAGGCCTTCCTGGGTGGG + Intronic
964672237 3:159239364-159239386 TTGCAGAAAGCTTGCTGGGTGGG - Intronic
966920080 3:184605335-184605357 CTGAAGAAGGCCTAGTGGGTGGG + Intronic
967153494 3:186671385-186671407 CTGGTGAAGGCATCATGAGTAGG + Intronic
969136060 4:5029712-5029734 CTGGAGATGGGCGCCTGGGTGGG - Intergenic
969150245 4:5163149-5163171 CAGGAGAAGGCTTGCAGGGAAGG + Intronic
969541969 4:7797531-7797553 CTGTAGAAGGCTCCCAGGTTTGG - Intronic
969588885 4:8109999-8110021 CAGGTGAAGGCTTTCTGGGCTGG + Intronic
969684669 4:8664512-8664534 CTGAAGAAGACCTCCTGGGAAGG + Intergenic
969927335 4:10597249-10597271 CTGGCCAAGCCTTCCTGGGGTGG - Intronic
970685002 4:18557101-18557123 CTGGAAAAGGCTTCATGGAGGGG + Intergenic
972646554 4:40973422-40973444 ATGGGGAAGGCTTCTAGGGTTGG - Intronic
973827515 4:54723383-54723405 CTGGGAAAGCCTTTCTGGGTTGG + Intronic
974850771 4:67402974-67402996 CAGGAAATGGGTTCCTGGGTAGG + Intergenic
977666223 4:99649887-99649909 CTGGGGCAGGCATGCTGGGTGGG + Exonic
979295685 4:119030654-119030676 CTGGAGAAGGCGTCAGGGGGAGG - Exonic
981175038 4:141671880-141671902 CTGGAGAAGGGTGCATGGGATGG + Intronic
982209790 4:153025032-153025054 CAGGAGAAGGCTCCATGGGTGGG + Intergenic
983938749 4:173521285-173521307 ATGGAGAAGGTGTCCAGGGTGGG + Intergenic
984747539 4:183237512-183237534 CTGGAGAAGGCTACCTGAACAGG - Intronic
987255699 5:16148565-16148587 CTGGAGAAGGATCCATAGGTCGG - Intronic
991602690 5:68369302-68369324 CAGGAGAAGGATTCCTTGGAGGG - Intergenic
994066140 5:95544864-95544886 CTGGAGAAGGCTTCCCTGAAGGG + Intronic
994966608 5:106680528-106680550 TTGGAGAAAGCTTCCTGGTGTGG - Intergenic
995313468 5:110739345-110739367 CTGGAAAAGGGTTCCTCCGTGGG - Exonic
996524415 5:124462893-124462915 CAGGAGAAGGCTTCCTTGGCTGG - Intergenic
997335815 5:133108492-133108514 ATTGAGAAGTTTTCCTGGGTGGG + Intergenic
999302344 5:150498987-150499009 CTGGGGAAGGAATCCTGGATAGG - Intronic
999330218 5:150668708-150668730 CTGCAAAAGGCTTCCTTTGTTGG + Intronic
999402742 5:151279180-151279202 CTGGAGAGGACTCCCTGGCTCGG + Intronic
999710688 5:154315716-154315738 CTGAAGAAGGAGTCCTGGGTGGG - Intronic
1001451754 5:171831149-171831171 CTGGACAAGGCTTCCAGGGAAGG + Intergenic
1001565589 5:172697321-172697343 CTGGAGGAGCCCTCCAGGGTGGG + Intergenic
1002787042 6:409930-409952 CTGGAAAATGCTTCTTGGCTGGG + Exonic
1002880932 6:1251708-1251730 CTGGGCAAGGCTTCTGGGGTAGG - Intergenic
1002885566 6:1290592-1290614 CTGTAGGAGGCTACCTGGGTGGG - Intergenic
1003330074 6:5122421-5122443 CTGGAAAGGGCTTCCAGAGTAGG + Intronic
1004043135 6:12002127-12002149 CTGGAGAAAGCTTCTTATGTTGG + Intergenic
1006626540 6:35401949-35401971 ATGGAGAGGGCTTCCAGGGTAGG - Intronic
1008035641 6:46742302-46742324 CTGGACAAGGGCTCCTTGGTGGG + Intergenic
1008119493 6:47595913-47595935 GTGGAGTAGGTTTCTTGGGTGGG - Exonic
1010245178 6:73655592-73655614 CTGGAGAAGTCTCCCTTGCTTGG - Intergenic
1011552762 6:88544964-88544986 CTGGGGAATGCTTCCTGGAAGGG + Intergenic
1012944580 6:105451781-105451803 CTGGAATAGGCTCCCTGGGAAGG - Intergenic
1012983398 6:105852985-105853007 CAGGAGAAGGCTTCTTTGTTAGG + Intergenic
1013377107 6:109528108-109528130 CTGGAGAAGGGATACTGCGTAGG + Intronic
1014884877 6:126767621-126767643 GTGGAGAAGGACTCCTTGGTAGG - Intergenic
1015506166 6:133991163-133991185 CTGGAGAAAGCTGCCTGGATTGG + Exonic
1016506076 6:144780943-144780965 CTGGAAAAGGCTCCCTGGAGAGG - Intronic
1016761616 6:147743945-147743967 CTTGAAATGGCTTTCTGGGTGGG + Intergenic
1017850617 6:158302380-158302402 CAGGGGCAGGCATCCTGGGTTGG + Intronic
1019290791 7:249112-249134 CTGGAGAAGGCTTCCTGGAGAGG - Intronic
1019993346 7:4707594-4707616 CTGGAGAAGGCTGCCTCACTGGG + Intronic
1020573042 7:9890396-9890418 CTGGTGAATACTTCCTGGCTTGG - Intergenic
1021807465 7:24371423-24371445 CTGGAGGAGGGTTATTGGGTAGG + Intergenic
1023868712 7:44251513-44251535 CTGGAGAGCCCCTCCTGGGTTGG - Intronic
1024257924 7:47552229-47552251 CTCTAGACGGCTTCCTGGCTTGG - Intronic
1024653778 7:51431849-51431871 CTTGAAAAGGCTTCCAGGGCTGG + Intergenic
1024724885 7:52181851-52181873 GTGGAGAAGGCTTCCTTGTTAGG + Intergenic
1026349105 7:69500098-69500120 CTGCAGAAGGTTTCCTGGGAAGG - Intergenic
1026361437 7:69604541-69604563 TTCCAGAAGGCTTCATGGGTGGG + Intronic
1026772640 7:73212095-73212117 CTGGAGGGGTCCTCCTGGGTGGG - Intergenic
1027013504 7:74765495-74765517 CTGGAGGGGTCCTCCTGGGTGGG - Intergenic
1027074534 7:75180538-75180560 CTGGAGGGGTCCTCCTGGGTGGG + Intergenic
1029155640 7:98515699-98515721 CTGCAGATGGCTCCCTGTGTAGG - Intergenic
1030523553 7:110627655-110627677 ATGGAGAGAGCTTCCAGGGTTGG + Intergenic
1032082207 7:128865300-128865322 TCGGAGAGGGCTGCCTGGGTAGG + Intronic
1032580490 7:133098975-133098997 CTGGAGTAGATTTCCTGGATGGG + Intergenic
1032665706 7:134034172-134034194 CTGGAGAAAGTTCTCTGGGTGGG + Intronic
1034416918 7:150970216-150970238 CCAGAGGTGGCTTCCTGGGTGGG - Intronic
1035312891 7:157981274-157981296 ATGGAGAAGGCTTCCATAGTCGG + Intronic
1035396190 7:158536597-158536619 CTGGTGATGGCTGCCTGGGAAGG - Intronic
1036292126 8:7503141-7503163 CTGGAGAGGGCAACCCGGGTTGG + Intronic
1036723144 8:11196739-11196761 CTGAAGAAGACTCCCTGGGGAGG - Intronic
1043471194 8:80565038-80565060 CTGGGGTAGGCTGCCTGCGTTGG - Intergenic
1044000741 8:86877553-86877575 TTGGAGAAGGCTTCCTCTTTTGG + Intronic
1044838995 8:96322215-96322237 CCAGAGAGGGCTGCCTGGGTAGG - Intronic
1045384372 8:101657280-101657302 CTGGAGAAGGCTGGCTGAATTGG + Intronic
1047322369 8:123799290-123799312 CTGGAGAAGACTGCCTAGTTTGG - Intronic
1050349783 9:4729598-4729620 CTTGAGCAGTCTTCCTGTGTTGG - Intronic
1051366854 9:16327433-16327455 CTGGGGAAGGCTTCCATGGAGGG - Intergenic
1051665516 9:19464363-19464385 GTGAGGAAGGCTTCCTGGATTGG + Intergenic
1052831576 9:33220461-33220483 CTGGAGACAGATTCCTTGGTTGG - Intronic
1053296387 9:36917219-36917241 CAGGAGAAGGCTTCTTTGTTAGG - Intronic
1056577597 9:87868336-87868358 CAGGAGAAGGCTTCCCTGGAAGG - Intergenic
1056588383 9:87944284-87944306 CTGGAGATGGCTTGCAGGGAGGG + Intergenic
1058781072 9:108336042-108336064 CTGGAGAAGAGTTCCTGGGCTGG - Intergenic
1061159557 9:128885343-128885365 CTGGAGAAGGCTTGCGGGCTCGG - Intronic
1062125974 9:134863349-134863371 GTGGAGACGGCCTCCTGAGTAGG - Intergenic
1062351723 9:136142885-136142907 CTCGGGAAGGATCCCTGGGTGGG + Intergenic
1062518056 9:136945868-136945890 CTGGACTAGGATTCCTGGTTGGG + Intronic
1185768453 X:2746115-2746137 CTCGAGAAGTCATCCTGTGTGGG - Intergenic
1186479606 X:9886216-9886238 GTGCAGAAGGCATCTTGGGTGGG - Intronic
1186995272 X:15114820-15114842 CTGAAGAAAGCATCCTGGGCAGG - Intergenic
1187487195 X:19715833-19715855 CTGGAAATGTGTTCCTGGGTTGG + Intronic
1190929358 X:54934840-54934862 CTGCAGGAGGTTTCCTGGGTGGG - Intronic
1191216394 X:57935828-57935850 CTCTAGACTGCTTCCTGGGTAGG + Intergenic
1192497733 X:71627256-71627278 CTGGAGCAGGCTGTCTGGATTGG + Intergenic
1195711750 X:107778548-107778570 CAGGAGAAGGCTGACTGGGCAGG + Intronic
1197220395 X:123906674-123906696 TTGGAGAAGGCTTCACAGGTTGG - Intronic
1198034081 X:132783722-132783744 CTGGAGAGGGCTTCCTGAGGCGG - Intronic
1198296094 X:135288170-135288192 CAACAGAAGGCTGCCTGGGTAGG + Intronic
1200154585 X:153968773-153968795 CTGGAGCAGGCTCCCTGGCAGGG - Intronic
1200240131 X:154489020-154489042 CCTGAGAAGGGTTCATGGGTGGG + Exonic
1200861312 Y:7995739-7995761 CTGGGGCAGGCATGCTGGGTTGG + Intergenic