ID: 1138555731

View in Genome Browser
Species Human (GRCh38)
Location 16:57770308-57770330
Sequence CTGAGTCCCCACTGTGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 277}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138555726_1138555731 9 Left 1138555726 16:57770276-57770298 CCGTGGGCACAAAGCTTCTTGGG 0: 1
1: 0
2: 2
3: 13
4: 139
Right 1138555731 16:57770308-57770330 CTGAGTCCCCACTGTGAGGTGGG 0: 1
1: 0
2: 0
3: 32
4: 277
1138555724_1138555731 22 Left 1138555724 16:57770263-57770285 CCTGTGTGCTGGGCCGTGGGCAC 0: 1
1: 0
2: 0
3: 48
4: 290
Right 1138555731 16:57770308-57770330 CTGAGTCCCCACTGTGAGGTGGG 0: 1
1: 0
2: 0
3: 32
4: 277

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138555731 Original CRISPR CTGAGTCCCCACTGTGAGGT GGG Intronic
900127597 1:1075437-1075459 CTGGGTCCCTACTGAGGGGTCGG - Intergenic
900311041 1:2033259-2033281 CTGAGTGCCCTCTGAGAGTTGGG + Intergenic
900578506 1:3395931-3395953 CTGTGTGCCCACTGTCAGCTTGG - Intronic
901024527 1:6272074-6272096 CTGAGTGCCCACTGTGGGCTAGG + Intronic
901653310 1:10755396-10755418 CTGAGTGCCCACAGTGAGAGAGG - Intronic
901807209 1:11746057-11746079 CTGAGGCCTCACTGTGGGGCAGG - Intronic
902256000 1:15188997-15189019 CTGAGTGCCCTCTATGAGCTGGG - Intronic
902820729 1:18941738-18941760 CTGAGGTCTCACTATGAGGTAGG - Intronic
903230976 1:21922206-21922228 CTGAGCCTCCTCTGTCAGGTGGG - Intronic
903543178 1:24108190-24108212 CTGAGACCCCAGTATGAGGAGGG - Intronic
903601035 1:24540507-24540529 CTCAGTCCCCAATTTGAGTTAGG - Exonic
903658219 1:24961683-24961705 CTGATTCCGCAGTCTGAGGTAGG + Intronic
903708917 1:25307257-25307279 CTGAGGTCTCACTGCGAGGTGGG + Intronic
903718202 1:25385161-25385183 CTGAGGTCTCACTGTGAGGTGGG - Intronic
904305191 1:29584388-29584410 ATGAGTCCCCACTGGGTGCTGGG + Intergenic
904768492 1:32868444-32868466 CTTTGTCACCACTGGGAGGTGGG - Intronic
905249221 1:36637362-36637384 TTGAGCCCCTACTGTGTGGTAGG + Intergenic
905903461 1:41597666-41597688 CTGTGTCCTCTCTGTGAGGCTGG - Intronic
906545987 1:46619833-46619855 CAGAGTTCCCACTGCGAGGGGGG - Intergenic
908185306 1:61646984-61647006 CTGAGTGCCTACTTTGAGCTAGG + Intergenic
908435114 1:64098254-64098276 CTGAGTCCCCACCCAGAGGTAGG + Intronic
911252803 1:95597285-95597307 CTGAATGCCTACTATGAGGTAGG + Intergenic
912380751 1:109247038-109247060 CAGAGCCTCCACTGTGAAGTGGG + Intergenic
914984287 1:152442837-152442859 CTGAGCCCCCACTGTATGGGAGG - Intergenic
915849960 1:159310777-159310799 CTGAGTCTCCACTCTGAAGGTGG - Intergenic
916242340 1:162652638-162652660 CTGAGTACCCACTATGTGGTAGG + Intronic
917533106 1:175854754-175854776 CTGACTTCCCTCTGTGAGCTGGG - Intergenic
917962986 1:180159054-180159076 CTGAGCCCCCACTGGGGGCTTGG - Intronic
920986834 1:210898586-210898608 CTGAGCACCCACTGTGAGCCAGG + Intronic
922882637 1:228992563-228992585 CTGAGGCTGCACTGTCAGGTGGG + Intergenic
922953357 1:229578077-229578099 TTGAGTCCCCACTATGAGCAAGG + Intergenic
923986538 1:239387742-239387764 TTGCGGCCCCACTGCGAGGTTGG - Intronic
1062809643 10:452930-452952 CTGAGGCCCCAGTGCGAGGAAGG + Intronic
1062918193 10:1258007-1258029 CAGGGTCCCCACTGTGTGGATGG - Intronic
1064162306 10:12957103-12957125 CTGAGTCTCCACAGAAAGGTGGG + Intronic
1067234267 10:44435206-44435228 CTGATTCCCCACTTGGGGGTAGG - Intergenic
1067445118 10:46337080-46337102 CTGGGGCCGCACTGTGAGGTGGG + Intergenic
1067450197 10:46377317-46377339 CTGAGTCCCTACTCTGTGGCCGG + Intronic
1067587045 10:47482446-47482468 CTGAGTCCCTACTCTGTGGCCGG - Intronic
1067592253 10:47523648-47523670 CCGGGGCCGCACTGTGAGGTGGG - Intronic
1067634105 10:47990213-47990235 CTGAGTCCCTACTCTGTGGCCGG - Intergenic
1067639370 10:48031721-48031743 CCGGGGCCGCACTGTGAGGTGGG - Intergenic
1067714390 10:48678085-48678107 CAGAGTCTCCACTTTGAGGAAGG - Intergenic
1069869439 10:71524246-71524268 CTGAGTCCCCACCGTGCGCCAGG - Intronic
1073193375 10:101668225-101668247 CTGATTCCCCAGTGTAAAGTTGG - Intronic
1076855932 10:133115641-133115663 CTGAGTCCCCACAGTGCCGGCGG - Intronic
1076898985 10:133327869-133327891 CTGAGTCCCCACAGTGGGTGGGG + Intronic
1078600663 11:12727476-12727498 CTCAGTCCCCACTGTGGGATGGG - Intronic
1080888823 11:36390821-36390843 CTGACTGCCAACTGTGAGGCGGG - Intronic
1081723106 11:45304445-45304467 CTGAGTCCCACATGTGAAGTCGG - Intergenic
1082082723 11:48024882-48024904 CTGATTCCCTACTGTGTGGCAGG - Intronic
1083468427 11:62865015-62865037 GTAAGTCCCCACTGTAATGTGGG + Intronic
1083620075 11:64044882-64044904 CTGAGGCCCCACTGTGTGCTGGG + Intronic
1084612150 11:70210071-70210093 CTGAGGCCCCACTGGGAGTGGGG - Intergenic
1087711237 11:101555065-101555087 CTGAGCCCTCACTCTGTGGTAGG + Intronic
1089324543 11:117648166-117648188 CTGAGGCCCCCCTCTGAGATGGG - Intronic
1089392010 11:118108623-118108645 CTGAGTACCTACTGTGTGCTGGG - Intronic
1090393177 11:126402693-126402715 CTGAGTACTCACTGTGTGTTAGG + Intronic
1091557506 12:1585644-1585666 TTGACACCCCACTGTGTGGTAGG + Intronic
1091693359 12:2611749-2611771 CTGACTGCCCACGGAGAGGTGGG + Intronic
1091731149 12:2881503-2881525 CTGAGTGCCTACTGTGTGCTAGG - Intronic
1092905101 12:13093739-13093761 CTATGTCCCCACTGTGAGGCAGG - Intronic
1093670296 12:21866394-21866416 CTGAGTCAAATCTGTGAGGTTGG - Intronic
1095876620 12:47086007-47086029 CTGAGCGCCCACTGTGTGCTAGG + Intronic
1097220722 12:57449442-57449464 CTGAGTAGCCAAGGTGAGGTTGG - Exonic
1101402626 12:104401645-104401667 CAGTGTCCCCACTGTTAGGGAGG + Intergenic
1101551610 12:105767755-105767777 CTGAGCACCCACTGTGATCTGGG - Intergenic
1101735183 12:107458191-107458213 CTGAGTGCCTACTGTGTGCTAGG + Intronic
1103235492 12:119369047-119369069 CTGAGACCTCACTGTGTGGTTGG - Intronic
1104760681 12:131296098-131296120 CTGAGTCCTCCCTTTGAGGCAGG + Intergenic
1104819094 12:131664694-131664716 CTGAGTCCTCCCTTTGAGGCAGG - Intergenic
1105291738 13:19057850-19057872 CTGTGTGCCCACTGTGTGCTGGG - Intergenic
1106130340 13:26934296-26934318 CTTATTCCCCACTGTGGCGTTGG + Intergenic
1106569255 13:30912047-30912069 CTGAGTACCTACTGTGTGCTGGG - Intronic
1107564596 13:41589113-41589135 CTGAGTCGCCACTGAGAGCTGGG - Intronic
1107817391 13:44256364-44256386 CTAACCACCCACTGTGAGGTTGG - Intergenic
1107899286 13:44996010-44996032 CTGAGTACCCACTTTGTGCTGGG - Intronic
1110795344 13:79630598-79630620 CTGAGTACCCACTGTGTGTCCGG - Intergenic
1115707440 14:36013523-36013545 CTGAGCCTCCACTGTTAGGAAGG - Intergenic
1118038484 14:61892963-61892985 CTGAGTCACCACACTGAGGAAGG - Intergenic
1118572528 14:67207847-67207869 CTGATTCCCCAGTCTGAGTTTGG - Intronic
1119331226 14:73795484-73795506 CTTCCTCCCCACTGTGCGGTGGG - Intergenic
1119750193 14:77071912-77071934 CTCACTCTCCACTGTGAGGATGG + Intergenic
1120286309 14:82506111-82506133 CTGAGTCCCAACTATGAGTCAGG - Intergenic
1121310527 14:92933015-92933037 CTGGGTGCCCCCTGTGAGCTGGG - Intronic
1121595501 14:95158620-95158642 CTGTGTGCACCCTGTGAGGTAGG + Intergenic
1121595505 14:95158651-95158673 CTGTGTGCACATTGTGAGGTAGG + Intergenic
1122137535 14:99643601-99643623 CTGAGTCCCAGCTGGGAAGTAGG + Intergenic
1122406701 14:101505184-101505206 CTGAGTTCCCAAAGTAAGGTAGG - Intergenic
1122627751 14:103092813-103092835 CTGGGTTCCCTCTGTGAAGTGGG - Intergenic
1122799976 14:104224638-104224660 GGGAGCCCCCACTGTGAAGTGGG - Intergenic
1123136334 14:106030886-106030908 CTAAGTCCCCACTGCTAAGTGGG + Intergenic
1124491017 15:30155576-30155598 CTGAGTGCCCACTGTGTGCTTGG - Intergenic
1124752520 15:32382755-32382777 CTGAGTGCCCACTGTGTGCTTGG + Intergenic
1124961999 15:34405634-34405656 CTGTGTTCCCACAGTTAGGTGGG + Intronic
1124978622 15:34551855-34551877 CTGTGTTCCCACAGTTAGGTGGG + Intronic
1125633730 15:41169877-41169899 CTGTGTCCCCACTCAGGGGTTGG + Intergenic
1125768814 15:42151945-42151967 CTGAGTGCTCACTCTGAGGCAGG - Intronic
1127028994 15:54840773-54840795 CTGTGTTCCCAGTGTGAGCTAGG - Intergenic
1127402856 15:58608040-58608062 CTGAGTGCCTACTGTGTGTTTGG - Intronic
1128628344 15:69235479-69235501 ATGAGTGCCTACTGTGTGGTAGG + Intronic
1128708136 15:69852199-69852221 CAGAGTACCTACTGTAAGGTTGG - Intergenic
1128734183 15:70043215-70043237 CTGAGAGCCCACTGTGTGGTGGG + Intergenic
1128946629 15:71827386-71827408 TTGTGCCCCCACTGTGAGGTGGG - Intronic
1129230386 15:74193997-74194019 CTCAGGGCCCAGTGTGAGGTGGG - Intronic
1129890428 15:79068144-79068166 CTCAGCCCCCTCTGTGAAGTGGG - Intronic
1130353252 15:83109015-83109037 CTGAGTGCCTACTGTGTGTTTGG + Intronic
1132615601 16:839911-839933 CACAGTCCCCACTGTGAACTGGG + Intergenic
1133565555 16:6990137-6990159 CTGAATCCCTACTGTGTGTTGGG - Intronic
1134017370 16:10898559-10898581 TTGAGTCCCCACTGTGTGCCAGG + Intronic
1135177931 16:20247653-20247675 CTGGGTCCACACTGGAAGGTGGG - Intergenic
1135185755 16:20314455-20314477 CTGAGTGCCCACTGTGTGCCAGG - Intronic
1135841977 16:25885225-25885247 CTGAATCCCAGCTGTGATGTAGG - Intronic
1137598163 16:49738497-49738519 CCGCCTCCCCACTGTGAGGTTGG - Intronic
1137818795 16:51424063-51424085 CTGAGTACTTACTGTGTGGTAGG - Intergenic
1138079629 16:54077643-54077665 CTGAGTCCCCTCAGTCAGGCAGG + Intronic
1138555731 16:57770308-57770330 CTGAGTCCCCACTGTGAGGTGGG + Intronic
1138584589 16:57961733-57961755 CTGAGTCCTCACTCTGTGGCAGG + Intronic
1138728970 16:59173685-59173707 CTGTTTCCCCACTGTGAGCTGGG - Intergenic
1139465338 16:67151063-67151085 ATTAGTCCCCACTCTGAGGCCGG - Exonic
1140790000 16:78382404-78382426 CTGAGTGGCCACGGTGAGCTGGG + Intronic
1140792839 16:78408774-78408796 CTGAGTCACCTTTGGGAGGTAGG + Intronic
1141127132 16:81408766-81408788 CTGTGTCCCCTCTGTGACCTTGG - Intergenic
1142993986 17:3750372-3750394 CAGAGTGCCCACGGTGATGTCGG + Exonic
1143105819 17:4530169-4530191 CTGAGGGCCCAGTGTGAAGTGGG - Intronic
1143490504 17:7282885-7282907 CTGAGTGTCCTCTGTGAGATGGG - Intronic
1144372485 17:14605427-14605449 CTGAGTCCCCAAAGAGAAGTGGG - Intergenic
1144865492 17:18332861-18332883 CTGAGGCTCAACTGAGAGGTTGG - Intronic
1144967732 17:19088812-19088834 CAGGGTCCCGAGTGTGAGGTGGG + Intergenic
1144980184 17:19163251-19163273 CAGGGTCCCGAGTGTGAGGTGGG - Intergenic
1144988038 17:19214981-19215003 CAGGGTCCCGAGTGTGAGGTGGG + Intergenic
1146651939 17:34612462-34612484 CAGAGCCCCCACTCAGAGGTAGG + Intronic
1147613771 17:41816641-41816663 CTTTGTCTCCCCTGTGAGGTGGG - Intronic
1148347518 17:46913285-46913307 CTCAGTGCCCGGTGTGAGGTAGG - Intergenic
1150246172 17:63677063-63677085 CGGAGTTCCTACTGTGAGATGGG + Intronic
1150493300 17:65589071-65589093 CAGGGTTCCCACAGTGAGGTGGG - Intronic
1152028225 17:77825382-77825404 CTGAGTCCCTGCTGTGGGTTAGG + Intergenic
1152507741 17:80762352-80762374 CTGAGTCCCCACTGGGGGCTGGG + Intronic
1153915761 18:9742688-9742710 CTGAGTGCCCTCTTTGATGTGGG + Intronic
1154477387 18:14776218-14776240 CTGAGTACCAACTGTGTGCTAGG + Intronic
1155991595 18:32284583-32284605 ATGAGTCCCCACTGTGTGCCAGG + Intronic
1157194220 18:45607449-45607471 CTGAGTACCAACTATGTGGTAGG - Intronic
1160236516 18:77090109-77090131 CTGAGGCCCCTCTGACAGGTGGG - Intronic
1162269792 19:9604834-9604856 CTGAGTCCCTACTTTCAGGTGGG + Intronic
1162624593 19:11874511-11874533 CTGTGTCCACACTGTGGGGAGGG + Intronic
1162629687 19:11917345-11917367 CTGTGTCCACACTGTGGGGAGGG + Intergenic
1162634741 19:11958576-11958598 CTGTGTCCACACTGTGGGGAGGG + Intronic
1164979601 19:32603900-32603922 CTGTGTTCACACTGTGAGGATGG + Intronic
1165788318 19:38475543-38475565 GGGAGTCCCCAGTGTAAGGTGGG - Intronic
1166364803 19:42272960-42272982 CTGGGTACTCACTGTGAGGAGGG + Intronic
1167194677 19:48019946-48019968 CTGAAACCCCACTGTGAGCCAGG + Intronic
1167286078 19:48599587-48599609 CTGACTCCCCAGTCTGAGGGAGG + Intergenic
1168412482 19:56148336-56148358 CTGAGTCCCCAGTGGCAGGAGGG + Intronic
925218722 2:2120878-2120900 TTGAGTGCGCACTGTGTGGTGGG + Intronic
925409683 2:3632805-3632827 CTGAGTCCCCACTTGGAGAGGGG + Intronic
925609123 2:5689928-5689950 CTGAATCCCCCCTGTCATGTAGG - Intergenic
926140850 2:10367014-10367036 CTGAGATCCCACAGTGAGGCTGG + Intronic
931846943 2:66213751-66213773 CTCAGTCACCACAGTGAGGTAGG - Intergenic
931994677 2:67828626-67828648 TTGAGTCCTCACTGTGTGCTAGG + Intergenic
937156256 2:119721572-119721594 CTGAGACCCCACCTTGTGGTTGG + Intergenic
937379931 2:121367416-121367438 CTGAATCCCTACTGTGCGCTTGG - Intronic
940135134 2:150426893-150426915 CTGACTCCCCACTGTGTGCCAGG - Intergenic
940733292 2:157419494-157419516 CTCAGTCCCCTCTGTGGGATAGG - Intronic
941463980 2:165803317-165803339 CTTACTCCCCACTTTGAGCTGGG + Intergenic
941656722 2:168152235-168152257 CTGGATCCCCAATGTGGGGTGGG + Intronic
941921745 2:170857804-170857826 CTGAGTACCCACTGTGTGCCAGG + Intronic
942158610 2:173158203-173158225 TTGAGTACCTACTGTGAGCTAGG - Intronic
944512469 2:200478001-200478023 CTCAGTCCCGGCTGTGACGTTGG + Exonic
944581699 2:201137666-201137688 CTGGATGCCCACTATGAGGTAGG + Intronic
946366519 2:219252453-219252475 CAGATTCCCCACTGAGAAGTGGG - Intronic
946581708 2:221135266-221135288 CTGAGTACCCACTTTGATATTGG - Intergenic
947714783 2:232334038-232334060 CTGAGCACCCACTGTGGGGGTGG - Intronic
948706720 2:239798540-239798562 CTGAGTGCCCGCTGTGTGGCAGG - Intronic
949059675 2:241949580-241949602 CTCCGTCCCCCTTGTGAGGTGGG - Intergenic
1168925794 20:1577912-1577934 CTGAGACCCCACTGTGTGCCAGG - Intronic
1168929672 20:1610931-1610953 CTGAGACCCCACTGTGTGCCAGG - Intronic
1169111422 20:3036637-3036659 CTGAGTGCCTACTCTGAGGCAGG - Intronic
1170177366 20:13487247-13487269 TTGAGTCCCTACTCTGTGGTAGG + Intronic
1171302560 20:24076417-24076439 CTGAGTCCCCTCTCTGAGGCTGG + Intergenic
1171408979 20:24933533-24933555 CAGAGCCCCCACTGGGAGGGAGG - Intergenic
1171769703 20:29313242-29313264 CTCGGTCCTCACTGTGGGGTTGG - Intergenic
1172093211 20:32447907-32447929 CCTAGTGCCCACTGTGAGTTGGG + Intronic
1172125517 20:32623125-32623147 CTCAGTCCCCATTGACAGGTGGG + Intergenic
1172755259 20:37279448-37279470 CTGATTCCCCACCGAGAGATGGG - Intergenic
1181185384 22:21099691-21099713 CTGAGTGCCTACTGTGTGGCAGG + Intergenic
1181473668 22:23155956-23155978 CTGTGTCCCAGCTGTGAGGTGGG - Exonic
1181918608 22:26301348-26301370 CCGAGCGCCCACTGTGTGGTAGG + Intronic
1183036291 22:35143269-35143291 CTGAGTCACCACTTGGAGGAGGG + Intergenic
1183142838 22:35960260-35960282 CTCAAACCACACTGTGAGGTTGG + Intronic
1183211105 22:36451957-36451979 GTGTGTCCCCAGTGTGTGGTCGG - Intergenic
1183364866 22:37401555-37401577 CTGAGGGCCCACTGTGTGATTGG - Intronic
1183392236 22:37552257-37552279 CTTTGTTCTCACTGTGAGGTGGG - Intergenic
1183669513 22:39264266-39264288 CTGAGGGCCCACTGTGTGCTGGG + Intergenic
1183706587 22:39478320-39478342 CTGAGTGCCCACTGGGTGTTGGG + Intronic
1184091251 22:42294129-42294151 AGGATTCCCCACTGTGAGGCTGG - Intronic
1184093508 22:42304469-42304491 CTGAGTCCTCTCAGTGAGTTGGG - Intronic
1184291086 22:43498513-43498535 CTGAGTGCCCACTGAGAGCAGGG + Intronic
1184839717 22:47045673-47045695 CTGAGGCCCTACTGTGTGCTAGG + Intronic
1185370332 22:50457935-50457957 CTGCGTCCTCACTGTGAGCTGGG - Intronic
1185382571 22:50516897-50516919 CAGAGGCCCCACCGTGAGGGTGG - Intronic
949884359 3:8681802-8681824 CTCAGTCCCCACCCTGCGGTGGG - Intronic
949894901 3:8761705-8761727 CTGAGTGCCCACTGTGAGCAAGG - Intronic
950055611 3:10021887-10021909 CTGAGTGCCCACTGTGTGCCTGG - Intergenic
950159564 3:10750061-10750083 CTGAGTGCCCACTGTAAGCCAGG + Intergenic
950186568 3:10949143-10949165 CTGAGTACCTACTGTGTGCTGGG - Intergenic
953140686 3:40226767-40226789 CTGAGTGCTCACTGTGTGCTAGG - Intronic
953215273 3:40912484-40912506 CTATGGCCGCACTGTGAGGTGGG + Intergenic
953896626 3:46808219-46808241 CTGAGTACCCACAGGGAGGAGGG - Intronic
954640206 3:52093298-52093320 CTGAGCCCACTCTGTGTGGTGGG - Intronic
954758401 3:52855976-52855998 TTCGGTCCCCACTGTGGGGTTGG - Intronic
954943253 3:54394031-54394053 CAGAGTTACCACTATGAGGTAGG + Intronic
955106897 3:55907072-55907094 CTGATTCACCACTGTGTGCTAGG - Intronic
955325328 3:58005824-58005846 CTGAGTCCCTATTGTGAGCCAGG + Intergenic
955924948 3:63995575-63995597 CTGACTCCACATTGTGATGTCGG - Exonic
955941774 3:64152748-64152770 CATAGTCCCCACTTGGAGGTGGG + Intronic
957523359 3:81349539-81349561 GGCAGTCCACACTGTGAGGTTGG + Intergenic
957636268 3:82790395-82790417 CCGAGCACCCACTGTGATGTTGG + Intergenic
957643528 3:82888481-82888503 CTTAATCCCCAATGGGAGGTGGG - Intergenic
960649175 3:119927078-119927100 CTGAGTACCTACTGTGTGCTAGG - Intronic
961241360 3:125414748-125414770 CTGATGCCTCACTGTGAGCTTGG - Intergenic
961522358 3:127474052-127474074 CTGAGTCCCCACTATTAGAAAGG + Intergenic
963505108 3:146174964-146174986 GGGAGTTCACACTGTGAGGTTGG - Intergenic
964201536 3:154122714-154122736 CTGCTTCCCCACTTTGAGGGCGG - Exonic
964272579 3:154973976-154973998 CTGAGACACCAGTGTGAGCTTGG - Intergenic
964747106 3:160022741-160022763 GTGAGTGCCCACTATGTGGTAGG + Intronic
965879058 3:173366255-173366277 TAGAGTGCCCACTGTGAGTTAGG + Intergenic
968669959 4:1843911-1843933 CTGTGTTCCTTCTGTGAGGTGGG + Intronic
969394585 4:6911720-6911742 CTGTGTCCCCACTTTGAGAGAGG - Intronic
969531840 4:7734658-7734680 CAGTGTCCTCCCTGTGAGGTGGG - Intronic
969596662 4:8152926-8152948 CTGAGACCCCACTTCAAGGTAGG + Intronic
975345926 4:73292828-73292850 CTGAGATCAAACTGTGAGGTGGG - Intergenic
976205438 4:82619447-82619469 CTGAGTACAGACTGTCAGGTGGG + Intergenic
976858575 4:89633709-89633731 TTGAGTAACCACTGTGTGGTAGG + Intergenic
976872541 4:89812847-89812869 ATGAGTCCCCACTCAGAGGAAGG - Intronic
982967816 4:161936522-161936544 CTGAATCCCAACTTTGTGGTTGG + Intronic
983257512 4:165416864-165416886 CTGAGTCCCCACTGTGTGCCAGG - Intronic
986695523 5:10351841-10351863 TTGAGTCCCCACTGTGAGTCAGG - Intergenic
989697957 5:44225746-44225768 CTGACTTCCCTCTGGGAGGTTGG + Intergenic
991460818 5:66856223-66856245 CTGAGTCCCCACTGTGGCTAAGG + Intronic
994652701 5:102549104-102549126 TTGAGTGCCTACTGTGTGGTAGG - Intergenic
997057327 5:130460057-130460079 CAGAGTCCCCACTGTGACATGGG + Intergenic
997201994 5:132016096-132016118 CTGAGTCCCCACTATGTGCAAGG + Intergenic
998710628 5:144821144-144821166 CTGAGTACTCATTGTGAGTTAGG + Intergenic
999148205 5:149409658-149409680 CTCCGTCTCCTCTGTGAGGTGGG - Intergenic
1001279197 5:170374252-170374274 CTGAGTCTTCACTGTGAAGAAGG + Intronic
1001304502 5:170561752-170561774 TTGAGTTCCCACTGCGTGGTGGG + Intronic
1001306481 5:170578084-170578106 TTGAGTGCCCACTATGTGGTAGG + Intronic
1001618615 5:173063072-173063094 CTGACTCACCTCTGTGGGGTAGG + Intronic
1001741504 5:174056618-174056640 CTGAATCCCTACTGTGAGCCAGG - Intronic
1001905943 5:175473358-175473380 CTGAGTGTCCACTGTGAGTGGGG - Intergenic
1002517798 5:179772630-179772652 CTGAGTACCCACTCTGTGGCAGG - Intronic
1004957384 6:20744386-20744408 CTGAGTGCCTACTGTGTGCTTGG + Intronic
1005011744 6:21342364-21342386 CTGAGTACCCACTTTCAGGGTGG + Intergenic
1005081176 6:21958170-21958192 CTAAGTCCCCACTCTGTGATAGG + Intergenic
1006765813 6:36505417-36505439 CTGAGGCCCCACTGATAGGTGGG + Intronic
1007010835 6:38416123-38416145 CTGATTAGCCACTGGGAGGTGGG + Intronic
1007847099 6:44768333-44768355 CTGAGTCTCTGCTGTGAGGCAGG + Intergenic
1007935127 6:45726217-45726239 CAGAGTGCCCAGAGTGAGGTGGG + Intergenic
1012437774 6:99233479-99233501 CTGAGTCCCCCCTGTGTGCCAGG - Intergenic
1015107201 6:129550914-129550936 CTGAGTCCCCACTATGTGGAAGG - Intergenic
1016768426 6:147821057-147821079 CTGAGTCCCTACTGTGTGCCTGG - Intergenic
1016772118 6:147863233-147863255 CTAAGTCCCCAACGTGAGTTTGG - Intergenic
1018729262 6:166636676-166636698 CGGAGTGCCTACTGTGAGCTGGG - Intronic
1019351545 7:556363-556385 CTGAGTTTCCACTGCGACGTGGG + Intronic
1019744521 7:2692212-2692234 CTGTGTCCTCCCTGTGAGATGGG - Intronic
1021650348 7:22826935-22826957 GTGAATCTCTACTGTGAGGTAGG - Intergenic
1023576360 7:41632250-41632272 CTGAGTCCCCACTCTGTAATTGG + Intergenic
1027171531 7:75876328-75876350 CTGTGGCCCCACTGTGTGCTAGG + Intronic
1027200212 7:76059506-76059528 CTGCGTCCTCACTGAGAGGGCGG + Intronic
1029606150 7:101600681-101600703 CTGGACCTCCACTGTGAGGTGGG - Intergenic
1029670168 7:102024673-102024695 TTGAGTCCCCACTGTGTGCCAGG + Intronic
1029805184 7:102988592-102988614 CTAAGTCCCCACTGTGTTCTTGG - Intronic
1038500880 8:28042542-28042564 CTGAGTCCCCAGGTAGAGGTGGG + Intronic
1039491328 8:37949677-37949699 CTCACTCACCACTGTGAGGAAGG - Intergenic
1040075316 8:43223347-43223369 CTGAGTCCAGACTGAGGGGTTGG + Intergenic
1040425890 8:47285875-47285897 CTGGGTGCCCACTGTGTGCTAGG - Intronic
1041486290 8:58380916-58380938 CACAATCCCCACTGTGAAGTTGG - Intergenic
1041545036 8:59033299-59033321 CTGAGTGCCTACTGTGTGCTAGG - Intronic
1042721827 8:71834443-71834465 CTGAGTCTGCACTGTCAGCTGGG + Intronic
1043408894 8:79971206-79971228 CTCAGTCCCCATTGTCTGGTTGG - Intronic
1043473066 8:80580290-80580312 CTTAGTCCCCATTTTTAGGTAGG + Intergenic
1044630062 8:94270009-94270031 CTGAGTTCCCTCTGTGTGCTAGG - Intergenic
1047211151 8:122841465-122841487 CTGACTCCCTACTGTGAGGCAGG - Intronic
1047275458 8:123401937-123401959 CTGGATGCCCACTATGAGGTAGG - Intronic
1047849488 8:128841349-128841371 TTTAGTCCCAATTGTGAGGTTGG - Intergenic
1048775629 8:137943064-137943086 TTGAATCCACTCTGTGAGGTAGG - Intergenic
1049258230 8:141625135-141625157 CTGAGTCCTCAGTGTGGGGTTGG + Intergenic
1049363291 8:142224536-142224558 GTGAGTCTCCACGGTGAGGAGGG - Intronic
1051362417 9:16293085-16293107 CTGAGGCCCTACTGTGTGCTGGG - Intergenic
1052779480 9:32765843-32765865 CTGAGTACCTACTGTGAGCTGGG - Intergenic
1052941237 9:34133307-34133329 CTGGATGCCCACTATGAGGTAGG + Intergenic
1057212851 9:93210033-93210055 TTGGGGCCCCACTGTGAGGATGG + Intronic
1057504249 9:95619627-95619649 CTGAGTACCCACTGTGTACTGGG - Intergenic
1057858478 9:98621192-98621214 TTGAGTCCCCTCTCTAAGGTGGG - Intronic
1059226650 9:112679120-112679142 CTGATACCCCACTCTGTGGTGGG - Intergenic
1059421121 9:114193094-114193116 CTGAGGTCCCACTGTGAGTCTGG + Intronic
1059661087 9:116400938-116400960 CTGCCCTCCCACTGTGAGGTAGG - Exonic
1059771171 9:117427580-117427602 CTGAGACCACACTGTCAGATTGG - Intergenic
1060285607 9:122248918-122248940 CTGAGTTCTCACTGTGTAGTAGG + Intronic
1061809533 9:133154307-133154329 CAGGGTCCCCACTGTGTGCTGGG + Intronic
1062011037 9:134267018-134267040 TTGAGCCCCCTCTGTGGGGTGGG + Intergenic
1062089975 9:134670816-134670838 CTGAGTCCCCACTGCGGTGATGG + Intronic
1062425044 9:136502226-136502248 CTGGGTCCCCGGTGGGAGGTGGG - Intronic
1062697386 9:137882428-137882450 TTGGGGCCCCACTGTGACGTGGG + Intronic
1186381888 X:9069593-9069615 CTGAGGCCCCACAGAGAAGTTGG - Intronic
1187600077 X:20819232-20819254 CTGAGTACCTACTGTGTGCTAGG - Intergenic
1190465078 X:50718089-50718111 CTGAGTGTCCACTGTGTGCTGGG + Intronic
1192316331 X:70054627-70054649 CAGAGTCCCCACTGTGCTGAGGG + Intergenic
1194667233 X:96688695-96688717 CTGAGTACCTACTGTGTGCTAGG + Intronic
1200042271 X:153379178-153379200 CTGAGTCCCCACTGTGTGCCAGG - Intergenic