ID: 1138563479

View in Genome Browser
Species Human (GRCh38)
Location 16:57815982-57816004
Sequence CTTGAACTTCACCTGGGGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 186}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138563475_1138563479 2 Left 1138563475 16:57815957-57815979 CCTGCTACAAACAGGCTTTTACA 0: 1
1: 0
2: 0
3: 13
4: 148
Right 1138563479 16:57815982-57816004 CTTGAACTTCACCTGGGGTGAGG 0: 1
1: 0
2: 1
3: 12
4: 186
1138563473_1138563479 4 Left 1138563473 16:57815955-57815977 CCCCTGCTACAAACAGGCTTTTA 0: 1
1: 0
2: 3
3: 22
4: 164
Right 1138563479 16:57815982-57816004 CTTGAACTTCACCTGGGGTGAGG 0: 1
1: 0
2: 1
3: 12
4: 186
1138563474_1138563479 3 Left 1138563474 16:57815956-57815978 CCCTGCTACAAACAGGCTTTTAC 0: 1
1: 1
2: 1
3: 5
4: 122
Right 1138563479 16:57815982-57816004 CTTGAACTTCACCTGGGGTGAGG 0: 1
1: 0
2: 1
3: 12
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138563479 Original CRISPR CTTGAACTTCACCTGGGGTG AGG Intronic
901090657 1:6638634-6638656 CCTGAAATTCTCCTGTGGTGGGG - Intronic
901244752 1:7720958-7720980 CCTGGACTGCACCTGGGGAGCGG + Intronic
902240435 1:15084732-15084754 CATTAACTTCTACTGGGGTGGGG - Intronic
903183534 1:21617351-21617373 CTCGAGCTTCACCTTGGTTGTGG + Exonic
903237318 1:21958423-21958445 CTTGATTCTCAGCTGGGGTGGGG + Intergenic
905818654 1:40972045-40972067 CTTGAACTTGGCCTGGGAGGTGG + Intergenic
906345022 1:45009672-45009694 GTTGAACTCCTCCTGGGGAGGGG + Exonic
906528633 1:46510924-46510946 CTTGAACCACACCTGGGGACGGG - Exonic
911070018 1:93825116-93825138 CCTGAACTTGACCTTGGATGTGG - Intronic
914425423 1:147571550-147571572 CTTCAACATAACCTGGGGAGGGG - Intronic
915625970 1:157114363-157114385 CAAGAGCTTCACCTGGGCTGGGG + Intergenic
916459277 1:165006219-165006241 CTTTCACTTTACTTGGGGTGGGG - Intergenic
917167430 1:172128045-172128067 CTTGAAATTCACCTTGGCTTTGG + Intronic
917648270 1:177049803-177049825 CTTGGACTCCACCTTGGGTTCGG - Intronic
918516617 1:185370417-185370439 CTTTAATTTCATCTGGGCTGTGG - Intergenic
920117604 1:203631413-203631435 CTGCCACTTCACTTGGGGTGTGG + Intronic
920365259 1:205444896-205444918 TTTGCCCTTTACCTGGGGTGGGG - Intronic
923669815 1:236030839-236030861 CATGGACTTCAGCTGGGCTGAGG - Intronic
924602148 1:245500675-245500697 CTTGAACTTCACCAGGGCGAGGG + Intronic
1063409487 10:5826032-5826054 CTTGAACTGAACCTGGGAGGCGG + Intronic
1069606477 10:69741995-69742017 CTTGAACGAGGCCTGGGGTGCGG - Intergenic
1070253714 10:74796059-74796081 GCTGAACTTCACCAGGGATGGGG - Intergenic
1070556085 10:77528788-77528810 CTTGAGGTTCACCTGTGTTGTGG - Intronic
1070827057 10:79397468-79397490 CTTCTCCTTCACCTGGGGTCTGG + Intronic
1070989620 10:80720028-80720050 CGTGAACTTCATCTGGGGTCTGG - Intergenic
1073114715 10:101085267-101085289 CTTGAACTCCACCTGGGAGGTGG + Intergenic
1074120232 10:110488562-110488584 CTTGAACTTCATCTGTGGCAGGG - Intergenic
1074405897 10:113180255-113180277 CTTGAACTTGAACTGAGCTGTGG - Intergenic
1074601705 10:114920720-114920742 CCTAAACTTAACCTGGGTTGGGG - Intergenic
1075060530 10:119253775-119253797 CTGGAGCTTTGCCTGGGGTGGGG + Intronic
1075241892 10:120786666-120786688 CCTCAAACTCACCTGGGGTGAGG + Intergenic
1076040076 10:127238963-127238985 CTTCAATTTCCCCTGGGGTGTGG + Intronic
1076998205 11:309400-309422 CTGTGACTTCACCTGGGGAGCGG + Intronic
1077000452 11:319649-319671 CTGCGACTTCACCTGGGGAGGGG - Exonic
1077514877 11:2995419-2995441 CATGCCCTTCACCTGTGGTGGGG + Intergenic
1077843955 11:6004265-6004287 CTTGAACCAGACCTGGGGGGCGG + Intergenic
1079709800 11:23666783-23666805 CTTGAACAGCTCCTGGGGTAGGG - Intergenic
1085402387 11:76242626-76242648 TTTGAATGTCACCTGGGTTGGGG - Intergenic
1085408854 11:76279947-76279969 TTTGAACTTGACCAGGGTTGGGG - Intergenic
1088662174 11:112058591-112058613 TGTGAACTTCAGTTGGGGTGGGG + Intronic
1090774103 11:129947859-129947881 TCTGAACTAAACCTGGGGTGGGG + Intronic
1091203262 11:133799029-133799051 GTTGAACTACACCTGGAGTTGGG + Intergenic
1094625559 12:32120631-32120653 CTTGAAGTTGACCTTGTGTGAGG + Intronic
1095089046 12:38087183-38087205 TTTGAACACCACCTGGGCTGGGG + Intergenic
1095105081 12:38223794-38223816 CTTGAACTTCAACTGTGGCATGG - Intergenic
1096147611 12:49290053-49290075 CCTGGACTTCACCTAGGATGTGG + Intergenic
1097144063 12:56927707-56927729 CTTCACCTCCACCTAGGGTGAGG - Intronic
1099918433 12:88925995-88926017 CTGGAAGTCTACCTGGGGTGGGG - Intergenic
1099942118 12:89200728-89200750 CTTAAACATCTCCTGGGGTATGG - Intergenic
1101647082 12:106641412-106641434 CTTGAACAGCACCTGGCATGGGG + Intronic
1102477110 12:113195878-113195900 CTCCAACTCCTCCTGGGGTGAGG + Exonic
1104745574 12:131208258-131208280 TCTGAGCTTCCCCTGGGGTGTGG + Intergenic
1104788768 12:131468851-131468873 TCTGAGCTTCCCCTGGGGTGTGG - Intergenic
1105968264 13:25404379-25404401 TTTGAACTTCACCTGCAGGGTGG + Intronic
1106134561 13:26964417-26964439 CTGGAACTTCTCATGGGGCGGGG + Intergenic
1107867110 13:44713688-44713710 TTTCAACTTCACATGGGGTTGGG + Intergenic
1108185834 13:47887613-47887635 CTATAACTTCCCTTGGGGTGGGG - Intergenic
1108221168 13:48234027-48234049 GGTGAACTTCACCTGGAGAGGGG + Intronic
1108900885 13:55406752-55406774 CGAGAACCTCTCCTGGGGTGTGG + Intergenic
1110354696 13:74553949-74553971 CCTGAACTGCCCCTGGGGTGTGG + Intergenic
1111478077 13:88780939-88780961 CTTCATCTTCACCCAGGGTGTGG + Intergenic
1113974064 13:114213298-114213320 CTTGAGCTTGTCCAGGGGTGGGG - Intergenic
1114086124 14:19237904-19237926 CTTGATGTTCACCTGGGGGCTGG - Intergenic
1118761523 14:68883026-68883048 CTTGAACTGCTCATGGGCTGTGG + Exonic
1119175923 14:72567715-72567737 CTAGAACTTTTCCTGGGATGTGG + Intergenic
1121640378 14:95481259-95481281 GTTGAACTTCACCTACCGTGGGG + Intergenic
1202896620 14_GL000194v1_random:14112-14134 CTTGATATTCACCTGGGGCCTGG + Intergenic
1202897662 14_GL000194v1_random:19523-19545 CTTGATGTTCACCTGGGGGCTGG - Intergenic
1126196669 15:45938964-45938986 CTAGAACTTCCCCAGGGGTCAGG + Intergenic
1127277874 15:57463212-57463234 CTTGTGCCTCACATGGGGTGGGG + Intronic
1129177332 15:73849451-73849473 CTTGAACTCCCCAGGGGGTGGGG - Intergenic
1130057927 15:80544985-80545007 CTTGAACTCCTCCAGTGGTGGGG - Intronic
1136370908 16:29835508-29835530 TTTAAAATTCAACTGGGGTGGGG + Intronic
1138563479 16:57815982-57816004 CTTGAACTTCACCTGGGGTGAGG + Intronic
1141566232 16:84903920-84903942 CTGGAAGTTCTACTGGGGTGGGG + Intronic
1142507632 17:375172-375194 CTGGAAGATCACCTGGGGTCAGG + Intronic
1142763519 17:2054217-2054239 CCTGACCTTCACGTGGGGCGCGG + Intronic
1144412329 17:15013261-15013283 AGTGACCTTCACCTGGGCTGGGG - Intergenic
1146163781 17:30573176-30573198 CTTGAACCTGCCCTGGGCTGAGG + Intergenic
1146627247 17:34444017-34444039 GCAGAACTGCACCTGGGGTGAGG - Intergenic
1147020626 17:37529656-37529678 CTTGCACTTCACCTGGTGAGAGG + Intronic
1148178856 17:45589081-45589103 CTTGAACTAAACCTGGGAGGCGG - Intergenic
1148270299 17:46257364-46257386 CTTGAACTAAACCTGGGAGGCGG + Intergenic
1148731087 17:49837071-49837093 CTTGCACTTAACCTGTAGTGAGG - Intergenic
1148772757 17:50076573-50076595 CTGGAACTGGACCTGGGGGGTGG - Exonic
1148836143 17:50466888-50466910 CTCCAACTTCAGCTGGGGAGAGG + Intronic
1155280312 18:24232775-24232797 CTTGCACTTTACCTGATGTGTGG - Intronic
1158278092 18:55790663-55790685 CATGCACTTCACCAGGGTTGGGG - Intergenic
1159237192 18:65692155-65692177 CTTTAACTTCAGGTGGGATGAGG + Intergenic
1160482841 18:79258574-79258596 CACAGACTTCACCTGGGGTGTGG - Intronic
1161277182 19:3425043-3425065 CTTCATCTGCTCCTGGGGTGGGG + Intronic
1161342526 19:3751086-3751108 CTTGATATGCACCTGGGGAGTGG + Exonic
1164750690 19:30652798-30652820 CTTGACCTTCACCTGGGGCGTGG + Intronic
1167105348 19:47427219-47427241 CTTGGACTTCAGGTTGGGTGCGG + Intergenic
1167596071 19:50428736-50428758 CCTGAATCTCATCTGGGGTGGGG + Exonic
1167870394 19:52364657-52364679 CTTGAACCTCACATGGGGGAAGG - Intronic
1168038630 19:53740238-53740260 ATGGAACTTCACTTGGGGTCAGG + Intergenic
926249705 2:11147552-11147574 CTTGAACCTAACCTGAAGTGTGG - Intergenic
927938990 2:27092119-27092141 CTTGAATTTAGCCTGGGCTGGGG + Intronic
928706406 2:33954281-33954303 ATTGACCCTAACCTGGGGTGGGG - Intergenic
931230179 2:60367440-60367462 CCTGAACTTCACCTAAGGTGTGG - Intergenic
936702593 2:115031449-115031471 CTTGAAGGTCAACAGGGGTGAGG - Intronic
937524032 2:122745424-122745446 CCTGAACTCAAGCTGGGGTGGGG - Intergenic
941766153 2:169298872-169298894 CTTGAAATTCACCAGGAATGGGG - Intronic
942623813 2:177877390-177877412 CTTGTGCCTCATCTGGGGTGAGG - Intronic
944488035 2:200227259-200227281 CTTGAACTCCCTCTGGGATGTGG + Intergenic
947233220 2:227910385-227910407 CTTGAACTCCTCCTGGGCTCAGG - Intronic
947484817 2:230538438-230538460 CCTGAGCTTCCCCTGGAGTGGGG - Intronic
947828883 2:233125133-233125155 CTTGAACTTGGCCTGGGAGGTGG - Intronic
948682995 2:239648963-239648985 CTGGAACTCCACCTGTGCTGGGG + Intergenic
1170169188 20:13392667-13392689 CTTCACCTTCACCAGGGATGTGG - Intronic
1170403058 20:16008454-16008476 CATGAACTTCTCCCTGGGTGAGG + Intronic
1173624409 20:44461751-44461773 ATTGATCTTCACCTGGGCAGTGG - Exonic
1175223831 20:57433404-57433426 CTAGAACGGCACCTGGGTTGTGG - Intergenic
1175994781 20:62807199-62807221 CATGCACCTCCCCTGGGGTGTGG - Intronic
1176616308 21:9030108-9030130 CTTGATATTCACCTGGGGCCTGG + Intergenic
1176617346 21:9035512-9035534 CTTGATGTTCACCTGGGGGCTGG - Intergenic
1176707794 21:10128157-10128179 CTTGATGTTCACCTGGGGGCTGG + Intergenic
1178921630 21:36742714-36742736 TTTGCACTTTACATGGGGTGAGG + Intronic
1179999594 21:44989306-44989328 CTGGAACTTCCCCCTGGGTGGGG + Intergenic
1180291843 22:10855289-10855311 CTTGATGTTCACCTGGGGGCTGG + Intergenic
1180292925 22:10860790-10860812 CTTGATATTCACCTGGGGCCTGG - Intergenic
1180494647 22:15884711-15884733 CTTGATGTTCACCTGGGGGCTGG + Intergenic
1180495732 22:15890212-15890234 CTTGATATTCACCTGGGGCCTGG - Intergenic
1182106770 22:27695320-27695342 GTTGAACTTCTCCTGGGTTCAGG - Intergenic
1184003896 22:41694928-41694950 CATGAAATTCAAGTGGGGTGGGG + Exonic
1184172090 22:42765766-42765788 CCTGAGCTCCACCTGGGGTGTGG - Intergenic
1184292930 22:43507999-43508021 CTTTAACCTCCCCTGGGGTGGGG + Intergenic
1184803388 22:46776166-46776188 TTTGAAGGTTACCTGGGGTGTGG + Intronic
1185277930 22:49957768-49957790 CCTGAGCTTCAGGTGGGGTGGGG + Intergenic
951996074 3:28730729-28730751 CTTGTTCTTCTCCTGGGATGTGG - Intergenic
952399521 3:32950612-32950634 CTTGATCTTCACTTTGGATGTGG - Intergenic
952929562 3:38348441-38348463 GTTGAACTGCTCCTAGGGTGTGG + Intronic
954052225 3:47989365-47989387 CTTAAGCTTCACCTGGGAAGTGG + Intronic
955068425 3:55552251-55552273 CTTGACCTTGGCCAGGGGTGGGG + Intronic
957742621 3:84291457-84291479 CAAGAAGTTCACCTGGGGTAAGG + Intergenic
959348178 3:105225944-105225966 CTTGAACTTGACCCGGGAGGTGG + Intergenic
959444617 3:106423502-106423524 CTTGAACTTTATCTTGGTTGAGG - Intergenic
962139248 3:132771452-132771474 CTTGAATTTTATTTGGGGTGTGG - Intergenic
963502171 3:146141442-146141464 CATGAACTTCTCCTGAGGTTGGG - Intronic
966248804 3:177838820-177838842 CTTGAACTTCAGTTCGGATGTGG + Intergenic
969150907 4:5167674-5167696 CTTGCCCGTCACCTGGGATGAGG - Intronic
969728262 4:8938735-8938757 CCTGAGCTTCTCATGGGGTGGGG - Intergenic
971677764 4:29655959-29655981 CTTTGACTTCTTCTGGGGTGTGG - Intergenic
974263972 4:59560447-59560469 CTTGAACTTCATTGGGGGAGGGG - Intergenic
975064063 4:70039407-70039429 CTTGAAGCTAACCTGGGGAGAGG - Intergenic
975802204 4:78072523-78072545 CTTGAACTTCTCCAGCAGTGGGG + Intronic
975984413 4:80189407-80189429 CTTGCATTAAACCTGGGGTGGGG + Intronic
976147692 4:82058320-82058342 TTTGAACTGCTCCAGGGGTGGGG - Intergenic
976245479 4:83002317-83002339 CTTGAACTCCACCTGGGCTTAGG - Intronic
976837929 4:89396902-89396924 ATGGTACTTCATCTGGGGTGGGG + Intergenic
978383896 4:108160900-108160922 CTGGAAAAACACCTGGGGTGGGG - Intronic
981431215 4:144663205-144663227 CTTGAACTGAACCTGGGAGGCGG + Intronic
986407430 5:7440035-7440057 CTGGAACTTCTCCTGTGATGTGG - Intronic
986801847 5:11268506-11268528 CTTGAACTTGACCTGAGAGGTGG + Intronic
988556375 5:32239582-32239604 ACTGAACTCCTCCTGGGGTGTGG + Intronic
993233307 5:85268258-85268280 CATGGAATTCACCTGGGGTCTGG - Intergenic
1000689509 5:164297446-164297468 CTTGAACTTAAACTGGGATCTGG + Intergenic
1005688972 6:28283496-28283518 CTTGCACTTCAGCTGGGGAGAGG - Intronic
1005811120 6:29517355-29517377 ATTGAAATTGAACTGGGGTGGGG - Intergenic
1006299222 6:33185030-33185052 CTTCCTCTTCACCTGGGGTGGGG + Exonic
1006463419 6:34177171-34177193 CTTGAACTCCACCTGATGTCTGG + Intergenic
1012616728 6:101286426-101286448 CATGAACTTCAACTGGAGTTAGG - Intergenic
1016911349 6:149202361-149202383 CATGCACTACACCTGGCGTGTGG + Intergenic
1019261440 7:84144-84166 CTTGGACTCCAGCTGGTGTGGGG + Intergenic
1021340497 7:19457800-19457822 CTTGAACTTGGCCTGAGGTCTGG + Intergenic
1022113683 7:27245875-27245897 CTGGAACCACACCTGGGGAGAGG - Exonic
1022395144 7:29981581-29981603 CTTGAACTTCACCTGAAGCTGGG - Intronic
1024343493 7:48290264-48290286 CTGGAACTTCAGGTTGGGTGGGG + Intronic
1024527309 7:50359900-50359922 CTTGACCTCCACCTGTAGTGGGG + Intronic
1026107091 7:67429888-67429910 CTTCAACAACACCTGGTGTGGGG - Intergenic
1031030484 7:116728864-116728886 CTCAAACTTGACCTGGTGTGTGG - Intronic
1037640716 8:20740179-20740201 CTAGAACTTCAGCTGTAGTGTGG - Intergenic
1037963407 8:23116334-23116356 CGTGACCTTCCCCTGGAGTGTGG + Intronic
1038799578 8:30737521-30737543 CTGTAACAGCACCTGGGGTGTGG + Intronic
1039065265 8:33602074-33602096 ATTGATCTTCACCTGAGGTCGGG - Intergenic
1041385561 8:57298312-57298334 CTTGAACATCATCTGAGCTGGGG + Intergenic
1044929144 8:97235087-97235109 CTGGAATTCCACATGGGGTGAGG - Intergenic
1049793832 8:144486951-144486973 TTTGCATTTCACCTGGGGTGGGG + Intronic
1050181069 9:2923461-2923483 CCTGTATTTGACCTGGGGTGGGG + Intergenic
1051549500 9:18313359-18313381 CATGTAACTCACCTGGGGTGAGG - Intergenic
1051830020 9:21265725-21265747 GATGCACTTTACCTGGGGTGGGG + Intergenic
1053092317 9:35290076-35290098 CTTGAAATTCAATTTGGGTGTGG + Intronic
1053760993 9:41349957-41349979 CTTGATGTTCACCTGGGGGCTGG - Intergenic
1055773663 9:79744547-79744569 CTTGAACTTCTACTGAGGAGGGG + Intergenic
1057302955 9:93896968-93896990 CTTGGCCCTCTCCTGGGGTGGGG - Intergenic
1060138697 9:121184410-121184432 TTTGGCCTTTACCTGGGGTGGGG + Intronic
1062375270 9:136259208-136259230 CTTGATCTTCATCTTGGTTGGGG - Intergenic
1062383518 9:136299046-136299068 CCTGAACTTGACCTGGGGCAGGG + Intronic
1202792539 9_KI270719v1_random:97037-97059 CTTGATGTTCACCTGGGGGCTGG + Intergenic
1187007331 X:15245597-15245619 CTTCAGACTCACCTGGGGTGGGG + Intronic
1189462484 X:41253602-41253624 CTTGAACTTCACTAGGGAGGCGG + Intergenic
1190259284 X:48787864-48787886 TTGGAACGTTACCTGGGGTGAGG + Intronic
1192097742 X:68230751-68230773 CTGGAGCTTGACGTGGGGTGGGG + Intronic
1193193894 X:78606849-78606871 GTTGAAGTCCACCTGGAGTGTGG + Intergenic
1194031935 X:88828387-88828409 CTTGAACTACAACTGGGGCAAGG - Intergenic
1200270093 X:154674653-154674675 CTCATACTTCACCAGGGGTGAGG + Intergenic
1201149683 Y:11088833-11088855 CTTGATATTCACCTGGGGCCTGG + Intergenic
1202338668 Y:23836866-23836888 CTGGAACTCCACCTGAGGTCAGG + Intergenic
1202532098 Y:25833206-25833228 CTGGAACTCCACCTGAGGTCAGG - Intergenic