ID: 1138563553

View in Genome Browser
Species Human (GRCh38)
Location 16:57816355-57816377
Sequence TCCTGGCTTCCTCTTGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 359
Summary {0: 1, 1: 0, 2: 1, 3: 44, 4: 313}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138563547_1138563553 -8 Left 1138563547 16:57816340-57816362 CCTGGGGCCTGCCCCTCCTGGCT 0: 1
1: 0
2: 8
3: 62
4: 658
Right 1138563553 16:57816355-57816377 TCCTGGCTTCCTCTTGAGGAAGG 0: 1
1: 0
2: 1
3: 44
4: 313
1138563541_1138563553 10 Left 1138563541 16:57816322-57816344 CCCGTGTGTCTTCAGGATCCTGG 0: 1
1: 0
2: 0
3: 15
4: 215
Right 1138563553 16:57816355-57816377 TCCTGGCTTCCTCTTGAGGAAGG 0: 1
1: 0
2: 1
3: 44
4: 313
1138563543_1138563553 9 Left 1138563543 16:57816323-57816345 CCGTGTGTCTTCAGGATCCTGGG 0: 1
1: 0
2: 2
3: 33
4: 301
Right 1138563553 16:57816355-57816377 TCCTGGCTTCCTCTTGAGGAAGG 0: 1
1: 0
2: 1
3: 44
4: 313

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138563553 Original CRISPR TCCTGGCTTCCTCTTGAGGA AGG Intronic
900946768 1:5835201-5835223 CCCTGGGTTTCTCTTTAGGAAGG - Intergenic
901808837 1:11754430-11754452 CTCTGGCTTCCTCATGTGGAAGG - Intronic
903238837 1:21968905-21968927 TGCTGGCTTCCTCCTCAGGATGG - Intergenic
903242758 1:21994569-21994591 TGCTGGCTTCCTCCTCAGGATGG - Intronic
904464616 1:30700419-30700441 TCCTGACTTCCTCTTCAGGTTGG - Intergenic
904598846 1:31662871-31662893 TCCTTGCTGCCCCATGAGGAAGG + Intronic
904694137 1:32318255-32318277 TCCTGTCTTCCTCTTAAAGAGGG - Intronic
905743247 1:40390535-40390557 TCTGGGCTTCTTTTTGAGGAAGG + Intronic
906188387 1:43879391-43879413 TCCTGGCCTCCTCGAGAGAATGG + Intronic
906798343 1:48715092-48715114 TTCTGTCTTCCTCTTCAGAAAGG - Intronic
907388159 1:54139288-54139310 TCCAGGCTTCCTGTTGAGTGAGG + Exonic
911494636 1:98616297-98616319 TCCTGTGTTCCTCTTGATGAGGG + Intergenic
913529461 1:119723299-119723321 TCAAGGCTTTCTCTTGGGGAAGG + Intronic
916833813 1:168520866-168520888 TCCTCGCTTCATGTTCAGGAGGG + Intergenic
917226163 1:172785917-172785939 TCCTGTCTTCCTTTTAATGAAGG + Intergenic
919003083 1:191860070-191860092 CCCTTCCTTCCACTTGAGGAGGG + Intergenic
920340311 1:205271552-205271574 AGCTGGCTCCCTCTTGAGGCAGG - Intronic
920385919 1:205569899-205569921 TTCTGGCTGCCTCAGGAGGAGGG - Intronic
920414204 1:205787625-205787647 TCCTGGTTCCCTCTGCAGGACGG + Intergenic
921003270 1:211066987-211067009 ACCTGGCTTCCTCACGGGGAAGG + Intronic
921355049 1:214278096-214278118 TGCTGGCTTATTCTTGAGGGTGG - Intergenic
922182234 1:223244376-223244398 TCCTGGCCTCCTCTTGTGTCTGG - Intronic
923040637 1:230317674-230317696 TCCTGGCTCCCTCAGGTGGAAGG - Intergenic
923960269 1:239073856-239073878 TCCTGTCTTCCTTTTGGTGAAGG - Intergenic
1067078379 10:43200742-43200764 TGGTGGCTTGGTCTTGAGGATGG + Exonic
1070688630 10:78508657-78508679 TCCTGGCTCCCTTTTGGGGTTGG - Intergenic
1071335866 10:84600147-84600169 TCCTGATTTCCTCTGGAGAAGGG + Intergenic
1071750602 10:88471459-88471481 TGCTGGCTACCTTTTGGGGAAGG + Intronic
1071899440 10:90103675-90103697 TCCTGTCTTCCTTTTAGGGAAGG - Intergenic
1072626404 10:97115178-97115200 TCCTGGCTTCCCCGTAAGGTTGG + Intronic
1072686461 10:97540121-97540143 TCCTTGCTCCCTCTATAGGAGGG - Intronic
1074314272 10:112347387-112347409 TCCTGGCATCCTCCTGGGGAAGG + Intergenic
1074611146 10:115023289-115023311 TTCTGGCTTCCTCCAGAAGAGGG - Intergenic
1076886101 10:133263180-133263202 TCCTTGCTTCCTCTGGATGGGGG + Exonic
1077233897 11:1470761-1470783 TCCTGGCCACCTCCTCAGGAAGG + Intronic
1077305060 11:1865245-1865267 GCCTGGATACCTCTTGAGGTAGG + Exonic
1077446678 11:2595440-2595462 TACTGGCTTCAACTTGAGCAAGG - Intronic
1077574662 11:3373260-3373282 CCCAGGATTCCTCTTGAGGATGG - Intronic
1080027018 11:27625814-27625836 TTCTGGCTCCATTTTGAGGAAGG - Intergenic
1082195296 11:49297834-49297856 TCCTGTCTTCCTTTTGGTGAAGG + Intergenic
1082709627 11:56538621-56538643 TCCTGGCTTAGTCTTGTGAAGGG + Intergenic
1083346964 11:62000584-62000606 TCCTGGCGTCCCTGTGAGGATGG + Intergenic
1083568443 11:63741127-63741149 TCCTGGCTTCCACTTGGCCATGG - Intronic
1084768669 11:71328566-71328588 TCCTATCTTCCTCTTAAGGCTGG + Intergenic
1085402125 11:76241533-76241555 TCCTAGCTGCCTCTTCCGGATGG + Intergenic
1086660635 11:89411718-89411740 TCCTGTCTTCCTTTTGGTGAAGG - Intronic
1089207197 11:116773577-116773599 TCCTGGCTTCCTTTCTTGGACGG - Intergenic
1089494759 11:118902435-118902457 TCCTGGGGGCCCCTTGAGGAAGG + Exonic
1089743714 11:120602427-120602449 TCCTTCCTTCCTCTTCAGGTGGG - Intronic
1090515470 11:127421610-127421632 TCCTGTCTTCCTTTTAATGAAGG + Intergenic
1090821431 11:130345871-130345893 TACTGTCTTCCTCTAGAGAAAGG + Intergenic
1091785971 12:3243660-3243682 CCCTGGCTTCCTCTTCAGGGAGG + Intronic
1092020996 12:5202080-5202102 TGCTGGCTGCCTCTTAAAGAAGG + Intergenic
1092183744 12:6463492-6463514 TCCTCTCTTCCTGTTGATGAAGG - Intronic
1093135644 12:15447086-15447108 TCCAGGCAGCCTCTTGCGGAGGG - Intronic
1095042928 12:37464222-37464244 TCCTGGCTTCCCCTTGGAGAAGG - Intergenic
1095133882 12:38574381-38574403 TCCTGTCTTCCTCTAGTGAAGGG - Intergenic
1097141272 12:56904084-56904106 TCTTGGCAATCTCTTGAGGAGGG + Intergenic
1097314590 12:58158593-58158615 TCCTGTTTGCCTCTTGAGTAGGG - Intergenic
1097444254 12:59648672-59648694 TCCTGGAATCCTCTTGAGACTGG - Intronic
1100121017 12:91369475-91369497 TCCTGACTTCCTGTTGTTGAGGG - Intergenic
1100183717 12:92113499-92113521 GCCTGGCTCTCTATTGAGGAGGG - Intronic
1101551226 12:105764215-105764237 TCCTGGCTTCTTAATTAGGAAGG - Intergenic
1101817052 12:108153358-108153380 TCCTGGCAACCTCTGGCGGAGGG + Intronic
1101997361 12:109534634-109534656 GCCTGGCTCCCGCTTGCGGATGG - Exonic
1102669285 12:114603357-114603379 CCCTGAAGTCCTCTTGAGGAAGG - Intergenic
1102995084 12:117342976-117342998 TCCTGGCTTCCACTAGTAGAAGG + Intronic
1104579739 12:130002204-130002226 TCCTGTTTTCCTCGTCAGGATGG - Intergenic
1107750680 13:43562433-43562455 TCCTGTCTTCCTTTTAATGAAGG - Intronic
1108029756 13:46217321-46217343 TCCTGGTTTCATCTTGGGGAGGG + Intronic
1110190715 13:72726963-72726985 TCCTAGTTTCCTCTTGAAGCGGG - Intronic
1111181285 13:84669249-84669271 TACTGGCTTCCACCTGAGAAAGG - Intergenic
1112053722 13:95670794-95670816 TTCTGTCTTTCTCTTCAGGATGG + Intergenic
1113459025 13:110468828-110468850 TCGTGGCGTCCTCATGAGGCAGG + Intronic
1114262880 14:21051527-21051549 TCCTGGATTCATCTTCATGAGGG - Intronic
1115117101 14:29894382-29894404 TTCTGGCTTCCAACTGAGGATGG - Intronic
1115537859 14:34390504-34390526 TCCTGTCTTCCTTTTAATGAAGG - Intronic
1117545813 14:56794409-56794431 CCCAGGCTTCCTCTTGACGTGGG - Intergenic
1117554757 14:56872632-56872654 TGCTGGCTTCCCCTAGAGCAAGG + Intergenic
1119205728 14:72792118-72792140 TCCTGGCTGGCTCTGCAGGAAGG - Intronic
1119476915 14:74935576-74935598 ACCTCACCTCCTCTTGAGGATGG - Intergenic
1122578282 14:102755497-102755519 TCCTTGGATCCTCTTCAGGAAGG - Intergenic
1202941467 14_KI270725v1_random:151825-151847 TCCTGGCTTCCCCTTGGAGAAGG - Intergenic
1123472333 15:20564678-20564700 TCCTGGCTTCCCCTTGAGACTGG - Intergenic
1123645670 15:22435675-22435697 TCCTGGCTTCCCCTTGAGACTGG + Intergenic
1123666930 15:22615241-22615263 TCCTGGCTTCCCCTTGAGACTGG + Intergenic
1123732638 15:23159669-23159691 TCCTGGCTTCCCCTTGAGACTGG - Intergenic
1123750771 15:23357049-23357071 TCCTGGCTTCCCCTTGAGACTGG - Intronic
1124283142 15:28380965-28380987 TCCTGGCTTCCCCTTGAGACTGG - Intronic
1124299557 15:28530648-28530670 TCCTGGCTTCCCCTTGAGACTGG + Intronic
1124320771 15:28709814-28709836 TCCTGGCTTCCCCTTGAGACTGG + Intronic
1124350861 15:28954660-28954682 TCCTGACATCTTCTTGAAGACGG + Intronic
1124521868 15:30411665-30411687 TCCTGGTTTCCCCTTGAGACTGG + Intronic
1124536796 15:30554554-30554576 TCCTGGTTTCCCCTTGAGACTGG - Intronic
1124543269 15:30606607-30606629 TCCTGGTTTCCCCTTGAGACTGG - Intronic
1124563227 15:30794062-30794084 TCCTGGCTTTCCCTTGAGACTGG - Intergenic
1124761856 15:32453037-32453059 TCCTGGTTTCCCCTTGAGACTGG + Intronic
1124776773 15:32596031-32596053 TCCTGGTTTCCCCTTGAGACTGG - Intronic
1124810897 15:32937063-32937085 TCCTGGCTTCTCCTTGGAGAAGG - Intronic
1124810924 15:32937299-32937321 TCCTGGCTTCTCCTTTGGGAGGG - Intronic
1124960065 15:34387174-34387196 TCCTGGCTTCCCCTTGAGACTGG + Intronic
1124976694 15:34533395-34533417 TCCTGGCTTCCCCTTGAGACTGG + Intronic
1125726384 15:41870341-41870363 TCGTGGCTTTCTCCTGAGGAAGG + Exonic
1126292006 15:47091582-47091604 TCCTGGCTTCTCCTTGGAGAAGG + Intergenic
1126309017 15:47294591-47294613 TTCTGACTTCCTCCTGAGGTAGG + Intronic
1126499488 15:49329283-49329305 GACTGGCTTTCTCTTGTGGATGG + Intronic
1126730898 15:51681439-51681461 TCCTCACTTCCTCTGCAGGAGGG + Exonic
1127149529 15:56059229-56059251 TCCTGGCTTCTTCTTGATCTAGG - Intergenic
1127907082 15:63383896-63383918 TCCCAGCTTCCTAGTGAGGATGG - Intergenic
1128509104 15:68302693-68302715 CCCTGGGTTTCTCTGGAGGATGG + Exonic
1129029162 15:72605941-72605963 GCCTGGCTTCCCCTTGAGACTGG - Intergenic
1129118981 15:73383544-73383566 TCCTCACTTCCTCTTGAGTTGGG + Intergenic
1129364813 15:75047717-75047739 GCCTGGCTTCCTCTCTAGAAAGG - Intronic
1130167095 15:81472650-81472672 GCCTGGCTTCTACTTGAGCAAGG - Intergenic
1130209792 15:81912509-81912531 TCAGGGCTTCCTTTTGGGGATGG - Intergenic
1130259998 15:82347128-82347150 GCCTGGCTTCCCCTTGAGACTGG + Intronic
1130268729 15:82432309-82432331 GCCTGGCTTCCCCTTGAGACTGG - Intronic
1130281234 15:82521883-82521905 GCCTGGCTTCCCCTTGAGACTGG - Intergenic
1130472607 15:84238065-84238087 GCCTGGCTTCCCCTTGAGACTGG - Intronic
1130480098 15:84352636-84352658 GCCTGGCTTCCCCTTGAGACTGG - Intergenic
1130484329 15:84390208-84390230 GCCTGGCTTCCCCTTGAGACTGG - Intergenic
1130491671 15:84435493-84435515 GCCTGGCTTCCCCTTGAGACTGG + Intergenic
1130503286 15:84514533-84514555 GCCTGGCTTCCCCTTGAGACTGG + Intergenic
1130594902 15:85242699-85242721 GCCTGGCTTCCCCTTGAGACTGG - Intergenic
1130996640 15:88907868-88907890 CCCTGGCTTCCTCAGGAGGGTGG + Intronic
1132433654 15:101779649-101779671 TCCTGGCTTCCCCTTGAGACTGG + Intergenic
1133320515 16:4910667-4910689 TCCTGGCGTCCAGTTGGGGAGGG - Intronic
1133457464 16:5954931-5954953 TCCTGGGTTCCTCTTGAAGGAGG + Intergenic
1134215142 16:12311453-12311475 TCCTGGCTTCCTCTGCTGGCTGG + Intronic
1134515820 16:14886020-14886042 TCCTGGCATTCTCTTGCGGCAGG + Intronic
1134703492 16:16284664-16284686 TCCTGGCATTCTCTTGCGGCAGG + Intronic
1134964051 16:18427450-18427472 TCCTGGCATTCTCTTGCGGCAGG - Intronic
1134968338 16:18509986-18510008 TCCTGGCATTCTCTTGCGGCAGG - Intronic
1138061289 16:53893227-53893249 TCTTTGCTCCCTATTGAGGATGG + Intronic
1138563553 16:57816355-57816377 TCCTGGCTTCCTCTTGAGGAAGG + Intronic
1138659970 16:58511138-58511160 CACTGGCATCCTCTTGAGGGAGG + Intronic
1138822898 16:60283000-60283022 CAGTGGCTTCCTCTGGAGGAGGG + Intergenic
1139559567 16:67733495-67733517 GGCTGGCTTCCTCTAGTGGAAGG - Intronic
1140786744 16:78349496-78349518 TCCTGGCTTCTTCTAAAGGGTGG - Intronic
1140827507 16:78720911-78720933 TCTTGGTTTCATCCTGAGGATGG - Intronic
1142003947 16:87680178-87680200 GGCTGGCTTCCTCTGGCGGAGGG + Intronic
1143102808 17:4513623-4513645 TCCAGGCTCCCTCCTGAGGCTGG + Intronic
1143518620 17:7432699-7432721 TGCTGGGTGCCTCTTGATGAAGG - Intergenic
1143848271 17:9789855-9789877 CCCTGGCTTGCCCTTGAAGAAGG + Intronic
1144060571 17:11580449-11580471 TTCAGGCTTTCTCTGGAGGAAGG + Intergenic
1144682319 17:17204214-17204236 GACTGACTTCCTTTTGAGGAAGG - Intronic
1144769819 17:17753196-17753218 CCCTGCCTTCCTCCTGAGGCAGG - Intronic
1145101361 17:20080560-20080582 ACCTTGCTGCCTCTTGGGGAAGG + Intronic
1151411143 17:73930615-73930637 TTCTGGCTGTCTCTTGAGCAGGG + Intergenic
1152522517 17:80866372-80866394 TCCCGGCTTCCACCTGAAGAGGG + Intronic
1153363561 18:4226758-4226780 TCCTGGCTTCCTTTTAGTGAAGG - Intronic
1153387272 18:4511471-4511493 TCTTGGCTGCATCTTAAGGAGGG - Intergenic
1155492525 18:26414356-26414378 TCCTTGCTTCCCCTTGAGGGAGG + Intergenic
1156638156 18:39056019-39056041 TTCTGGCTTCCTCTTGGGCTTGG - Intergenic
1157283543 18:46361734-46361756 TCCTGGCTCCCGCCTGGGGAGGG - Intronic
1159896257 18:73999327-73999349 TCCTGTCTTCCTTTTCATGAAGG + Intergenic
1159918698 18:74208490-74208512 TCCTGGCTTCTTTTTTAGAAGGG - Intergenic
1160451477 18:78969446-78969468 TCTTGTCTTCCTCTGGACGAAGG + Intergenic
1161569428 19:5022405-5022427 TCGTGGCTTCATCTTGAGGCTGG + Intronic
1164147984 19:22524261-22524283 GCCTGGCTTCCCCTTGAGACTGG + Intronic
1165645843 19:37435375-37435397 TCCTGTCTTCCTTTTTGGGAAGG - Intronic
1166461471 19:42991916-42991938 TTCTGGCTTCCTCCTTGGGAAGG + Intronic
1166750802 19:45163236-45163258 GCCTGGCTTAGGCTTGAGGATGG + Intronic
1166794687 19:45419425-45419447 CCCTGGCTTCTTCATGAAGAGGG + Intronic
926146269 2:10398724-10398746 TCCTGCCTTCCTCTTCCTGAGGG + Intronic
927419959 2:22920233-22920255 TCCTGGCATCCTAGTGAGAATGG - Intergenic
927853826 2:26515926-26515948 GCCTTTCTTCCTCTTGAGAAGGG - Intronic
928105067 2:28464968-28464990 TCCTGGCTTCCTCCTGGGCTAGG + Intronic
929593538 2:43161956-43161978 TGCTGTCTTCCTGGTGAGGATGG - Intergenic
929764243 2:44831028-44831050 TCCGGGCTTCCTCTGAAGGCAGG - Intergenic
933077903 2:77953089-77953111 TCCTGTCTTCCTTTTAATGAAGG - Intergenic
933132365 2:78688389-78688411 TCCTGTCTTCCTCTTTTTGAAGG - Intergenic
934131954 2:88956773-88956795 TCCTGACTGCCTGGTGAGGAAGG - Intergenic
934133467 2:88971425-88971447 TCCTGACTGCCTGGTGAGGAAGG - Intergenic
934160018 2:89240624-89240646 GCCTGGCTTTCTAATGAGGAAGG - Intergenic
934207256 2:89941810-89941832 GCCTGGCTTTCTAATGAGGAAGG + Intergenic
935987620 2:108689781-108689803 TCCTGGGCTCCTCTTGGGGCTGG - Intergenic
936126448 2:109792482-109792504 TCCTGGGCTCCTCTTGGGGCTGG - Intergenic
936218245 2:110578986-110579008 TCCTGGGCTCCTCTTGGGGCTGG + Intergenic
937733575 2:125262377-125262399 CACTGGCTTCCTTTTGTGGATGG - Intergenic
940402132 2:153259893-153259915 TCCTGTCTTCCTCTTAGTGAAGG + Intergenic
941721838 2:168820665-168820687 TGCCGGCTTTCTCTTGAGCATGG - Intronic
942369514 2:175267437-175267459 TCCTGGCTTCTTGTTAAGAATGG - Intergenic
944190244 2:196995238-196995260 TCCTGGCTTCCCCTGCATGAAGG - Intronic
944235947 2:197441565-197441587 TCTTGGCTTCCACAGGAGGAGGG + Intergenic
944616479 2:201465509-201465531 TCCTTCCTTTCCCTTGAGGAGGG - Intronic
948006265 2:234610333-234610355 TTCTGGGCTCCTCTAGAGGAAGG - Intergenic
1168833381 20:859931-859953 TCCTGTTTCCCTCTAGAGGAAGG + Intergenic
1168899020 20:1344109-1344131 TCAGGTCTTCCTCTTGAGGCAGG - Intronic
1169116423 20:3069264-3069286 TCCTGCCCTCTTGTTGAGGAAGG - Intergenic
1169246036 20:4025619-4025641 TCCTGACTTACTCTTGAAGTAGG + Intergenic
1169684533 20:8256304-8256326 TCCTGGCTTCCTTGTGTGTATGG + Intronic
1169711003 20:8563439-8563461 TCCTGGCTTCCTTTTGAGTTTGG - Intronic
1169947669 20:11006707-11006729 TTCTTGTTTCCTTTTGAGGAAGG + Intergenic
1170634410 20:18092287-18092309 GCCTAGCTTGCTCTTAAGGAAGG - Intergenic
1171395966 20:24833350-24833372 TGCTGGCTTCAGCTGGAGGAAGG + Intergenic
1171397157 20:24842803-24842825 TCCTCCCCTACTCTTGAGGATGG - Intergenic
1171537351 20:25906977-25906999 TCCTGGCTTCCCCTTGGAGAAGG - Intergenic
1171803760 20:29654309-29654331 TCCTGGCTTCCCCTTGGAGAAGG + Intergenic
1171840304 20:30202316-30202338 TCCTGGCTTCCCCTTGGAGAAGG - Intergenic
1172593231 20:36132054-36132076 CCCTGGCTAGCCCTTGAGGAGGG + Intronic
1173419059 20:42884474-42884496 TCTTGGCTACCTCTGGAGAACGG - Intronic
1174983038 20:55419110-55419132 TGCTGGCTTCCCATGGAGGAAGG + Intergenic
1175164847 20:57036170-57036192 TCCTGGCTGCCTCACCAGGATGG - Intergenic
1175994792 20:62807233-62807255 TCCTGGCTTCCACCTTAGGGTGG - Intronic
1176046634 20:63096359-63096381 TCCTTGCTTGCTCCTGGGGAAGG - Intergenic
1176581695 21:8535109-8535131 TCCTGGCTTCCCCTTGGAGAAGG + Intergenic
1178903034 21:36612991-36613013 CCTTGGCTTCTTCTTGAGAAAGG + Intergenic
1179490836 21:41740769-41740791 TCCTGTGTTCCTCGTGGGGATGG - Exonic
1179810739 21:43867422-43867444 TCCTGGATTCCTTTGGAGGAGGG + Intronic
1180264530 22:10512181-10512203 TCCTGGCTTCCCCTTGGAGAAGG + Intergenic
1181910324 22:26233484-26233506 TCCTGGCACCATCATGAGGAAGG + Intronic
1182577795 22:31284882-31284904 ACCAGGCTTCCTCTTAGGGAGGG - Intronic
1185132414 22:49046705-49046727 TCCGGGCTTCCTCCAGAGGGCGG + Intergenic
950046282 3:9950225-9950247 TCCTGTCAGCCCCTTGAGGAAGG - Intronic
950276891 3:11669273-11669295 TCCTGGCTTTCTCCTGAGCTGGG - Intronic
950879541 3:16311997-16312019 GCCTGGCTTCCTCTGCTGGAGGG + Intronic
951028668 3:17857863-17857885 TCCTGTCTTCCTTTTGGGGAAGG + Intronic
952955671 3:38555832-38555854 TCCTGGCATCCTCATCAAGAAGG - Intronic
953375902 3:42428359-42428381 TCCTGTCTTCAGATTGAGGAAGG + Intergenic
953386293 3:42507930-42507952 GCCTCACTTCCTCTTGGGGAAGG - Intronic
954638308 3:52083550-52083572 GCCTGGTTTTCTCTTGAGGTGGG + Intronic
955585001 3:60468385-60468407 TCCTGTCTTCCTTTTAATGAAGG + Intronic
955753171 3:62203287-62203309 GCCTGGCTGCCACTGGAGGAGGG - Exonic
956781423 3:72606242-72606264 CCCTGGCTTCATCTAGGGGATGG - Intergenic
956819616 3:72941950-72941972 CCCTGGGTTCCTTTGGAGGATGG - Intronic
958711060 3:97717504-97717526 AGATGGCTTCTTCTTGAGGATGG + Intronic
959913783 3:111793921-111793943 TCCTTTCTTCTGCTTGAGGAAGG - Intronic
961661693 3:128472327-128472349 TCCTGGCTACTTCTGGAGGCGGG + Intergenic
961785821 3:129346057-129346079 GTCTGGCTTCCTCTACAGGATGG - Intergenic
963310317 3:143702621-143702643 TCCTCTCTTCCTCTTAATGAAGG - Intronic
965717003 3:171615515-171615537 TCAAGTCTTCCTCTTGGGGAGGG - Intronic
967728111 3:192880699-192880721 CCCTGGCTCCCTCTGGGGGAGGG - Intronic
969156951 4:5219329-5219351 TGCTGGGTTCCTCTACAGGAAGG - Intronic
969701728 4:8771356-8771378 TCCTGGCATCCTCGTGGGGGAGG - Intergenic
969965780 4:10993913-10993935 TTCTGTCTTCCACTTAAGGATGG + Intergenic
971698178 4:29933280-29933302 TCCTGGTTTATTCTTTAGGATGG - Intergenic
972139901 4:35945448-35945470 TGCTGGCTTACACCTGAGGAAGG - Intergenic
973852719 4:54977178-54977200 TCCTTCCTTCTGCTTGAGGAGGG + Intergenic
974224309 4:59018829-59018851 TCCTCTCTTCCACTTGGGGAAGG - Intergenic
975191377 4:71466882-71466904 TTCTGGCTTCCTCTTGGGTTTGG + Intronic
976722004 4:88178163-88178185 TCCTCCCTTCCACTTGAGCAGGG + Intronic
979391342 4:120131384-120131406 TCCCTGCTTCCTGTTGTGGAAGG + Intergenic
981283624 4:142990539-142990561 TCCTGGCTTCTTTCTGGGGAGGG - Intergenic
984388247 4:179092752-179092774 TCATGTCTTCCTCTTTTGGATGG - Intergenic
984673994 4:182525781-182525803 TGCTGGCTTCATTTTGAGTATGG - Intronic
985914029 5:2904021-2904043 TCCTGGCCCCCTGTTGAGCAGGG + Intergenic
986687825 5:10289564-10289586 TCCTGGCAGCCCCTTGAGGGAGG - Intronic
988497029 5:31754217-31754239 TCCTCGCGCCCTCTTCAGGAGGG + Intronic
991681657 5:69146088-69146110 TCCTGTCTTCCTCTTAGTGAAGG + Intergenic
992361896 5:76047264-76047286 TCATGGGTTACTCTTGAGGGTGG - Intergenic
994244668 5:97466436-97466458 TCCTGGCAACCTCTCGAAGAAGG - Intergenic
995206024 5:109482497-109482519 TTCTGGCTCCCACTTTAGGAAGG - Intergenic
995265562 5:110155185-110155207 TCCTGTCTTCCTTTTAATGAAGG - Intergenic
996560326 5:124821250-124821272 TCCTGACCTCCTCTAGTGGATGG - Intergenic
996931438 5:128893939-128893961 TCCTGTCTTCCTTTTAATGAAGG + Intronic
998151632 5:139760669-139760691 TCCTGGCACCCTATGGAGGAGGG + Intergenic
998443521 5:142181180-142181202 TCCTGGCTTCCTTGTGATAAAGG + Intergenic
998453694 5:142254007-142254029 TCCAGGTTTCCACTTGAGGGAGG + Intergenic
999032408 5:148308471-148308493 TCCTGGTTTCATCATGAAGAAGG - Intergenic
1000889753 5:166788259-166788281 TCCTGTCTTCCTCTAGGGCAAGG - Intergenic
1001274470 5:170340367-170340389 ACCTGCCTTCCTCTTCTGGAAGG - Intergenic
1004276548 6:14241510-14241532 TCCTGGCCTCCTTTTGAGAAGGG + Intergenic
1004400183 6:15281469-15281491 TGATGGCTTACTTTTGAGGAAGG - Intronic
1005354656 6:24970522-24970544 TCTCGGGTTCCTCCTGAGGAGGG - Intronic
1006378238 6:33683587-33683609 TCCAGGCTTCCTCTGGAAGGAGG - Intronic
1006554704 6:34855839-34855861 TCCAGACGTCCTCTTGAAGAGGG - Intronic
1010070785 6:71742189-71742211 TCCTGTTTTACTCTGGAGGATGG + Intergenic
1010193654 6:73218870-73218892 TGTTGGCTTCCTCTTCAGGTTGG - Intronic
1010197055 6:73250478-73250500 TGTTGGCTTCCTCTTCAGGTTGG - Intronic
1010314050 6:74424075-74424097 TCCTGCCTTCCTCTTAGTGAAGG - Intergenic
1010653331 6:78480434-78480456 TCTTGCCTTCCTCTTATGGAGGG - Intergenic
1011160557 6:84385228-84385250 TCTTTGCTTAGTCTTGAGGAGGG - Intergenic
1015263617 6:131266105-131266127 CTCTGGCTTACTCTTCAGGAAGG + Intronic
1016011912 6:139145883-139145905 TCCTTGGTTGCTCTTGGGGAGGG + Intronic
1016230024 6:141791581-141791603 TCCTGTCTTCCTTTTAATGAAGG - Intergenic
1016875553 6:148861208-148861230 TCCTGGTTTAGTCTTGGGGAGGG + Intronic
1018361188 6:163070603-163070625 TCCTGTCTTCCTCTTAGTGAAGG - Intronic
1018647428 6:165961372-165961394 TCCTGGCTTCCTTCTGAAGTAGG - Intronic
1018681607 6:166270154-166270176 TCCTTGCTGCTTCCTGAGGATGG - Intergenic
1018917390 6:168144207-168144229 TCCTGTCTTCCTTTTAATGAAGG + Intergenic
1019060355 6:169252995-169253017 GCCTGGCTACCACTTAAGGAAGG - Intronic
1019733374 7:2639114-2639136 TTGTTGCTTCCTCTGGAGGAGGG + Intronic
1021629971 7:22635197-22635219 TTCTGACATCCTCTTGGGGAAGG + Intergenic
1022343236 7:29487768-29487790 TACTGGATGCCTCTGGAGGAAGG - Intronic
1022451923 7:30523692-30523714 TCCTGGCTTCCCCTTGAGACTGG + Intronic
1022580200 7:31545373-31545395 GCTTTGCTTCATCTTGAGGAGGG - Intronic
1022749652 7:33211248-33211270 TCCTGTCTTCCTTTTAATGAAGG + Intronic
1023105739 7:36761624-36761646 TCCTGGCAGCCTGGTGAGGAAGG + Intergenic
1025288827 7:57693811-57693833 TCCTGGCTTCCCCTTGGAGAAGG - Intergenic
1026352885 7:69532959-69532981 TCCTTCCTTCCTTTTGAGGCAGG - Intergenic
1027245742 7:76366076-76366098 TTCTGGCTTCCTCCTGTGGCTGG + Intergenic
1029256161 7:99271046-99271068 TCGGGGCTTCCTCATGAGGGTGG + Intergenic
1030678529 7:112409527-112409549 TGCCGGCATCCTCTTGAGCAGGG + Intergenic
1031077601 7:117227865-117227887 ACCTGGCACCCGCTTGAGGATGG + Intronic
1032097808 7:128948145-128948167 TCCTGGCTGCCTCTTGCCCAGGG + Intronic
1032207188 7:129877515-129877537 TTCTTGTTTCCTCTAGAGGAAGG - Intronic
1034210074 7:149355808-149355830 TCCTAGATTCCGCTTCAGGATGG + Intergenic
1034213776 7:149387380-149387402 TCATGGCTTCCTGTGGAGGTGGG - Intergenic
1035038115 7:155908504-155908526 TCCTGGATTCATCTTGAACAAGG - Intergenic
1035185786 7:157125182-157125204 GCCTGCCTTCCTCCCGAGGAAGG + Intergenic
1036032568 8:4990722-4990744 TCCTGGCTTCATCAGGAGGAAGG + Intronic
1036196184 8:6717055-6717077 TTCTGCCTTACTCTTGAGGGTGG - Intronic
1036519735 8:9479944-9479966 TCCTGGCTTCTCCCTGAGGAGGG + Intergenic
1038094212 8:24289675-24289697 TCCTGCTTGCTTCTTGAGGAGGG - Intergenic
1038132177 8:24744919-24744941 TCCTGTCTTCCACTGGAGAAGGG - Intergenic
1039420943 8:37439503-37439525 TCCTGGCTTCCTTTTAGTGAAGG + Intergenic
1040987951 8:53317165-53317187 TGCTGGCTTCCTCTTGAGAAGGG + Intergenic
1041439264 8:57876049-57876071 TTCTGGCTTCCTGTCTAGGAAGG + Intergenic
1043176358 8:77027299-77027321 TCATGGCCTCCTGTTGAGGTGGG + Intergenic
1044988738 8:97776666-97776688 TCTTGGCATCCTCTTGTGAATGG + Intronic
1045508333 8:102794426-102794448 TCCTGGATTCCACTTGGGGCTGG + Intergenic
1046149946 8:110211077-110211099 ACCTTCCTTCCACTTGAGGACGG + Intergenic
1046768307 8:118093897-118093919 TGATGGCTTCTTCTTGAGGATGG - Intronic
1046848382 8:118944454-118944476 TCCTAGCCTCCTGGTGAGGATGG - Intronic
1047409692 8:124614276-124614298 TCCTGGCCTCCAATTGAGCAAGG - Intronic
1047728807 8:127708810-127708832 TCCTGGCTTCCCTTGCAGGAAGG - Intergenic
1048323690 8:133422436-133422458 TGATGGCTTCCTTGTGAGGAAGG - Intergenic
1048496313 8:134939036-134939058 TCCTTGCTCCCTCTTTAGGGAGG + Intergenic
1048624650 8:136171868-136171890 TCCTGTCATCCAATTGAGGAAGG - Intergenic
1049299499 8:141862123-141862145 TCCTGGCTTCCTGTTCATGGAGG + Intergenic
1049955523 9:689408-689430 CCCTGCCTTCCACATGAGGAGGG - Intronic
1050392427 9:5159195-5159217 TCCTGTCTTCCTTTTAGGGAAGG - Intronic
1050616178 9:7404024-7404046 TGCTGGCTTCCTCTAGATGAAGG + Intergenic
1052742580 9:32407603-32407625 TCCTGGTTTCCTCTTGCTGCTGG - Intronic
1052972503 9:34385636-34385658 TACTGGCTTTCTCAAGAGGAAGG - Exonic
1054718943 9:68584585-68584607 TTCTGGCGCCCTCTTGTGGAGGG - Intergenic
1054951674 9:70858905-70858927 TCCTTGCTGCCTCTCCAGGATGG + Intronic
1055018078 9:71640535-71640557 TCCTTGCTTCTTGTTGAAGAAGG - Intergenic
1055904598 9:81278096-81278118 GTCTGTCTTCCTCTTAAGGAAGG + Intergenic
1057470960 9:95355847-95355869 CCCTGGCTTTCACTTGTGGAGGG + Intergenic
1057825629 9:98370308-98370330 TCCTGCCGTCCTCTTGATGCAGG - Intronic
1058091225 9:100808099-100808121 AGCTGGCTCCCTCTTAAGGAGGG - Intergenic
1059500197 9:114745949-114745971 TGCTCCCTTCATCTTGAGGAAGG - Intergenic
1059784567 9:117566490-117566512 TTATGGCTGCCTCTTGAGGTAGG + Intergenic
1061109166 9:128555003-128555025 TCCTGGGATCCTCAGGAGGAAGG + Intronic
1061735149 9:132650169-132650191 TCCTGCCTTCCTATTCAGTAAGG - Intronic
1062015302 9:134288236-134288258 TCGCGGCTTCCTCTGGAGCAGGG - Intergenic
1062043178 9:134413524-134413546 TTCTGGCCTCCTCTTAAGGGTGG - Intronic
1062697188 9:137881399-137881421 GCCTGGCTTCCTGGGGAGGAAGG + Intronic
1203611713 Un_KI270749v1:13146-13168 TCCTGGCTTCCCCTTGGAGAAGG + Intergenic
1188797714 X:34485655-34485677 TCCTAGAGTCCTCTGGAGGAGGG - Intergenic
1188924306 X:36020906-36020928 TCCTGTCTTCCTCTTAGGGATGG + Intergenic
1189032769 X:37466932-37466954 ACCTGGCTCCATCTTGAGGATGG + Intronic
1190933052 X:54966643-54966665 TCGTGGCTTCACCTAGAGGAAGG - Intronic
1192725997 X:73752667-73752689 CCCTTCCTTCCACTTGAGGAAGG - Intergenic
1192890868 X:75389449-75389471 TCCTTCCTTCTGCTTGAGGAGGG + Intronic
1193219814 X:78910945-78910967 TCCTGGCTTCCTTTTAGTGAAGG + Intergenic
1193284954 X:79701422-79701444 GCATTCCTTCCTCTTGAGGATGG + Intergenic
1195172347 X:102281606-102281628 CCCTTCCTTCCACTTGAGGAGGG - Intergenic
1195186514 X:102405487-102405509 CCCTTCCTTCCACTTGAGGAGGG + Intronic
1195820256 X:108937381-108937403 TCCTGCCTTCCTTTTAGGGAAGG + Intergenic
1196616759 X:117775281-117775303 TTCTGGTTTCCTATTGAGTATGG + Intergenic
1196760166 X:119193791-119193813 TGCTGGCTGACTCTTAAGGAAGG - Intergenic
1196921543 X:120590727-120590749 TCCTGGGTTTCCCATGAGGATGG - Intergenic
1197661315 X:129176610-129176632 TCCTGTCTTCCTTTTAATGAAGG + Intergenic
1198293947 X:135266175-135266197 TCCTGTCTTCCTCTTAGTGAAGG - Intronic
1199672561 X:150159241-150159263 TCCTGGCTTGCACCTGGGGAAGG + Intergenic
1199829238 X:151532440-151532462 TCCTGGCTGCCCCATAAGGAAGG - Intergenic