ID: 1138563757

View in Genome Browser
Species Human (GRCh38)
Location 16:57817531-57817553
Sequence CTTCAGTGCACCTCGGCTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 149}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138563748_1138563757 30 Left 1138563748 16:57817478-57817500 CCTAGGAGAGAATCCTTCTTTTC 0: 1
1: 1
2: 3
3: 37
4: 281
Right 1138563757 16:57817531-57817553 CTTCAGTGCACCTCGGCTTATGG 0: 1
1: 0
2: 0
3: 8
4: 149
1138563749_1138563757 17 Left 1138563749 16:57817491-57817513 CCTTCTTTTCCTCTTCCAGCTTC 0: 2
1: 13
2: 97
3: 513
4: 1854
Right 1138563757 16:57817531-57817553 CTTCAGTGCACCTCGGCTTATGG 0: 1
1: 0
2: 0
3: 8
4: 149
1138563751_1138563757 8 Left 1138563751 16:57817500-57817522 CCTCTTCCAGCTTCTGCTGGAGG 0: 1
1: 2
2: 13
3: 185
4: 1217
Right 1138563757 16:57817531-57817553 CTTCAGTGCACCTCGGCTTATGG 0: 1
1: 0
2: 0
3: 8
4: 149
1138563755_1138563757 2 Left 1138563755 16:57817506-57817528 CCAGCTTCTGCTGGAGGCGGGCG 0: 1
1: 0
2: 3
3: 16
4: 176
Right 1138563757 16:57817531-57817553 CTTCAGTGCACCTCGGCTTATGG 0: 1
1: 0
2: 0
3: 8
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138563757 Original CRISPR CTTCAGTGCACCTCGGCTTA TGG Intronic
907942543 1:59103213-59103235 CTACTGTGAACCTAGGCTTATGG - Intergenic
908416105 1:63914848-63914870 CTTCCATGCACCTTGGCTGATGG + Intronic
908874347 1:68653418-68653440 CTTCACTTCACCTCAACTTAAGG - Intergenic
911814541 1:102329072-102329094 CTTGGTTGCACCTCTGCTTAGGG + Intergenic
916572374 1:166038973-166038995 CTCCAGTGCTGCTCTGCTTAGGG + Intergenic
916788591 1:168104851-168104873 GGTCAGTGCACCTCGGCGTGGGG + Exonic
917417154 1:174822352-174822374 CTTCAGTGCACCTTAGATTGGGG + Intronic
923093920 1:230760103-230760125 CTGATGTGCACCTCGGCTGAGGG - Intronic
1075543484 10:123335931-123335953 CTTCAGTGCACCTCTGATTTTGG - Intergenic
1080614817 11:33936658-33936680 CTTCAGTATAGCTTGGCTTATGG + Intergenic
1081058733 11:38445919-38445941 CTTCAGTGTACCTGGGACTATGG - Intergenic
1084779174 11:71397385-71397407 CTTGAGTCCTCCTCGGCTTGTGG - Intergenic
1090667935 11:128927203-128927225 CTCCAGTGCAGCTGGGCTCAGGG - Intergenic
1093921250 12:24862143-24862165 CTTCAGTGCTGCTCTGCTTATGG + Intronic
1095878511 12:47107231-47107253 GCACAGTGCACCTAGGCTTACGG - Intronic
1101557092 12:105820552-105820574 CTGCAGTGCATGTCAGCTTAAGG - Intergenic
1102988902 12:117300665-117300687 CTTCAGTGCCCCACTTCTTAGGG - Intronic
1106363683 13:29056809-29056831 CTTCAGTTCACCTCGGATTTTGG + Intronic
1113560516 13:111275910-111275932 CTTCAGTTCACGTGGGCTTCGGG - Intronic
1114586862 14:23823376-23823398 CTTCAGTTCACCTCTGATTTTGG + Intergenic
1121790840 14:96698552-96698574 CTTCAGTGACCCTCATCTTAAGG + Intergenic
1133214573 16:4283825-4283847 CTTCAGTGCACACCGTCTTTTGG + Intergenic
1133526920 16:6614683-6614705 CTTTGGTGTTCCTCGGCTTATGG + Intronic
1138563757 16:57817531-57817553 CTTCAGTGCACCTCGGCTTATGG + Intronic
1138976212 16:62211448-62211470 CTTCAGTTCACCTCTGATTTTGG + Intergenic
1141325309 16:83051681-83051703 CTTAAGTAAACCTCTGCTTATGG + Intronic
1145829781 17:27906719-27906741 CTTCTGTGCACCTCTGCATGGGG + Intergenic
1148759502 17:49992309-49992331 TATCTGTGCACCTCTGCTTATGG - Intronic
1150581767 17:66480858-66480880 CTTCAGTGAACCATGGCTGAAGG + Intronic
1160370403 18:78368360-78368382 CTTCAGGGCACCCTGGCTTCGGG + Intergenic
925783185 2:7402860-7402882 CTTCAGGGCACCCAGGCTGAAGG - Intergenic
927697891 2:25250573-25250595 CTTCAGTGCACCTTCTCGTAGGG - Intronic
929279721 2:40064791-40064813 CTTTAGTGCACCTCGTCTCCTGG - Intergenic
932482859 2:72058546-72058568 CTTCAGTTCACCTCTGATTTTGG + Intergenic
944963532 2:204902869-204902891 CTTCAGTGCATCTAGTTTTATGG + Intronic
945337236 2:208606701-208606723 CTTTAGTGCTCCTTGGCCTATGG - Intronic
945553361 2:211248994-211249016 CTTCTGTGATCCTGGGCTTAAGG - Intergenic
948328714 2:237148576-237148598 CTTCACTGCACATGGGGTTAAGG - Intergenic
948588834 2:239036937-239036959 CTGCAGGGCACCTCGGTTCAGGG - Intergenic
1170492419 20:16891774-16891796 CTTCAGTTCAGCTCTGCTTTTGG - Intergenic
1171362250 20:24595954-24595976 CTTCAGTTCACCTCTGATTCTGG + Intronic
1173347414 20:42213715-42213737 CCTCCGTGCTCCTTGGCTTATGG - Intronic
1178354329 21:31897941-31897963 GTTAAGTGCACTTGGGCTTATGG + Intronic
1183069288 22:35385114-35385136 CTTGAGTGTACCTTGGCTTGGGG - Intronic
1184815968 22:46870220-46870242 GTTCAGTGCACCTGGGTTCAAGG - Intronic
950080979 3:10221960-10221982 CTGGAGTGCACCTCTGCTTCCGG + Intronic
961522412 3:127474631-127474653 CTGCAGTGGACCTCGCCATATGG - Intergenic
967750206 3:193105198-193105220 TTTCAGTTCACCTCGGATTTTGG + Intergenic
972527037 4:39924176-39924198 CTTCAGCCCACCTCAGCTTACGG + Intronic
976941872 4:90712141-90712163 CTTCAGTGCAGCTCTGATTTTGG + Intronic
986279675 5:6313205-6313227 CATCAGTGGGCCTTGGCTTAAGG - Intergenic
986409653 5:7464587-7464609 GGTCAGTTCACCTCAGCTTAGGG + Intronic
988870858 5:35387859-35387881 CTTCAGTTCACCTCTGATTTTGG - Intergenic
993794705 5:92252232-92252254 CTTCAGTGCAGCTCTGATTTTGG - Intergenic
994326209 5:98448537-98448559 CTTCAGTGGCCCTGGGCTTCAGG + Intergenic
995154761 5:108897713-108897735 CTTCAGTGCATCTCAGCTGCTGG - Exonic
995666031 5:114543773-114543795 CTTCAGTTCACCTCTGATTTTGG - Intergenic
995672038 5:114616091-114616113 CTTCAGTTCACCTCTGGTTTTGG - Intergenic
995960307 5:117830796-117830818 CTTCAGTTCACCTCTGATTTCGG + Intergenic
1003129171 6:3380706-3380728 CTTCAGTGCAACACAGCTTGTGG - Intronic
1003283543 6:4714308-4714330 CATCAGAGCACCTGGGCTCAAGG + Intronic
1005282986 6:24294463-24294485 CTTCAGTTCACCTCTGATTTTGG - Intronic
1006147581 6:31968630-31968652 CCTCAGTGCACCCCTGCTAAGGG + Intronic
1007667303 6:43522682-43522704 CTTCAGTCCACTTCGGCTCTCGG + Exonic
1008706353 6:54165284-54165306 CCTCCCTGCACCTCTGCTTATGG + Intronic
1011522913 6:88229082-88229104 CTGCAGTGAACCTGGGCTTCAGG + Intergenic
1015028893 6:128570344-128570366 CTTCAGTACAGCTCGGCATGTGG - Intergenic
1016237873 6:141890170-141890192 CTTCAGTTCAGCTCTGATTATGG - Intergenic
1018661989 6:166096861-166096883 CTTCAGTTCACCTCTGATTTTGG + Intergenic
1019184533 6:170213412-170213434 CTTCAGTGCACCCCGCCTTGGGG - Intergenic
1019184572 6:170213622-170213644 CTTCAGTGCACCCCGCCTTCCGG - Intergenic
1019184582 6:170213675-170213697 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019184621 6:170213884-170213906 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019184670 6:170214146-170214168 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019184678 6:170214199-170214221 CTTCAGTGCTCCCCGCCTTCTGG - Intergenic
1019184689 6:170214252-170214274 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019184722 6:170214406-170214428 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019184733 6:170214459-170214481 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019184754 6:170214564-170214586 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019184775 6:170214669-170214691 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019184786 6:170214721-170214743 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019184796 6:170214773-170214795 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019184807 6:170214826-170214848 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019184830 6:170214930-170214952 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019184839 6:170214982-170215004 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019184849 6:170215035-170215057 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019184868 6:170215139-170215161 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019184877 6:170215191-170215213 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019184888 6:170215244-170215266 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019184897 6:170215296-170215318 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019184906 6:170215348-170215370 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019184917 6:170215401-170215423 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019184928 6:170215454-170215476 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019184981 6:170215711-170215733 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019184992 6:170215764-170215786 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185074 6:170216129-170216151 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185209 6:170216748-170216770 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185233 6:170216852-170216874 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185287 6:170217113-170217135 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185299 6:170217165-170217187 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185320 6:170217270-170217292 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185331 6:170217322-170217344 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185341 6:170217374-170217396 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185352 6:170217427-170217449 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185363 6:170217480-170217502 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185445 6:170217845-170217867 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185533 6:170218256-170218278 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185557 6:170218360-170218382 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185612 6:170218621-170218643 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185624 6:170218673-170218695 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185645 6:170218778-170218800 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185656 6:170218830-170218852 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185667 6:170218882-170218904 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185678 6:170218935-170218957 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185701 6:170219039-170219061 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185710 6:170219091-170219113 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185720 6:170219144-170219166 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185730 6:170219196-170219218 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185740 6:170219248-170219270 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185768 6:170219404-170219426 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185778 6:170219457-170219479 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185787 6:170219509-170219531 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185798 6:170219562-170219584 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185808 6:170219614-170219636 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185819 6:170219667-170219689 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185828 6:170219719-170219741 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185837 6:170219771-170219793 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185848 6:170219824-170219846 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185859 6:170219877-170219899 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185878 6:170219982-170220004 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185889 6:170220035-170220057 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185900 6:170220088-170220110 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185911 6:170220141-170220163 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185929 6:170220246-170220268 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185940 6:170220299-170220321 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185961 6:170220405-170220427 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185970 6:170220457-170220479 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185979 6:170220509-170220531 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185990 6:170220562-170220584 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019186001 6:170220615-170220637 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019186020 6:170220717-170220739 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019186030 6:170220769-170220791 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1024309506 7:47956455-47956477 CTGCAGGGAACCTGGGCTTAGGG + Intronic
1028645543 7:93092932-93092954 CTTCAGTGTTCTTGGGCTTAGGG - Intergenic
1033167106 7:139049510-139049532 CTTCTGTGCACCTCCTCTTCTGG + Intronic
1042315925 8:67425769-67425791 CTTCAGTGTCCCTCTGGTTAGGG + Intronic
1048035578 8:130674192-130674214 ATTCAGTGTTCCTTGGCTTAAGG - Intergenic
1057739117 9:97696856-97696878 CTTCGCTGCACCTCGGCTGCTGG - Intronic
1060126912 9:121056020-121056042 TTTCAGTGTTCCTGGGCTTAGGG + Intergenic
1062195062 9:135268460-135268482 ATTCAGTGCACCCCGGCTTGTGG - Intergenic
1185764502 X:2714818-2714840 CTTCACTGCACTTTGTCTTAAGG - Intronic
1186985129 X:15004282-15004304 TTTCAGTGAACCTGGGCTTAAGG + Intergenic
1192296866 X:69859230-69859252 CTTCAGTTCACCTCTGATTTTGG + Intronic
1193446820 X:81615824-81615846 CTTCCTTGCTCCTCAGCTTATGG + Intergenic
1194130129 X:90071337-90071359 CTTCAGTTCAGCTCTGATTATGG + Intergenic
1196856839 X:119992111-119992133 CTCCAGAGCACCTTGGATTACGG - Intergenic
1197137290 X:123076550-123076572 CTTCAGTGCCCCCCACCTTATGG - Intergenic
1197158841 X:123300670-123300692 CTTCAGTTCAGCTCTGCTTTTGG + Intronic