ID: 1138564010

View in Genome Browser
Species Human (GRCh38)
Location 16:57819325-57819347
Sequence CAGGCACATGATACTGTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 7932
Summary {0: 1, 1: 14, 2: 127, 3: 970, 4: 6820}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138564010_1138564015 4 Left 1138564010 16:57819325-57819347 CCAGGCACAGTATCATGTGCCTG 0: 1
1: 14
2: 127
3: 970
4: 6820
Right 1138564015 16:57819352-57819374 GCTAGCTACCTGGGAGGCTGAGG 0: 4
1: 371
2: 10511
3: 117520
4: 226040
1138564010_1138564011 -6 Left 1138564010 16:57819325-57819347 CCAGGCACAGTATCATGTGCCTG 0: 1
1: 14
2: 127
3: 970
4: 6820
Right 1138564011 16:57819342-57819364 TGCCTGTAGTGCTAGCTACCTGG 0: 2
1: 124
2: 3682
3: 46993
4: 150873
1138564010_1138564016 11 Left 1138564010 16:57819325-57819347 CCAGGCACAGTATCATGTGCCTG 0: 1
1: 14
2: 127
3: 970
4: 6820
Right 1138564016 16:57819359-57819381 ACCTGGGAGGCTGAGGAGAGAGG 0: 2
1: 98
2: 2058
3: 14997
4: 42312
1138564010_1138564014 -2 Left 1138564010 16:57819325-57819347 CCAGGCACAGTATCATGTGCCTG 0: 1
1: 14
2: 127
3: 970
4: 6820
Right 1138564014 16:57819346-57819368 TGTAGTGCTAGCTACCTGGGAGG 0: 2
1: 202
2: 5374
3: 60975
4: 181983
1138564010_1138564012 -5 Left 1138564010 16:57819325-57819347 CCAGGCACAGTATCATGTGCCTG 0: 1
1: 14
2: 127
3: 970
4: 6820
Right 1138564012 16:57819343-57819365 GCCTGTAGTGCTAGCTACCTGGG 0: 3
1: 124
2: 3638
3: 48070
4: 188914
1138564010_1138564018 15 Left 1138564010 16:57819325-57819347 CCAGGCACAGTATCATGTGCCTG 0: 1
1: 14
2: 127
3: 970
4: 6820
Right 1138564018 16:57819363-57819385 GGGAGGCTGAGGAGAGAGGATGG 0: 5
1: 166
2: 1934
3: 8716
4: 74892

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138564010 Original CRISPR CAGGCACATGATACTGTGCC TGG (reversed) Intronic
Too many off-targets to display for this crispr