ID: 1138572307

View in Genome Browser
Species Human (GRCh38)
Location 16:57883839-57883861
Sequence TCACCCATGAACTTTAAAAG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 6, 3: 14, 4: 108}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138572303_1138572307 4 Left 1138572303 16:57883812-57883834 CCATGTATTGGAGCCTCATTTTA 0: 1
1: 0
2: 1
3: 12
4: 144
Right 1138572307 16:57883839-57883861 TCACCCATGAACTTTAAAAGTGG 0: 1
1: 0
2: 6
3: 14
4: 108
1138572302_1138572307 5 Left 1138572302 16:57883811-57883833 CCCATGTATTGGAGCCTCATTTT 0: 1
1: 0
2: 0
3: 17
4: 173
Right 1138572307 16:57883839-57883861 TCACCCATGAACTTTAAAAGTGG 0: 1
1: 0
2: 6
3: 14
4: 108
1138572304_1138572307 -9 Left 1138572304 16:57883825-57883847 CCTCATTTTATCCCTCACCCATG 0: 1
1: 1
2: 3
3: 30
4: 301
Right 1138572307 16:57883839-57883861 TCACCCATGAACTTTAAAAGTGG 0: 1
1: 0
2: 6
3: 14
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138572307 Original CRISPR TCACCCATGAACTTTAAAAG TGG Exonic
904791899 1:33028838-33028860 TCAATCATAAACTTTAAAGGTGG - Intronic
906824776 1:48967642-48967664 TCACAATTGAACTTTAAAAAGGG - Intronic
907135178 1:52133843-52133865 TCACCAATGAATGTTAAAAGTGG + Intergenic
907478167 1:54721796-54721818 TTAACCATGAACATTTAAAGAGG - Intronic
910148071 1:84106198-84106220 TCACCCATATACTTTTAAACAGG - Intronic
910453441 1:87371175-87371197 TCATGCATGTACTTAAAAAGTGG + Intergenic
911790512 1:102010351-102010373 TCAGCCATGACCTTTATAATGGG - Intergenic
912417250 1:109518011-109518033 TCTCCAAGGAACTTCAAAAGAGG + Intergenic
912691176 1:111805598-111805620 TTAGCCATGCTCTTTAAAAGAGG - Intronic
914997215 1:152554617-152554639 TCAGCCATCAACTTCACAAGAGG + Intronic
915115238 1:153594408-153594430 TCCCCCATGAACTCTAGATGTGG + Intergenic
916354840 1:163893367-163893389 TCAGCCATGAACATTACAATGGG - Intergenic
917783422 1:178425318-178425340 TCACCCATTAAGTTAAAAACTGG - Intronic
918768086 1:188514967-188514989 TCATCCATTAACTTTATATGGGG - Intergenic
919681316 1:200437588-200437610 TAACCATTGAACCTTAAAAGTGG + Intergenic
1068950729 10:62774535-62774557 TCATCCCTGAAGTTTTAAAGGGG - Intergenic
1069777902 10:70937526-70937548 TCACTCATGAACATCCAAAGAGG - Intergenic
1070014957 10:72517893-72517915 TCACCCCTGAAGTGTATAAGTGG - Intronic
1071790118 10:88944420-88944442 TTTCCCATGAACATTAAAATGGG - Intronic
1073956935 10:108883273-108883295 TCACCCATGAACATAAAATCAGG + Intergenic
1075983082 10:126758226-126758248 TCAGGCAGGAACTTTAAAGGGGG - Intergenic
1077988463 11:7379367-7379389 GAACACATGTACTTTAAAAGGGG - Intronic
1080450951 11:32378499-32378521 TCAACAATGAGCTTTAACAGGGG - Intergenic
1081614452 11:44582288-44582310 CCACCCAAGAACTTGAAATGAGG - Intronic
1082727282 11:56751370-56751392 TCACACACCAACTTTACAAGTGG + Intergenic
1095131378 12:38547497-38547519 TTATCCATGAACTTTTAAAGAGG + Intergenic
1095635282 12:44425731-44425753 TCAGCCCTGAACTTTAGTAGGGG + Intergenic
1098162760 12:67661988-67662010 CCACCCATTAAGTTTAAAAGTGG - Exonic
1099733019 12:86529231-86529253 TTACACATGAACTTTATGAGTGG - Intronic
1105733646 13:23245664-23245686 TCACCCAGAAAATTTAAAGGCGG - Intronic
1109588970 13:64450673-64450695 AAACCCATTAACTTTATAAGAGG + Intergenic
1109627423 13:64993820-64993842 ACAACCATGAACCTTAAAAAAGG + Intergenic
1112471705 13:99695267-99695289 TCAGCCATGAACTTTGCAAGGGG - Intronic
1113006606 13:105710894-105710916 TCTCCCAGAAAATTTAAAAGGGG - Intergenic
1116476337 14:45344842-45344864 TCAGCCATGACTTTTTAAAGAGG - Intergenic
1120034384 14:79680151-79680173 TAATCCATAAACTTTAACAGGGG + Intronic
1128831768 15:70775914-70775936 TCACCCATGAGCTTGAAATTAGG - Intergenic
1136182476 16:28563324-28563346 TCAGCCACGAACTTTCAAAGTGG - Intronic
1138572307 16:57883839-57883861 TCACCCATGAACTTTAAAAGTGG + Exonic
1138900256 16:61260514-61260536 GCATTCCTGAACTTTAAAAGTGG - Intergenic
1140193684 16:72839088-72839110 TCACACATGAAATGTAAAAAAGG + Intronic
1140570992 16:76105992-76106014 TTTCCCATGAAATTTGAAAGGGG + Intergenic
1148883617 17:50754334-50754356 TCACTCATGAAGTATAAAAGTGG - Exonic
1149428624 17:56578812-56578834 TCACCCATGAAATTCATAATGGG - Intergenic
1153284995 18:3449299-3449321 TCACCCCTTAGCTATAAAAGTGG + Intronic
1153406062 18:4740924-4740946 TCAGCCATGAACTTTACAATGGG + Intergenic
1153667370 18:7378345-7378367 TCACCTATAAGCTGTAAAAGTGG + Intergenic
1156989889 18:43396588-43396610 TCAACCATGAACCTTGCAAGGGG - Intergenic
1157859215 18:51125687-51125709 TCACACATGAACTTGAAGGGTGG + Intergenic
1159809450 18:72999089-72999111 TCACCCATGAACTGGGAAATGGG - Intergenic
1159848263 18:73493102-73493124 TCAAGCATAAACTTTCAAAGAGG + Intergenic
1162251596 19:9448810-9448832 ACACCCATGGACTCAAAAAGTGG + Intergenic
928832414 2:35503268-35503290 TCATCCATGAATTTTGAAACAGG + Intergenic
931523165 2:63121678-63121700 TCTCCCAGGTACTTTAAAAAAGG - Exonic
934865391 2:97805286-97805308 ACAGCAATGTACTTTAAAAGTGG + Intronic
935918499 2:107985105-107985127 TTACCCATGTGTTTTAAAAGAGG - Intergenic
936712236 2:115144495-115144517 TGACCCATGAACTACAAACGTGG - Intronic
939313363 2:140513734-140513756 CAACCCCTGAAATTTAAAAGAGG + Intronic
939582984 2:143973304-143973326 TCCCTCATGAAATTTAAGAGTGG + Intronic
941241113 2:163039093-163039115 TCACAAATGAACTTTCAAACAGG + Intergenic
947343970 2:229171949-229171971 TCAGCCATGAAGATTAACAGTGG + Intronic
948828066 2:240583727-240583749 ACACCCATGAACCTGAGAAGTGG + Intergenic
1170231804 20:14056054-14056076 TTACCCATGACCTTTCATAGAGG + Intronic
1170315678 20:15039008-15039030 TCAGCCATGGACTCTATAAGGGG - Intronic
1177951757 21:27546856-27546878 TCACCGCTGAAGTTTATAAGTGG - Intergenic
1178195985 21:30345796-30345818 TCACCCAAGAGCTTTGAAAGGGG + Intergenic
1178567743 21:33703757-33703779 TCACCTATAACCTTTAAAGGGGG + Intronic
1182985179 22:34709508-34709530 TCACCAATGATCTGTGAAAGTGG - Intergenic
950316744 3:12008031-12008053 TTAGCCATGAACCTTAAAAGAGG - Intronic
951614332 3:24524559-24524581 TCACACATGAACTCTAAACTAGG + Intergenic
952248802 3:31628681-31628703 TTCCACATGAACTTTAAAATCGG - Intronic
956383665 3:68693438-68693460 TCACCTATTAACTCTAAATGTGG + Intergenic
957014744 3:75049777-75049799 TCACCCATGAGGCTTAAATGTGG - Intergenic
958116846 3:89231713-89231735 TCAGCCATAAACTTTATAATGGG - Intronic
960214504 3:115014909-115014931 TCACCCATAAACTTATAAAGTGG + Intronic
964247902 3:154674987-154675009 TGACACATTAACTTTGAAAGTGG - Intergenic
964820243 3:160760773-160760795 TCAGCCATGAACATTGATAGAGG - Intronic
966390443 3:179447580-179447602 GCCAGCATGAACTTTAAAAGAGG - Intronic
971551991 4:27968855-27968877 ATACCCATGTACTTTATAAGTGG - Intergenic
973781533 4:54292656-54292678 GTACCCCTGAACTTAAAAAGTGG + Intronic
975829517 4:78354542-78354564 AAACCCATCAATTTTAAAAGTGG + Intronic
977342636 4:95778450-95778472 TCACACAAGAACTATAAAACTGG - Intergenic
977581948 4:98735361-98735383 TCACCCATGAACCTTGCAATAGG + Intergenic
979415923 4:120438850-120438872 ACACCCATGGACTTTAATAAGGG + Intergenic
982034434 4:151331771-151331793 CCACCCATTTACATTAAAAGTGG - Intergenic
984310915 4:178057008-178057030 ACACCCATGAACTTTAAGAAAGG + Intergenic
986021343 5:3806651-3806673 TCACCCATTAACTTTGGTAGCGG + Intergenic
991678738 5:69116468-69116490 TCACCCATGAAGTTATAAAGAGG - Exonic
992439192 5:76783176-76783198 TCACTCAAGAACTTTAAAACTGG - Intergenic
993097878 5:83501783-83501805 TCCCACATGAATTTTAAAATTGG + Intronic
993725902 5:91366096-91366118 TCATCCTTCAACTATAAAAGGGG + Intergenic
996156275 5:120106477-120106499 TTACCCATCAAATTTAGAAGTGG + Intergenic
996191719 5:120551885-120551907 TCATCCATGAACTCAAATAGTGG - Intronic
999840397 5:155419014-155419036 TCACTCATGAATTTTTATAGTGG - Intergenic
1000441122 5:161264660-161264682 ACACCCATAATCATTAAAAGTGG - Intergenic
1007437189 6:41822960-41822982 TCATTCATGTACTTTAATAGGGG + Intronic
1009987390 6:70797401-70797423 TCACACAGGAGCTTTCAAAGTGG - Intronic
1010528367 6:76932927-76932949 TTCCCCATAAGCTTTAAAAGTGG + Intergenic
1012802902 6:103856373-103856395 TCATCCATGAAATTTATGAGAGG + Intergenic
1015414001 6:132927947-132927969 TCACTCATGGACTATAGAAGTGG + Intergenic
1016894406 6:149038084-149038106 TGACCCAAAACCTTTAAAAGTGG + Intronic
1020930718 7:14389926-14389948 TCACCCTTTAACTTTAACAAGGG - Intronic
1021158048 7:17236287-17236309 TCACCCAGGAATTTAAAAGGAGG - Intergenic
1024621667 7:51163590-51163612 TCACCCTTGATTTTTAAAAGTGG + Intronic
1027789606 7:82622019-82622041 TCAACTATGAACTTTATAAAAGG - Intergenic
1030066095 7:105660282-105660304 TCACCCTGGAAATTTCAAAGCGG - Intronic
1030700387 7:112631849-112631871 TTACCCATTACATTTAAAAGAGG - Intergenic
1032504826 7:132427070-132427092 ACACTCACAAACTTTAAAAGTGG + Intronic
1036607831 8:10323218-10323240 CCAACCAAGAACTTAAAAAGTGG + Intronic
1039885496 8:41651873-41651895 TCACCCATGTACCTGGAAAGTGG - Intergenic
1039985331 8:42442685-42442707 TTCTACATGAACTTTAAAAGTGG + Intronic
1043534963 8:81192744-81192766 TCACCCTTGAAGTTTAAAGTAGG - Intergenic
1044552732 8:93530082-93530104 ACACCCATGAAAAGTAAAAGGGG + Intergenic
1045335494 8:101199857-101199879 TTACACATTAACTTAAAAAGGGG + Intronic
1047260396 8:123253605-123253627 TCACTCATAAAATTTAAAACTGG - Exonic
1050944921 9:11504511-11504533 TCTCCCATTAACTTTATAAATGG + Intergenic
1052191312 9:25666231-25666253 TCACCATTTAACTTTAAAGGAGG - Intergenic
1054827985 9:69591906-69591928 TCAGCTAAGAACTTTAAAAAAGG + Intronic
1056005563 9:82266852-82266874 TAACACCTGAACTTTAAAACTGG + Intergenic
1056515466 9:87345248-87345270 ACATCCATTAACTTGAAAAGAGG + Intergenic
1058200836 9:102038158-102038180 TGAACCATTAACTTTAAATGAGG + Intergenic
1186564355 X:10646213-10646235 ACACCCATCAACATTTAAAGCGG - Intronic
1189756673 X:44278934-44278956 TCAGCCATGAACTTTGAGATAGG + Intronic
1201858262 Y:18568932-18568954 TGACCCATAAACTTTAAAAGAGG + Intronic
1201875059 Y:18751449-18751471 TGACCCATAAACTTTAAAAGAGG - Intronic
1202168777 Y:22019133-22019155 TGACCCATGAATTTTAAAAGAGG - Intergenic
1202222584 Y:22567235-22567257 TGACCCATGAATTTTAAAAGAGG + Intergenic
1202320531 Y:23628425-23628447 TGACCCATGAATTTTAAAAGAGG - Intergenic
1202550236 Y:26041631-26041653 TGACCCATGAATTTTAAAAGAGG + Intergenic