ID: 1138574318

View in Genome Browser
Species Human (GRCh38)
Location 16:57897780-57897802
Sequence AAATAAGGTCAGACGCAGCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 100}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138574318_1138574323 29 Left 1138574318 16:57897780-57897802 CCCAGCTGCGTCTGACCTTATTT 0: 1
1: 0
2: 0
3: 7
4: 100
Right 1138574323 16:57897832-57897854 ACCAGCACAGATTTCCCATCAGG 0: 1
1: 0
2: 0
3: 22
4: 124
1138574318_1138574325 30 Left 1138574318 16:57897780-57897802 CCCAGCTGCGTCTGACCTTATTT 0: 1
1: 0
2: 0
3: 7
4: 100
Right 1138574325 16:57897833-57897855 CCAGCACAGATTTCCCATCAGGG 0: 1
1: 0
2: 1
3: 14
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138574318 Original CRISPR AAATAAGGTCAGACGCAGCT GGG (reversed) Exonic
909091449 1:71231139-71231161 AAATAATGTCAGACTAAGTTAGG - Intergenic
910487931 1:87736337-87736359 AGATAAGGTCACAAGCACCTAGG + Intergenic
911125079 1:94333859-94333881 AAAAAAAGTCAGATGCAGCTGGG + Intergenic
913270912 1:117092698-117092720 AAAAAAGGACAGGAGCAGCTGGG - Intronic
913288116 1:117246125-117246147 AAATCAGGTCAGTCACAGCTGGG - Intergenic
914212023 1:145588475-145588497 AAATGAGGCCAGATGCAGATGGG + Intergenic
914364823 1:146968986-146969008 AAATGAGGCCAGATGCAGATGGG - Intronic
914365585 1:146975281-146975303 AAATGAGGCCAGATGCAGATAGG - Intronic
914486856 1:148118159-148118181 AAATGAGGCCAGATGCAGATAGG + Intronic
917056247 1:170984938-170984960 AAATAGGGGCAGAAGCAGCAAGG + Intronic
917122653 1:171657772-171657794 AAATAAGAGCAGACACAGCCTGG + Intergenic
1065866041 10:29916344-29916366 AAATAAGCTCATAAGCAGCCGGG + Intergenic
1070998786 10:80811187-80811209 AAACAAGGTCAGAGGTAGTTTGG + Intergenic
1071534106 10:86413676-86413698 AAATAAAGTGAGTGGCAGCTGGG - Intergenic
1075731329 10:124638504-124638526 AAATGAGATCACAAGCAGCTCGG + Intronic
1075794775 10:125112092-125112114 AAAAAAAGTCAAATGCAGCTGGG - Intronic
1076075522 10:127530906-127530928 AAGAAAGGCCAGAAGCAGCTTGG - Intergenic
1076892266 10:133291105-133291127 GAATAAGGCCATAAGCAGCTGGG + Intronic
1079193758 11:18305601-18305623 GAATAAGGGCAGATGCAGTTAGG - Intronic
1082022386 11:47545618-47545640 AAATAAGGTCTCTGGCAGCTAGG - Intronic
1083555805 11:63626082-63626104 AAATAAGGCATGACTCAGCTGGG + Exonic
1087103183 11:94384622-94384644 AAATCAGGTCAGCGGCAGCGAGG + Intronic
1089579323 11:119471512-119471534 AAAAAAGATCAGAGGCAGCAGGG + Intergenic
1093086423 12:14870359-14870381 AAATGTGGTCAGAAGCAGATAGG - Intronic
1093826066 12:23690700-23690722 AGATAAGGTCAGAGGGAGTTAGG - Intronic
1093945122 12:25099347-25099369 AAATAGGGGCAGAGGGAGCTGGG + Intronic
1095096360 12:38151595-38151617 AAATAAGGACAGAAGCCGCGGGG + Intergenic
1096712234 12:53465761-53465783 AAATATGGTCAGACCCAAATTGG - Intronic
1101473458 12:105021108-105021130 AGATGAGGTCAGAGGTAGCTAGG + Exonic
1102162323 12:110779595-110779617 AAAGAAAGTCAGAGACAGCTGGG + Intergenic
1104540815 12:129663122-129663144 AAAAAAGGGCAGACGTTGCTGGG - Intronic
1108086664 13:46800228-46800250 AATTGAGGCCAGATGCAGCTGGG - Intergenic
1110182602 13:72635417-72635439 AAAAAAGGTCAGATAGAGCTTGG - Intergenic
1111317998 13:86586125-86586147 ATATAATGTCAGAAGCAGCCAGG - Intergenic
1116764937 14:49059005-49059027 AAATTAGGTCAGACACAGATGGG + Intergenic
1117118678 14:52545583-52545605 AAATAAGGAAACATGCAGCTAGG + Intronic
1120870265 14:89330387-89330409 AAATGAGGTCAGGGGCAGCTGGG - Intronic
1125573326 15:40737803-40737825 AAATAGGGTCAAACGGGGCTGGG + Intronic
1125601938 15:40920135-40920157 AAAGAAGGCCAGAGGCAGCTAGG - Intergenic
1126251466 15:46572758-46572780 ACATAATATCAGAGGCAGCTTGG - Intergenic
1128175213 15:65549290-65549312 AAGTAAGGTCAAACCCAGCCTGG + Intronic
1130445463 15:83997290-83997312 AAAAAAGGTCTGAAGCGGCTGGG + Intronic
1131316832 15:91346682-91346704 CAATAATGTCAGACTCATCTTGG + Intergenic
1131505128 15:93011057-93011079 AAAAAAGGCCAGATGCCGCTAGG - Intronic
1135039877 16:19110096-19110118 AAATAAAGACAGAGGTAGCTGGG + Intergenic
1135245718 16:20855314-20855336 AATTAAGCACAGACGGAGCTGGG + Exonic
1138574318 16:57897780-57897802 AAATAAGGTCAGACGCAGCTGGG - Exonic
1138867189 16:60836187-60836209 ACATAGGGTGAGACACAGCTAGG + Intergenic
1140629412 16:76833670-76833692 AAATAATGTCATATGCAGCCGGG + Intergenic
1144315527 17:14057295-14057317 ATATAAGGTGAGACTCATCTAGG - Intergenic
1144844877 17:18211826-18211848 AAAAAAAGTCAGACTCAGCCAGG + Intergenic
1150663920 17:67112388-67112410 ACATATAGTCAGAGGCAGCTTGG - Intronic
1151964827 17:77425828-77425850 AACCAGGGTCAGACACAGCTGGG - Intronic
1159422788 18:68244785-68244807 AAATAAAGCCATAAGCAGCTGGG - Intergenic
1160931485 19:1572253-1572275 AAAAAATGTCAGACGCGGCCGGG - Intergenic
1162298050 19:9827171-9827193 AGATAAGATCAGCCCCAGCTTGG - Intronic
1162904375 19:13814859-13814881 AAAAAAGGTCAGCCTCAGCCGGG + Intronic
1164212831 19:23115466-23115488 AAATAAGGTCAGCCGTATCTAGG - Intronic
1167390815 19:49193783-49193805 AAAGAAGGTCAGATGCAGAGAGG - Intronic
926113805 2:10198377-10198399 AAAGATGGTGAGACTCAGCTTGG - Intronic
929480699 2:42304834-42304856 AAATAAGCCCTGACGCAGCCAGG + Intronic
935628700 2:105193868-105193890 AAATAAGGTGACACGTATCTGGG + Intergenic
936232555 2:110715949-110715971 AAGTAAGGTCAGGAGCAGCAGGG + Intergenic
940953644 2:159704989-159705011 AAAAAAGGCCAGACGAGGCTGGG - Intergenic
941409804 2:165140614-165140636 GAATAATGTCAGTAGCAGCTAGG + Intronic
943544100 2:189253212-189253234 CAATAAGGTCAGAGACAGGTTGG + Intergenic
947932740 2:233977012-233977034 AAATCAGGTCACACCCTGCTTGG - Intronic
951619767 3:24588172-24588194 AACTAAGGTGGGAGGCAGCTGGG - Intergenic
952402429 3:32975380-32975402 AAAAAAGGCCAGACCCAGCCAGG - Intergenic
953072242 3:39532426-39532448 AAATAAGCTCAGGAGCTGCTTGG + Intergenic
954644344 3:52121769-52121791 AAATAAGGTCATATTCAGCTTGG - Intronic
955342312 3:58134544-58134566 AAGAAAAGTCAGATGCAGCTGGG + Intronic
959334939 3:105052287-105052309 AAATAAAGGCAGAAGCAGTTAGG - Intergenic
963068188 3:141280450-141280472 AAATGAGGGCAGAGGCAGCCAGG - Intronic
964734751 3:159905317-159905339 AACTACTGTCAGAAGCAGCTGGG + Intergenic
969468252 4:7370522-7370544 AAATAAGGTCCTTGGCAGCTTGG + Intronic
970651141 4:18179319-18179341 ACATTAGGTCAGAGGGAGCTGGG + Intergenic
971166731 4:24191207-24191229 AAATAGGGTCAACAGCAGCTTGG + Intergenic
972248207 4:37268888-37268910 AAATAATTTCAGATGCCGCTGGG - Intronic
973915061 4:55625220-55625242 AAAGAAGTTAAGATGCAGCTGGG - Intronic
976214732 4:82705313-82705335 AAATATCCTCAGAGGCAGCTTGG + Exonic
985102005 4:186467560-186467582 AAAGAAGGACAGAGGCAGGTTGG + Intronic
1202763356 4_GL000008v2_random:131357-131379 AAATAATGTTAAAGGCAGCTAGG - Intergenic
986828845 5:11552061-11552083 AAATAAAGACAGAGGCAGCAGGG - Intronic
988982964 5:36589991-36590013 AAATAATGTGATACACAGCTGGG + Intergenic
992630911 5:78679328-78679350 AAATAAGGACAGACTCAGAAAGG + Intronic
994157424 5:96519598-96519620 AAAAAAAGTAAGACGGAGCTAGG - Intergenic
999378339 5:151102406-151102428 CAAAAAAGTCAGACGCAGCCAGG + Intronic
1005786372 6:29249500-29249522 GAATAAGGTGAGAGGCAGATGGG + Intergenic
1010640618 6:78321918-78321940 AAAAAAGGTCTGATGCACCTTGG - Intergenic
1011410908 6:87065233-87065255 AATCAAGGTCACACCCAGCTTGG - Intergenic
1012162795 6:95907817-95907839 AAAAAAGGTCAAACTGAGCTGGG - Intergenic
1017854933 6:158342214-158342236 AAATAAGATCACACCAAGCTGGG - Intronic
1022252107 7:28618622-28618644 AGATACAGTCACACGCAGCTGGG + Intronic
1024424545 7:49210872-49210894 AAATAAAGACAAAAGCAGCTGGG + Intergenic
1024760227 7:52587270-52587292 AGATAAGGTCAGGAGAAGCTTGG - Intergenic
1029699855 7:102239277-102239299 GACTAAGGTCAGGCCCAGCTGGG - Intronic
1041541478 8:58989925-58989947 AATTGAGGTCAGACACAGGTTGG + Intronic
1052276805 9:26685905-26685927 AAATAAGGACAGATCAAGCTGGG + Intergenic
1052380576 9:27766680-27766702 AAATAAGGTCAGACTAAACCAGG + Intergenic
1052408510 9:28092771-28092793 AAGTAAGGAAAGACGCTGCTTGG - Intronic
1056225989 9:84495898-84495920 AAAAAAAGACAGACGCAGCCGGG - Intergenic
1056923255 9:90810443-90810465 AAATAAGGTCACACTCAGAGGGG + Intronic
1060882695 9:127129502-127129524 AAACAAGGTCAGCAACAGCTTGG - Intronic
1185874101 X:3688148-3688170 AAAAAAGGTAAAACCCAGCTGGG + Intronic
1186327675 X:8497674-8497696 ACAAAAGGAGAGACGCAGCTGGG - Intergenic
1192327535 X:70145623-70145645 AAATGAGGTCAGACATAGCCAGG - Intronic
1194706059 X:97177198-97177220 AGACAAGGTCACACTCAGCTGGG - Intronic