ID: 1138574629

View in Genome Browser
Species Human (GRCh38)
Location 16:57899789-57899811
Sequence CAAACTAAACAGAAACATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 462
Summary {0: 1, 1: 0, 2: 2, 3: 43, 4: 416}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138574629_1138574634 -1 Left 1138574629 16:57899789-57899811 CCTCCATGTTTCTGTTTAGTTTG 0: 1
1: 0
2: 2
3: 43
4: 416
Right 1138574634 16:57899811-57899833 GACAAGAGTGAAAGGGTGAAGGG 0: 1
1: 0
2: 5
3: 33
4: 482
1138574629_1138574638 27 Left 1138574629 16:57899789-57899811 CCTCCATGTTTCTGTTTAGTTTG 0: 1
1: 0
2: 2
3: 43
4: 416
Right 1138574638 16:57899839-57899861 CACCTCAGTAACCAGTCCCCGGG 0: 1
1: 0
2: 0
3: 17
4: 130
1138574629_1138574631 -9 Left 1138574629 16:57899789-57899811 CCTCCATGTTTCTGTTTAGTTTG 0: 1
1: 0
2: 2
3: 43
4: 416
Right 1138574631 16:57899803-57899825 TTTAGTTTGACAAGAGTGAAAGG 0: 1
1: 0
2: 2
3: 18
4: 193
1138574629_1138574632 -8 Left 1138574629 16:57899789-57899811 CCTCCATGTTTCTGTTTAGTTTG 0: 1
1: 0
2: 2
3: 43
4: 416
Right 1138574632 16:57899804-57899826 TTAGTTTGACAAGAGTGAAAGGG 0: 1
1: 0
2: 1
3: 20
4: 227
1138574629_1138574639 28 Left 1138574629 16:57899789-57899811 CCTCCATGTTTCTGTTTAGTTTG 0: 1
1: 0
2: 2
3: 43
4: 416
Right 1138574639 16:57899840-57899862 ACCTCAGTAACCAGTCCCCGGGG 0: 1
1: 0
2: 0
3: 3
4: 110
1138574629_1138574633 -2 Left 1138574629 16:57899789-57899811 CCTCCATGTTTCTGTTTAGTTTG 0: 1
1: 0
2: 2
3: 43
4: 416
Right 1138574633 16:57899810-57899832 TGACAAGAGTGAAAGGGTGAAGG 0: 1
1: 0
2: 3
3: 26
4: 361
1138574629_1138574637 26 Left 1138574629 16:57899789-57899811 CCTCCATGTTTCTGTTTAGTTTG 0: 1
1: 0
2: 2
3: 43
4: 416
Right 1138574637 16:57899838-57899860 TCACCTCAGTAACCAGTCCCCGG 0: 1
1: 0
2: 0
3: 9
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138574629 Original CRISPR CAAACTAAACAGAAACATGG AGG (reversed) Intronic
901803519 1:11723327-11723349 CAAACAAAACAGAAGCTTTGTGG - Exonic
902577246 1:17386177-17386199 CCCATTAAACAGAAGCATGGGGG - Intronic
906970085 1:50503649-50503671 CAAAAAAAAAAGTAACATGGTGG + Intronic
907467079 1:54645566-54645588 CAAACTAAACCTTAACACGGTGG - Intronic
909427522 1:75544334-75544356 TATAATAAACAGAAACATAGTGG - Intronic
909462242 1:75929997-75930019 CAAACTGAATAGAAACAAAGCGG - Intronic
909465480 1:75969383-75969405 CAAACTTAACAAAAACAGTGTGG + Intergenic
909701596 1:78530570-78530592 CAAGCCAAACAAAAACATGGTGG - Intronic
909783273 1:79576738-79576760 AATAATAAACAGAAAAATGGAGG + Intergenic
910441312 1:87255196-87255218 CAAAGTAAATAAAAACCTGGGGG + Intergenic
911846867 1:102764482-102764504 CAAACTTCAGAGAAGCATGGTGG + Intergenic
912028609 1:105209894-105209916 CAAACTAAACCTAAAGGTGGAGG + Intergenic
912179620 1:107204111-107204133 AAAACAAAACAGAAACATCTTGG - Intronic
912257608 1:108076938-108076960 CAAACTACAAAAGAACATGGAGG - Intergenic
913342944 1:117778223-117778245 CAAGCTAAACAGAACTATGCTGG - Intergenic
914984407 1:152443590-152443612 TAAACTCAAGAGACACATGGAGG - Intergenic
915280034 1:154816192-154816214 CAAACTCAACAGAAACGTAACGG - Intronic
917861717 1:179152044-179152066 CAATATAAACAAAGACATGGCGG + Intronic
918175662 1:182042540-182042562 AAAATAAAAAAGAAACATGGAGG - Intergenic
918180561 1:182083278-182083300 CAAAAAAAATAGACACATGGTGG + Intergenic
919269620 1:195322783-195322805 CTAACTACTCAGAAAAATGGAGG - Intergenic
920193331 1:204209669-204209691 CAAACAAAACTGAAACACAGAGG + Intronic
920931078 1:210388734-210388756 AAAACTAAACAGAAATTTGTGGG - Intronic
921372500 1:214438726-214438748 CACACTAACCAGAAACATAGGGG - Intronic
922048020 1:221965724-221965746 AGAACTAAACAGAAAACTGGGGG - Intergenic
923266342 1:232318242-232318264 CAAATCAGACAGAAACATTGAGG + Intergenic
924007905 1:239632706-239632728 GAACATAAACAGAAACATTGTGG + Intronic
1064131448 10:12713541-12713563 AAAACCAAAAAGAAACAGGGAGG + Intronic
1064765949 10:18671511-18671533 CAAAATAAACTGAGACATGAAGG - Intronic
1065675019 10:28164955-28164977 AAATCAAAACAGAAACATGGGGG + Intronic
1066069354 10:31790702-31790724 CAAATTAAACAGAAAGAAGTAGG - Intergenic
1066289114 10:33997888-33997910 CAAACAAAAAAGAAACATGGAGG + Intergenic
1066600426 10:37100051-37100073 CAAAGCAAACAGAAACAAAGTGG + Intergenic
1066621426 10:37355847-37355869 CAAACTGTACAAATACATGGAGG - Intronic
1068625379 10:59240663-59240685 CAAAGACAACAGAAATATGGAGG - Intronic
1068631905 10:59306882-59306904 CAAACAAAAAAGAATAATGGTGG + Intronic
1069570413 10:69491360-69491382 AAAACAAAACAAAAACTTGGAGG - Intronic
1069603228 10:69722828-69722850 CAAACTAATCAGAGACACGAAGG + Intergenic
1069848108 10:71386706-71386728 CAAAATACACAGATACATAGAGG - Intergenic
1070780318 10:79133767-79133789 CAAAGTTAACAGAAACAGAGGGG - Intronic
1071209465 10:83321742-83321764 CAAACTATTCTGAAACATAGAGG + Intergenic
1071214681 10:83386602-83386624 CAAACTATACAAAAAAATAGAGG - Intergenic
1071361857 10:84854793-84854815 AAATCTTAACAGAAGCATGGTGG - Intergenic
1071770772 10:88727042-88727064 CAAATTAAACAGAGAGATGGGGG - Intronic
1073218774 10:101852387-101852409 CAAACTAAACTAAACCATGCTGG - Intronic
1073710359 10:106029902-106029924 CAAATTAACCAGGAAAATGGAGG - Intergenic
1077521352 11:3037283-3037305 CAAACTAGAAAGAAACATGCTGG + Intronic
1077871559 11:6266511-6266533 CAAACAAACAAAAAACATGGAGG + Intronic
1078890891 11:15557839-15557861 AAAACTACACAAAGACATGGAGG + Intergenic
1079508137 11:21178221-21178243 CCAAGAAAACAGAAACATTGTGG - Intronic
1079531266 11:21456772-21456794 GAGACCAAAGAGAAACATGGTGG + Intronic
1079779758 11:24586310-24586332 AAAACTAAACAGAAGCATAATGG - Intronic
1080085721 11:28279430-28279452 GAGAACAAACAGAAACATGGTGG - Intronic
1081011285 11:37815673-37815695 GAGACTAAACAGAAATATGAAGG - Intergenic
1081160348 11:39741319-39741341 CACACTAACAGGAAACATGGTGG - Intergenic
1082313888 11:50693902-50693924 AAAACTAAACAGAAGCATTCTGG + Intergenic
1082318499 11:50763351-50763373 AAAACTACACAGAAGCATTGTGG - Intergenic
1085213775 11:74808883-74808905 CAATCCAAACAGGAACACGGAGG - Intronic
1085698227 11:78723655-78723677 CAGACTAAAAAGAAACAGGATGG - Intronic
1086642254 11:89174119-89174141 GAAACAAAACAGAAAAATGCTGG + Intergenic
1086683654 11:89705507-89705529 CAAACTATGCAGAAAGATGAGGG + Intergenic
1087665443 11:101041147-101041169 CAAAATAAAAAGAAACTTGAAGG - Intronic
1089026608 11:115277170-115277192 AAAACAAAACAGAAACTTGTAGG - Intronic
1089649928 11:119906169-119906191 CAAATTAAATAGAAACATAAAGG + Intergenic
1090846155 11:130531764-130531786 CAAACTAAACAGACTCATGAAGG + Intergenic
1090955727 11:131511573-131511595 CAAACAAAACAGAAACCCCGAGG + Intronic
1091878104 12:3953934-3953956 CAAACCAAACAAAAATAAGGTGG - Intergenic
1093415419 12:18914736-18914758 CAAACAAAACAAAAACATCCAGG - Intergenic
1093608214 12:21120440-21120462 GAAATTAAACAGAAACATAAAGG - Intronic
1093619502 12:21271337-21271359 GAAATTAAACAGAAACATAAAGG - Intronic
1093890955 12:24520208-24520230 CATACTTAACAGTAACATGAAGG + Intergenic
1093991907 12:25598951-25598973 CAAACTATTCTGAAAAATGGAGG + Intronic
1094669313 12:32553806-32553828 AATAATAAACAGAAACATGCTGG + Intronic
1095242357 12:39876264-39876286 CACACAAAACAGAAACATATAGG + Intronic
1095801222 12:46271244-46271266 CAGAGTAAACATCAACATGGAGG + Intergenic
1096135004 12:49192892-49192914 CAAACAAAAAACAAACAAGGAGG - Intronic
1096414393 12:51401103-51401125 CAAACAAAAGAAAAACATGTTGG - Intronic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1098075953 12:66731540-66731562 GAAACTATAAATAAACATGGTGG + Intronic
1098504833 12:71237449-71237471 CAAACCCAATAGAAAAATGGAGG + Intronic
1099101556 12:78447681-78447703 CAAAGTAGACAGATACATGTTGG - Intergenic
1099545488 12:83974514-83974536 CAAACTTACCATAAACTTGGTGG - Intergenic
1100007415 12:89910953-89910975 AAAACTCAACAGATACATGTGGG - Intergenic
1100416410 12:94381472-94381494 GAAACTAAACAGAAACAATAGGG + Intronic
1101376565 12:104176210-104176232 CAAATTATACAGAAACATACAGG - Intergenic
1102582089 12:113896218-113896240 CAAACCAAAGAGAAACATCCTGG + Intronic
1102784574 12:115594141-115594163 CAAACTAAGCAGACAGAGGGGGG - Intergenic
1104416964 12:128603512-128603534 CAGACTAAACACAGGCATGGAGG - Intronic
1105051027 12:133051072-133051094 CAAACAAAACACAGGCATGGTGG - Intronic
1105204593 13:18210059-18210081 TAAATTAAACACAAATATGGTGG + Intergenic
1105695902 13:22888414-22888436 CACACAAAACAGTTACATGGTGG + Intergenic
1108367313 13:49728814-49728836 CAGAATGAACAGAAACATTGTGG - Intronic
1108456580 13:50621094-50621116 CACATTATACAGAAACAAGGTGG - Intronic
1108896239 13:55332866-55332888 CAAACTATTCTGAAAGATGGTGG + Intergenic
1109620436 13:64897790-64897812 AAAAGTAAACAGAAACAAGAAGG + Intergenic
1110518188 13:76441543-76441565 CAAGCTGACCAGAAACATGTTGG - Intergenic
1111022459 13:82470180-82470202 CAAACTATTCTGAAAAATGGAGG - Intergenic
1111752331 13:92349015-92349037 AAAACTAAACACAAAGATAGGGG + Intronic
1112181046 13:97081079-97081101 CAGACAAAACAGAAACAAGTGGG - Intergenic
1112535911 13:100255124-100255146 CAAGCCAAACAGAAAAATGTTGG - Intronic
1114001301 14:18251163-18251185 AAAACTACACAGAAACATTCTGG - Intergenic
1114471952 14:22969314-22969336 AATACTAAACAGAAATATTGAGG + Intronic
1114783436 14:25566579-25566601 CAAACTATTCTGAAACATAGTGG - Intergenic
1114827144 14:26094718-26094740 CAAACCAACCAGAATCCTGGAGG + Intergenic
1115245697 14:31292392-31292414 TAAACTAAACCAAAAGATGGTGG + Exonic
1115606062 14:35003525-35003547 CAAACAAACAAAAAACATGGTGG - Intronic
1115646660 14:35372804-35372826 CAAACAAAACAAAAACAATGAGG + Intergenic
1115667537 14:35569629-35569651 CAACATAATCAGAGACATGGAGG - Intronic
1116196967 14:41739669-41739691 CAAACTAAGCACAAACGTAGTGG + Intronic
1116880081 14:50158728-50158750 CAAAGTAAAAAGAAAAAGGGAGG - Intronic
1117106917 14:52407390-52407412 AAAAGTAAATAAAAACATGGCGG + Intergenic
1118287947 14:64494204-64494226 AACACTGAAGAGAAACATGGGGG + Intronic
1118631852 14:67712539-67712561 AAAACAAAACAAAAACATGAAGG + Intronic
1119460091 14:74794488-74794510 CAACCTAATCAGAAACATATGGG - Intronic
1119571820 14:75681471-75681493 AAAAATAAACTGTAACATGGTGG - Intronic
1120438753 14:84510029-84510051 CAAACTAAACCCAAAAATGAGGG + Intergenic
1121189030 14:92007574-92007596 TAAACTAAACACAGAAATGGTGG - Intronic
1122034919 14:98940974-98940996 CACACTAAACAGAGCCAAGGTGG - Intergenic
1122250221 14:100433667-100433689 CAAAATAAACAGACTAATGGGGG - Intronic
1122576501 14:102746463-102746485 CAAAATAAATATTAACATGGCGG + Intergenic
1125211628 15:37222857-37222879 CAAACTAAACAAAAGCACGTCGG - Intergenic
1126375112 15:47989669-47989691 GAAACTTGCCAGAAACATGGGGG - Intergenic
1126632034 15:50746137-50746159 AAAATTAAAAACAAACATGGAGG + Intronic
1126834157 15:52642556-52642578 CAAACTAAAAATAATCATGAGGG + Intronic
1127970436 15:63955519-63955541 CAAACTATGCTGAAAAATGGAGG - Intronic
1128199911 15:65795752-65795774 CAAACAAAAAACAGACATGGTGG + Intronic
1128497762 15:68207910-68207932 CAAATCAAACAGAAACTTGACGG + Exonic
1129020822 15:72516003-72516025 CATATTAAATAAAAACATGGTGG + Intronic
1129026769 15:72583356-72583378 CAAAACAAACACAAACAAGGAGG + Exonic
1129617289 15:77108806-77108828 CAAACCAAACCAAACCATGGGGG + Exonic
1130024332 15:80258453-80258475 GACACTAAACAGAAACAGGTAGG - Intergenic
1130128966 15:81120197-81120219 CAAATTAATCAGACACATGAAGG + Intronic
1131007043 15:88986883-88986905 AAAACAAAACAGAAACAAGGTGG - Intergenic
1131466830 15:92662438-92662460 CAAACCAAACCGAACCATGTTGG - Intronic
1134351679 16:13443631-13443653 TAAACTAAATAAAAACATAGGGG - Intergenic
1134384493 16:13759074-13759096 ACAAATAAACAGAAACCTGGTGG + Intergenic
1135745579 16:25014072-25014094 GAAACTAAGCAAAAAGATGGAGG + Intronic
1136907028 16:34104790-34104812 AAAACTAGACAGAAGCATTGTGG + Intergenic
1137080082 16:36038559-36038581 AAAACTAAACAGAAACATTCTGG + Intergenic
1137567126 16:49540269-49540291 AAAACAAAACAAAAACATTGTGG - Intronic
1137906534 16:52327845-52327867 CATGCTAAGTAGAAACATGGAGG + Intergenic
1138041164 16:53668876-53668898 CATACTAAAAAGTAACATGAGGG + Intronic
1138386268 16:56637842-56637864 TAAACTAAAAAGCAAGATGGGGG - Intergenic
1138493448 16:57392003-57392025 CAAACAAAAAACAAGCATGGTGG + Intergenic
1138574629 16:57899789-57899811 CAAACTAAACAGAAACATGGAGG - Intronic
1139133370 16:64172816-64172838 CAAACTACACCAAAACTTGGTGG - Intergenic
1139137575 16:64223495-64223517 TAAAACAAACAAAAACATGGAGG + Intergenic
1144150779 17:12441277-12441299 CAAACTAAAGAAATACATGGGGG + Intergenic
1146082951 17:29798808-29798830 GAAAATAAATAGTAACATGGTGG - Intronic
1146468130 17:33103459-33103481 CAAACCAAAAAGAAACATTGAGG - Intronic
1146862836 17:36319688-36319710 AAAAATAAACAGAACCATAGTGG + Intronic
1147093165 17:38123771-38123793 AAAAATAAACAGAACCATAGTGG + Intergenic
1147104042 17:38196717-38196739 AAAAATAAACAGAACCATAGTGG - Intergenic
1148425445 17:47591688-47591710 AAAAATAAACAGAACCATAGTGG + Intronic
1148582170 17:48751837-48751859 AAAACTAAACAGAAAGAAAGGGG - Intergenic
1149484951 17:57035340-57035362 CAAAAAATACAGAAAAATGGTGG - Intergenic
1149933584 17:60780938-60780960 AAAATAAAACAGAACCATGGTGG - Intronic
1153125043 18:1781203-1781225 CAACATAAACAGAAGCATAGAGG - Intergenic
1153410841 18:4790400-4790422 CAAACAAAAAATAAACATCGAGG + Intergenic
1155181430 18:23351691-23351713 CAATCTTAACTGAAACATGGTGG - Intronic
1156581501 18:38381993-38382015 CCAATTTAACAGAAACATGAAGG + Intergenic
1157910289 18:51611050-51611072 CAAACAAAACAGAAATATATTGG + Intergenic
1159027572 18:63200055-63200077 CAAACAAAACAGGAACATGTTGG - Intronic
1160539603 18:79613368-79613390 CAAACAAAGCAGCAGCATGGAGG + Intergenic
1164348998 19:27309429-27309451 AAAACTACACAGAAGCATTGTGG + Intergenic
1164350512 19:27331721-27331743 CAAACTAGACAGAAGCATTCTGG - Intergenic
1164354681 19:27408849-27408871 AAAACTAGACAGAAACATTCTGG - Intergenic
1166322230 19:42025565-42025587 CATCCCAGACAGAAACATGGGGG + Intronic
1166803752 19:45473027-45473049 CAAAACAAACAAACACATGGGGG + Exonic
925109387 2:1320870-1320892 CAATATACACAGAAACATGGGGG - Intronic
927163280 2:20290990-20291012 CAATCTATAAAGCAACATGGAGG + Intronic
928473370 2:31597197-31597219 CAAAGCAAACAGAAACAAAGTGG + Intergenic
928908085 2:36389640-36389662 TAACCTAAACAGATACAAGGTGG + Intronic
928988864 2:37209516-37209538 CAAAGTAAACAAAAACAAAGTGG + Intronic
929182432 2:39056821-39056843 CTATGTAAACAGAAACCTGGTGG + Exonic
930527398 2:52546884-52546906 CAAACTATTCAGAAAAATAGAGG - Intergenic
931060534 2:58523909-58523931 CAAACTAAACTGTTACATGTGGG + Intergenic
931328954 2:61259384-61259406 CAAAAAAAAAAGAAACATGGAGG - Intronic
931835033 2:66090133-66090155 CAAAGCAAAGAAAAACATGGGGG + Intergenic
932597586 2:73103698-73103720 CAAACCACACAGAAAGATGTGGG + Intronic
932625815 2:73295032-73295054 CAAATTAAATAAATACATGGGGG + Intergenic
934749982 2:96787909-96787931 CAAACAAAACAAAAACAGTGCGG - Intronic
934876772 2:97928807-97928829 CAATTTATACAGAAACAAGGCGG + Intronic
936943458 2:117909599-117909621 AAAAAAAAAAAGAAACATGGAGG - Intergenic
936976468 2:118226100-118226122 CTAAATAAACAGAGACCTGGAGG - Intergenic
937503044 2:122503850-122503872 CTCACTATACAGAAAAATGGTGG - Intergenic
937657259 2:124390505-124390527 CAAAGTAAATAGAAACATACTGG + Intronic
938239515 2:129732544-129732566 CTATCTAAACAGATAAATGGAGG + Intergenic
939735587 2:145840493-145840515 TAAACAAAACAAAAAGATGGTGG + Intergenic
940076454 2:149747580-149747602 AAAACTAAAGAGAACCATGGAGG + Intergenic
940150813 2:150598516-150598538 CAAACCCAACAGGAAGATGGAGG - Intergenic
940476719 2:154171154-154171176 CAGACCAAACAAATACATGGAGG + Intronic
941137813 2:161739232-161739254 CAGATTAACCAGAAAAATGGAGG + Intronic
941284766 2:163596532-163596554 CTAACTCAAGAGGAACATGGTGG + Intronic
941852036 2:170193904-170193926 CAAATTAAACAGAAAAATAAGGG - Intronic
942390847 2:175491588-175491610 GAAACCAAACAAAAAGATGGTGG + Intergenic
942546462 2:177069418-177069440 CAAACTACAGAAAAACTTGGAGG + Intergenic
942807107 2:179944108-179944130 AAAACTAAACATTAAAATGGTGG + Intergenic
942875570 2:180792469-180792491 GAAACTAAACAGAAAAAGTGGGG + Intergenic
943654682 2:190495716-190495738 CAAAGCAAACAGAAACATAAAGG + Intronic
944179754 2:196877736-196877758 CAAAATAATCAGAAAAATGTAGG - Intronic
944358909 2:198828181-198828203 AAAACAAAACAGAACCTTGGAGG - Intergenic
944670179 2:201987882-201987904 TAAACAAAACAGAAACACAGGGG - Intergenic
945877074 2:215289166-215289188 CAAAAAAAACAGAAATAGGGTGG + Intergenic
948074099 2:235151976-235151998 CAATCTAAACAAGAACTTGGTGG - Intergenic
948129084 2:235587119-235587141 TTACCCAAACAGAAACATGGTGG + Intronic
948856079 2:240731287-240731309 CAGACTAAACAGAGGCAGGGAGG + Intronic
949030173 2:241791978-241792000 AAAAGAAAACAGAAAAATGGGGG - Intronic
1168975254 20:1961027-1961049 GAAAATAAATAGCAACATGGTGG + Intergenic
1171012122 20:21514528-21514550 AAAACAAAACAGAAACCAGGAGG + Intergenic
1171293465 20:23995751-23995773 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1171741987 20:28906898-28906920 AAAACTAGACAGAAGCATTGTGG + Intergenic
1171744403 20:28952329-28952351 AAAACTACACAGAAACATTCTGG + Intergenic
1172463385 20:35136928-35136950 CCCACTAGACAAAAACATGGAGG + Intronic
1173317453 20:41957917-41957939 CAAAATAAATGGAAACATGAAGG - Intergenic
1175684744 20:61020482-61020504 TAAATTAAAAAGACACATGGTGG + Intergenic
1176517988 21:7800641-7800663 CAAAATAACCACAAACTTGGTGG - Intergenic
1177591895 21:23181963-23181985 GAAAATAAACAGAAAAATGCAGG + Intergenic
1177636187 21:23789927-23789949 CTAATTGAACAGAAACATGATGG + Intergenic
1177763228 21:25426390-25426412 CAAATAAAACAGATACCTGGAGG + Intergenic
1177946826 21:27480819-27480841 CAAAATGATCAGAAACATTGGGG - Intergenic
1178245324 21:30945091-30945113 CAAAATAAAAAAAAAGATGGTGG + Intergenic
1178652016 21:34430654-34430676 CAAAATAACCACAAACTTGGTGG - Intergenic
1179579316 21:42330413-42330435 CTACCAAAACAAAAACATGGTGG + Intergenic
1179579558 21:42332550-42332572 CAAACTGAACAGAATCATGAGGG - Intergenic
1180425810 22:15181961-15181983 AAAACTACACAGAAACATTCTGG - Intergenic
1180824521 22:18853467-18853489 CAAAGAAAACAGAAGCATGGAGG - Intronic
1181124943 22:20696622-20696644 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181188214 22:21121081-21121103 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1181210982 22:21289412-21289434 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181277626 22:21696520-21696542 CACATTTAACAGAAAAATGGGGG - Intronic
1181398518 22:22637476-22637498 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1181650897 22:24258584-24258606 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181706484 22:24652155-24652177 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1183402590 22:37613382-37613404 CAAACAAAAAAGAAACACAGAGG - Intronic
1183902009 22:41012964-41012986 CAAACAAAACAAAAACAGGCTGG - Intergenic
1203215964 22_KI270731v1_random:6018-6040 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1203274659 22_KI270734v1_random:79372-79394 CAAAGAAAACAGAAGCATGGAGG - Intergenic
949428455 3:3945106-3945128 CAAACTATTCAGAAAAATAGAGG - Intronic
949438768 3:4057657-4057679 CAAACTATAAAGAATCATGACGG + Intronic
949460326 3:4284756-4284778 CAAAATATAAAGAAGCATGGGGG + Intronic
950390163 3:12690289-12690311 CAAAATAAACAAATAAATGGTGG - Intergenic
950843086 3:15986997-15987019 CAAGCTATGAAGAAACATGGAGG - Intergenic
951271234 3:20626810-20626832 CAAACTAATCCGAAAAATAGTGG - Intergenic
951625352 3:24656092-24656114 AAAACTGATCAGAAATATGGAGG - Intergenic
952022278 3:29038574-29038596 GAAACAAAAAAGAAAGATGGTGG - Intergenic
952070683 3:29631803-29631825 CAAATTAAACAGAAAAGGGGAGG + Intronic
952239704 3:31517955-31517977 GAAACTGAAGAGACACATGGAGG + Intergenic
952242445 3:31546414-31546436 CAGACTAAGCAGTCACATGGAGG - Intronic
952261255 3:31742715-31742737 CAAATCAACCAGAAGCATGGAGG + Intronic
952760363 3:36908215-36908237 TAAAGAAAACAGAAACAGGGTGG + Intronic
953088497 3:39698576-39698598 CAAACTATTCAGAAAAATAGAGG + Intergenic
953798894 3:46006283-46006305 CACACTAAGCAGCAAAATGGTGG + Intergenic
954622277 3:52003000-52003022 CAGACTAAAGAGAGACTTGGCGG + Intergenic
955460449 3:59176715-59176737 CAAACTATTCTGAAAAATGGAGG - Intergenic
956055357 3:65292923-65292945 CAAACAACACAGAAACCAGGAGG - Intergenic
957239846 3:77644655-77644677 TAAATTGAACAGAAACATGGAGG - Intronic
957272910 3:78054705-78054727 GAAGATAAAGAGAAACATGGAGG - Intergenic
957934406 3:86923838-86923860 CAAAATAAACAGAAACATTCTGG - Intergenic
958201225 3:90317837-90317859 AAAACTAGACAGAAGCATGCTGG - Intergenic
958724425 3:97887362-97887384 CAAAGTAAACAAAAACAGTGAGG - Intronic
959652853 3:108768746-108768768 AAAACTAAACAGGAACATGCAGG + Intergenic
959807834 3:110578966-110578988 CAAAATAAAGAGAAACAGTGTGG + Intergenic
961343511 3:126246213-126246235 CAATCTAAACAGATACACGCAGG - Intergenic
962048356 3:131785390-131785412 AAAAATAAGCAGAAACATGAAGG - Intronic
962774476 3:138646203-138646225 CAAACAAAACAAAAGCATGCAGG - Intergenic
962995026 3:140618276-140618298 CAAAGTAAACAAAAACAAAGTGG + Intergenic
963277486 3:143347403-143347425 CAAAGGAAACAGATAAATGGAGG + Intronic
963375753 3:144462221-144462243 AAAACAAAACAAAAAGATGGAGG - Intergenic
963933068 3:151024413-151024435 AAAACTAAACCAAAACATAGTGG + Intergenic
964090174 3:152866618-152866640 CAAACCCAACAGAAACAAGAGGG - Intergenic
965173976 3:165306490-165306512 CAAACTATTCAAAAACATTGAGG + Intergenic
965601288 3:170457167-170457189 CAAACAAAAAAGAAACAGTGTGG - Intronic
965723959 3:171693580-171693602 CAAACTATACAAAAATAAGGAGG - Intronic
966145781 3:176810394-176810416 GGAAATAAACAGAAACATAGGGG - Intergenic
966669443 3:182510479-182510501 CAACCTAAACAGAAATCTGAAGG + Intergenic
967313432 3:188128045-188128067 CAAAACAAAAAGAAAGATGGGGG + Intergenic
970667299 4:18352627-18352649 CAAACTAATCTGAAAAATAGAGG - Intergenic
971986023 4:33825538-33825560 TATACTAAAAAGAAAAATGGTGG - Intergenic
972400857 4:38702309-38702331 CAAACAAAAAAGAAATATAGTGG - Intergenic
972729414 4:41778847-41778869 CAAAATATACAGAAATATGCTGG + Intergenic
973784470 4:54322182-54322204 AAAAATAATCAGAAAAATGGTGG - Intergenic
975264884 4:72351699-72351721 TTAACTAAGCACAAACATGGAGG + Intronic
975276650 4:72509712-72509734 CAAACTATTCTGAAAAATGGAGG + Intronic
975460109 4:74641972-74641994 CATAATAAACACACACATGGAGG + Intergenic
975621727 4:76303415-76303437 CAATATAAATAGCAACATGGAGG + Intronic
975847702 4:78542150-78542172 CAGACTTAACAGATACATGCTGG + Intronic
975874328 4:78818079-78818101 CAAACTAAGCCAAAACATAGAGG + Intronic
976536211 4:86221195-86221217 CAAACTAAACAGAAGTGAGGAGG + Intronic
977590726 4:98823712-98823734 GACACTACACAGACACATGGAGG - Intergenic
978571274 4:110140545-110140567 AAAATTAAAAAGAAGCATGGTGG - Intronic
979131775 4:117056119-117056141 CAAACTAACCACAAACTTTGTGG - Intergenic
979435802 4:120688575-120688597 AAAACTAGAAAGAAATATGGGGG - Intronic
979564672 4:122141224-122141246 CAAACTATTCTGAAAAATGGAGG - Intergenic
979838851 4:125410584-125410606 TAAATCAAAAAGAAACATGGTGG - Intronic
979963407 4:127048666-127048688 CAATTTGAAGAGAAACATGGAGG - Intergenic
981295933 4:143131496-143131518 CTAACTAAAAAGCAACATGGTGG + Intergenic
982132143 4:152239252-152239274 GAAACTAAACACCACCATGGTGG - Intergenic
982536616 4:156615068-156615090 CAGACTAAACTGAAATGTGGTGG + Intergenic
982575198 4:157100680-157100702 TAAATTAAAAAAAAACATGGAGG + Intronic
983271338 4:165565732-165565754 TAAAAGAAACAGAAAAATGGAGG + Intergenic
984875315 4:184362660-184362682 CAAAGAAAACAGAAACAGAGAGG + Intergenic
985001431 4:185487610-185487632 CAAACTAAACCCAAACAAGCAGG - Intergenic
985891234 5:2716647-2716669 CAAATTAAACACACAGATGGAGG - Intergenic
986420076 5:7571415-7571437 CAAACAGAACAGAAAGGTGGAGG - Intronic
986537804 5:8809984-8810006 CAAACCAAACAAAAACAGTGGGG - Intergenic
988294901 5:29344060-29344082 AAAACTAAAGAGAAAAAAGGTGG + Intergenic
988410643 5:30881392-30881414 CAAAGTGAACACAAAGATGGAGG - Intergenic
989110834 5:37905343-37905365 CAAGATAAAGAGAAACATTGAGG - Intergenic
989216557 5:38910043-38910065 CAAACAAAACAGAAAAAAGCAGG + Intronic
989942968 5:50175617-50175639 GAAACTAGACAGAAGCATTGTGG - Intergenic
989944227 5:50198708-50198730 AAAACTACACAGAAACATTCGGG - Intergenic
990712018 5:58593709-58593731 CAAACCAATCTGAAACATGTTGG - Intronic
990932619 5:61110369-61110391 CAAACTAGTCCGAAAAATGGAGG - Intronic
993364036 5:87013772-87013794 CAAACTAGATAGAAACCTAGAGG + Intergenic
993856354 5:93080837-93080859 AAAAGAAAACAGAAACATAGGGG - Intergenic
994098284 5:95867379-95867401 CAATCACAACAGAAACATGGTGG - Intergenic
995105642 5:108374962-108374984 CAAACTAAGCAGAAACAAGGGGG + Intronic
995492371 5:112706782-112706804 CAAACCACACAGAAAGATGATGG - Intergenic
996382898 5:122880075-122880097 CAAAGTAAACAGAAGGTTGGAGG - Intronic
996584405 5:125068630-125068652 TACACTAAAAAGAAACCTGGAGG + Intergenic
997689622 5:135817956-135817978 AAAAGTAAACAAAAACATTGTGG + Intergenic
1000650952 5:163818032-163818054 CAAACTAACCCAAAAAATGGAGG - Intergenic
1001127426 5:169032581-169032603 AAAACGAAACTAAAACATGGAGG - Intronic
1001733509 5:173978845-173978867 CAAACTAAACCCAAACACAGTGG - Intronic
1002635217 5:180604010-180604032 CAAACTAACAAAAAACAAGGAGG + Intronic
1003273645 6:4629363-4629385 AAAACTATACACAAGCATGGAGG + Intergenic
1003711583 6:8598219-8598241 CAAAGCAAACAAAAACATGAAGG - Intergenic
1003768703 6:9271890-9271912 AAAACTTAATACAAACATGGAGG + Intergenic
1004155069 6:13160178-13160200 CAAACAAAAGACAAACAGGGAGG - Intronic
1004343706 6:14829438-14829460 AAAACAAAACAAAAATATGGAGG + Intergenic
1005002589 6:21258119-21258141 CAAACAAAACAAAAACAATGTGG - Intergenic
1005032442 6:21523518-21523540 CAAACTATTCACACACATGGTGG + Intergenic
1005490387 6:26342358-26342380 CAAAATAAAGAGAAACATTGGGG + Intergenic
1006277044 6:33013333-33013355 AAAACAAAACAGAAAGATGGAGG - Intergenic
1006324124 6:33340388-33340410 AAAAGTAAAAACAAACATGGAGG + Intergenic
1007122354 6:39393513-39393535 AAAAATAAACACAAAGATGGGGG + Intronic
1008267362 6:49444980-49445002 CTAACAAATCAGAAACATGAAGG + Intronic
1009346386 6:62616964-62616986 CAAGGTAAACATAAATATGGAGG - Intergenic
1009559676 6:65222828-65222850 CACAGTAAGAAGAAACATGGTGG + Intronic
1009691865 6:67045085-67045107 CAAAGAAAAAAAAAACATGGAGG - Intergenic
1010218725 6:73428798-73428820 GAAATTAAGAAGAAACATGGCGG - Exonic
1010479504 6:76333650-76333672 CAAAGCAAACAGAAACATAAAGG - Intergenic
1010516085 6:76773615-76773637 ATAACTAAACAGAATCTTGGTGG + Intergenic
1010746901 6:79573533-79573555 AAAACAAAACAAAAACTTGGTGG + Intergenic
1012431932 6:99172935-99172957 CAAAACAAACAGAGACATGTGGG - Intergenic
1012861601 6:104566859-104566881 CTAAATAAACACAAACATGCAGG - Intergenic
1013421632 6:109972536-109972558 CATACAAAGCAGAAACATTGGGG + Intergenic
1014653004 6:124064432-124064454 CAAATGAAACAGAAACTGGGAGG - Intronic
1014785352 6:125612224-125612246 CAAACAAAAAAGGAAAATGGGGG - Intergenic
1015065669 6:129023686-129023708 TAAACCAGATAGAAACATGGCGG - Intronic
1015772376 6:136782446-136782468 CTTAAGAAACAGAAACATGGAGG - Intronic
1015995476 6:138991941-138991963 CAAAATCATCACAAACATGGTGG + Intergenic
1018529933 6:164751780-164751802 CAAACAAAAAAGAAACAAGTAGG - Intergenic
1020397292 7:7730703-7730725 AAAACAAAACAAAAACCTGGGGG + Intronic
1020444293 7:8253010-8253032 AAAACTAAAAAGAAATAAGGTGG - Intronic
1020756448 7:12209986-12210008 AAAACAAATCAGAATCATGGGGG - Intergenic
1021033948 7:15774116-15774138 AATACTAAATAGACACATGGTGG - Intergenic
1021272152 7:18603122-18603144 CACACTAAACAGAAGGATGTTGG - Intronic
1021439407 7:20660980-20661002 CTAACTAAACAGCAACATGAAGG + Intronic
1021709334 7:23399611-23399633 CAAATTAATCACAAACTTGGTGG - Intronic
1022392964 7:29959564-29959586 TAAAATAAAAACAAACATGGAGG - Intronic
1024366811 7:48529526-48529548 GAAACTGAACAGAAAGCTGGAGG - Intronic
1025112361 7:56229578-56229600 TAAACTAGACAGCAAGATGGCGG + Intergenic
1025272341 7:57535702-57535724 TATACTAAAAAGAAAAATGGTGG - Intergenic
1028847234 7:95495804-95495826 CAAACAAGACAGAGAGATGGAGG - Exonic
1031649454 7:124268931-124268953 CAAACTACATAGTAAGATGGAGG - Intergenic
1031711247 7:125048585-125048607 CAAAATAAAAAGAAAAGTGGAGG + Intergenic
1031927620 7:127652772-127652794 CAAAATGAACAGAAAGACGGGGG - Intronic
1032385424 7:131519456-131519478 CAACCTAAAGAAAAAAATGGAGG + Intronic
1032401941 7:131629850-131629872 CAAAAGAAACAGATACATGGTGG + Intergenic
1032730343 7:134635889-134635911 CAAACTAAAGAGAAAAAAGTTGG - Intergenic
1033110956 7:138575655-138575677 CAAACTAAACAGTAACAAGTAGG - Intronic
1034781022 7:153882941-153882963 CAAACCTAACAGAAACAGTGCGG + Intergenic
1035360139 7:158306545-158306567 CAAACTGAGCAGAGACTTGGTGG + Intronic
1036109377 8:5880412-5880434 CAAAGCAAACAAAAACAAGGTGG + Intergenic
1037551264 8:19974122-19974144 CAATAGAAACAGACACATGGTGG - Intergenic
1039412683 8:37368502-37368524 CCCACAAAGCAGAAACATGGAGG + Intergenic
1039748104 8:40450572-40450594 CAAAGCAAACAGAAACAAAGTGG - Intergenic
1039989496 8:42475754-42475776 CAAGGCAAGCAGAAACATGGAGG + Intronic
1041692498 8:60702734-60702756 CAAACTACACTGAAACTTGGTGG + Intronic
1041945881 8:63442390-63442412 AAAAGTAAACAGAGGCATGGAGG - Intergenic
1043032703 8:75157398-75157420 GAACCTAAACAAAAGCATGGTGG - Intergenic
1043558872 8:81467266-81467288 CAAAACAAACAGAAACCTTGAGG + Intergenic
1044244013 8:89919856-89919878 CAAACTAAATAGAAGTATGCAGG - Intronic
1044563079 8:93632828-93632850 CAACCACAACAAAAACATGGTGG + Intergenic
1044947497 8:97403633-97403655 CAAAGCAAACAAAAACATGAAGG - Intergenic
1045239048 8:100382458-100382480 CAAACTAGAAAAAAAAATGGAGG - Intronic
1045307099 8:100967569-100967591 AAAACTTAAAAGAAACATGAGGG - Intergenic
1046027511 8:108743425-108743447 GAAATTAAACAGAAAAAAGGTGG + Intronic
1047569065 8:126078031-126078053 AAAAATAAAGAGAAACAAGGCGG + Intergenic
1048385480 8:133908846-133908868 CAAACAGAAGAGAAACATGAGGG + Intergenic
1050121286 9:2310568-2310590 CAAACTATTCAGAAAAATAGAGG - Intergenic
1050236313 9:3584728-3584750 GAAACTTAAAACAAACATGGTGG + Intergenic
1050374296 9:4954999-4955021 CAAACCATGAAGAAACATGGAGG + Intergenic
1051472487 9:17462098-17462120 CAAACTATCCCGAAACATCGTGG + Intronic
1051641761 9:19230503-19230525 AAAAGGGAACAGAAACATGGCGG + Exonic
1051993830 9:23189002-23189024 CAAAGTAAAAAGTAAGATGGGGG - Intergenic
1052367024 9:27623927-27623949 CAAAATAAAGGGAAAAATGGTGG - Intergenic
1052690218 9:31808084-31808106 CAAACCAAACAGCCACGTGGCGG - Intergenic
1052843783 9:33316514-33316536 TCAACTAAACAGAAACAAGGAGG - Intronic
1053729824 9:41042050-41042072 AAAAGTAAAGAGAAACCTGGAGG + Intergenic
1054698684 9:68390013-68390035 AAAAGTAAAGAGAAACCTGGAGG - Intronic
1055183350 9:73418003-73418025 ATAACTGAAAAGAAACATGGAGG - Intergenic
1055863563 9:80784992-80785014 CAAACCACAAAGAAACATGGAGG - Intergenic
1056495847 9:87154543-87154565 CACTCTAACCAGAAACATGCAGG + Intronic
1058739411 9:107928363-107928385 CAACATTAACAAAAACATGGAGG - Intergenic
1059003392 9:110374664-110374686 AAAACAAAACAAAAACATGCTGG + Intronic
1059075039 9:111183935-111183957 CAAAGTAAACAAAAACAAAGTGG - Intergenic
1059529277 9:115020927-115020949 ACAACAAAACAGAAACATGTTGG + Exonic
1059828634 9:118065116-118065138 CAAAGCAAACAAAAACATGAAGG - Intergenic
1059877929 9:118656933-118656955 CAACATAAACAGAAAAATGAGGG + Intergenic
1061586083 9:131569579-131569601 CAAAAAAAAAAGAAACATGGAGG - Intergenic
1062220232 9:135411078-135411100 AAAACCAAACTGAAACCTGGAGG + Intergenic
1203382128 Un_KI270435v1:62779-62801 AAAACTAGACAGAAACATTCTGG + Intergenic
1203359896 Un_KI270442v1:209472-209494 AAAACTACACAGAAACATTCTGG - Intergenic
1203404435 Un_KI270515v1:4684-4706 AAAACTAAACAGAATCATTCCGG + Intergenic
1203683092 Un_KI270757v1:4349-4371 AAAACTAAACAGAAGCATTATGG - Intergenic
1185752547 X:2625415-2625437 AAAAATAAACAGAAAGATAGTGG - Intergenic
1187107573 X:16260088-16260110 CACCTTAAACAGAAACATGCAGG + Intergenic
1187125271 X:16448657-16448679 CAAAGGAAACAGAAACAGAGAGG - Intergenic
1187334122 X:18366917-18366939 CTCACTGAACAGAAACAAGGGGG + Intergenic
1187699170 X:21948137-21948159 CAATCTAAAAAGAATCATTGTGG - Intronic
1187837059 X:23442851-23442873 CAAACTATTCTGAAACATAGAGG + Intergenic
1188199869 X:27284508-27284530 CAAACACAAGAGAAACATAGAGG + Intergenic
1188286111 X:28327269-28327291 CAAACTAGAAAGAAACAGGTGGG + Intergenic
1189737951 X:44090431-44090453 CAAAAAAAAAAGAAGCATGGGGG - Intergenic
1189993557 X:46617366-46617388 AAAACTAAATAGAGACATGAGGG - Intronic
1190083604 X:47376093-47376115 CAAACCACAAAAAAACATGGAGG - Intronic
1190104552 X:47550035-47550057 CAAAATACACAGAGACTTGGGGG + Intergenic
1191417249 X:60486696-60486718 AAAACTAAACAGAAGCATACTGG + Intergenic
1193107994 X:77700725-77700747 CAAGCTACAAAGAGACATGGAGG + Intronic
1193176212 X:78397297-78397319 CAAACTATTCTGAAACATAGAGG + Intergenic
1193219645 X:78908821-78908843 CAAACTAAACCCAAACATAGTGG - Intergenic
1193247591 X:79247600-79247622 GAAACTAACCAAACACATGGAGG + Intergenic
1193388542 X:80899502-80899524 GAAAGAAAACAGAAAAATGGAGG - Intergenic
1193780119 X:85691112-85691134 CAGACTGAACACAAGCATGGAGG - Intergenic
1194332795 X:92604573-92604595 GAAAATAAAAAGAAAAATGGCGG + Intronic
1194866358 X:99073478-99073500 AAAAATAAACATAAACATTGTGG + Intergenic
1195318434 X:103700987-103701009 CAAAGAAAAAAGAAACTTGGTGG + Intergenic
1195396619 X:104417468-104417490 CAAGCTAATCTGAAAAATGGAGG + Intergenic
1195592384 X:106644809-106644831 CAAACTATTCAAAAAAATGGAGG - Intronic
1195742097 X:108075246-108075268 CAAACATAATAAAAACATGGGGG + Intronic
1196009063 X:110866888-110866910 CAAAATAAGCAAAAACTTGGAGG + Intergenic
1196110260 X:111939435-111939457 CAAACTATTCTGAAAAATGGAGG - Intronic
1196299213 X:114035791-114035813 CAAACTACCCCAAAACATGGTGG + Intergenic
1196406857 X:115372214-115372236 CAAACTAGACAGCTGCATGGAGG - Intergenic
1196815399 X:119661734-119661756 AAAACAAAACAGAAAGATGTAGG - Intronic
1197160220 X:123314380-123314402 GATACCAAACAGAAACATGAAGG + Intronic
1197193454 X:123674687-123674709 AAAACTAAACAGAAAAAAGAAGG - Intronic
1197252329 X:124229007-124229029 CACACTAAACAGGACCCTGGTGG - Intronic
1198642241 X:138769263-138769285 TAAGCTTAACAGTAACATGGCGG + Intronic
1199071934 X:143487091-143487113 CAAAATAAAGAGAAACTTTGTGG + Intergenic
1199322071 X:146451687-146451709 CAAATTAAACACAAGCATGCAGG + Intergenic
1199410906 X:147521626-147521648 CATACTGAATAGAAACATGTTGG + Intergenic
1201427321 Y:13866781-13866803 AAAATTAAACAGATACTTGGAGG + Intergenic
1201647972 Y:16256312-16256334 TAAACAAAACAAAAACATGAAGG + Intergenic
1201654838 Y:16328989-16329011 TAAACAAAACAAAAACATGAAGG - Intergenic
1201761878 Y:17549275-17549297 CAAAGTAAACAGAAACAGAGTGG - Intergenic
1201839674 Y:18356715-18356737 CAAAGTAAACAGAAACAGAGTGG + Intergenic