ID: 1138577041

View in Genome Browser
Species Human (GRCh38)
Location 16:57914693-57914715
Sequence CATTCCTTCTGGCACTCACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 181}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138577041_1138577046 -5 Left 1138577041 16:57914693-57914715 CCCAGTGAGTGCCAGAAGGAATG 0: 1
1: 0
2: 1
3: 20
4: 181
Right 1138577046 16:57914711-57914733 GAATGGCTGGAATGACACTGAGG 0: 1
1: 0
2: 1
3: 17
4: 216
1138577041_1138577047 0 Left 1138577041 16:57914693-57914715 CCCAGTGAGTGCCAGAAGGAATG 0: 1
1: 0
2: 1
3: 20
4: 181
Right 1138577047 16:57914716-57914738 GCTGGAATGACACTGAGGCCTGG 0: 1
1: 0
2: 4
3: 24
4: 267
1138577041_1138577052 23 Left 1138577041 16:57914693-57914715 CCCAGTGAGTGCCAGAAGGAATG 0: 1
1: 0
2: 1
3: 20
4: 181
Right 1138577052 16:57914739-57914761 CCAGTGATGAAACGGGTGTCTGG 0: 1
1: 0
2: 0
3: 8
4: 73
1138577041_1138577049 16 Left 1138577041 16:57914693-57914715 CCCAGTGAGTGCCAGAAGGAATG 0: 1
1: 0
2: 1
3: 20
4: 181
Right 1138577049 16:57914732-57914754 GGCCTGGCCAGTGATGAAACGGG 0: 1
1: 0
2: 0
3: 12
4: 190
1138577041_1138577048 15 Left 1138577041 16:57914693-57914715 CCCAGTGAGTGCCAGAAGGAATG 0: 1
1: 0
2: 1
3: 20
4: 181
Right 1138577048 16:57914731-57914753 AGGCCTGGCCAGTGATGAAACGG 0: 1
1: 0
2: 0
3: 26
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138577041 Original CRISPR CATTCCTTCTGGCACTCACT GGG (reversed) Intronic
903914444 1:26753333-26753355 AACTCATGCTGGCACTCACTAGG + Intronic
904300149 1:29549014-29549036 CCTTCCTCCTGGTCCTCACTGGG + Intergenic
909235442 1:73147447-73147469 CATTCCTTCTGGATCTCCCATGG + Intergenic
913389381 1:118293465-118293487 GCTTTCTTCTGGAACTCACTGGG + Intergenic
915022695 1:152796619-152796641 CCTTCCTTCTGACACCCACGTGG - Intronic
916095493 1:161346174-161346196 CATACCCTCTAGCACTCAATAGG + Intronic
918363509 1:183783112-183783134 TCTTCCTTTTGGCACCCACTGGG - Intronic
919745768 1:201008376-201008398 CCTTCCTTCTGGCCTTCTCTGGG - Intronic
920206805 1:204298249-204298271 CATTCCATCTGGGGCTCACAAGG - Intronic
1064176473 10:13079762-13079784 CATTCCCACTGCCACTCCCTAGG + Intronic
1065466998 10:26035038-26035060 CTTTCCTTCTAGCACTGACAGGG - Intronic
1069908978 10:71748485-71748507 CATTCCTTCAGCCTCTCCCTGGG + Exonic
1070596090 10:77834209-77834231 CATTCCCTCTGTCATGCACTGGG - Intronic
1070871291 10:79755777-79755799 CACTCCCTCAGGCAATCACTTGG - Intergenic
1070923479 10:80203688-80203710 CAGCCCTTCTGGCACTGACTCGG - Intronic
1071433579 10:85625894-85625916 CACCCCTTTTGGAACTCACTTGG + Intronic
1071638227 10:87277985-87278007 CACTCCCTCAGGCAATCACTTGG - Intergenic
1071657017 10:87459967-87459989 CACTCCCTCAGGCAATCACTTGG + Intergenic
1072974517 10:100046182-100046204 CATCCCTTCTGGTGCTCCCTGGG - Intronic
1074891872 10:117742660-117742682 AATTGCTTGTGGCATTCACTTGG - Intergenic
1075594069 10:123715112-123715134 CATCACTGCTGCCACTCACTCGG - Intronic
1075914470 10:126155576-126155598 CATTCCTTCATGCGCACACTGGG + Intronic
1076695726 10:132246428-132246450 CAGCCCTGCTGGCACTCACTGGG + Intronic
1077172747 11:1175267-1175289 CCTCCTTTCTGGCACTCACCTGG - Intronic
1078658196 11:13261838-13261860 TAATTCTTCTGGAACTCACTTGG + Intergenic
1081679833 11:44994443-44994465 TAAGCCTTCTGGCACGCACTGGG + Intergenic
1081738673 11:45423107-45423129 CATTACTTCCGGAACCCACTTGG + Intergenic
1082142557 11:48626879-48626901 TATTCCTTCTGGCAATGATTTGG - Intergenic
1082812254 11:57485477-57485499 CACACCATATGGCACTCACTAGG + Intronic
1083685595 11:64373232-64373254 CATTCATTAGGGCCCTCACTGGG + Intergenic
1085038665 11:73314290-73314312 CTTTGCTTCTGGCAGTCCCTGGG + Intronic
1086585309 11:88444562-88444584 CAGTCCATCAGACACTCACTTGG - Intergenic
1087229177 11:95640522-95640544 GATTCCTACTGGCAATTACTGGG + Intergenic
1088222624 11:107585941-107585963 CATTACTTATGGCATTGACTTGG - Intergenic
1088360621 11:108985346-108985368 CTTTCCTTCCAGCTCTCACTTGG - Intergenic
1088704682 11:112451345-112451367 CAATCCTTCTGTGACTCATTTGG + Intergenic
1091400744 12:179191-179213 CATCCCTTCTGGCTCCCAGTAGG - Intergenic
1091675542 12:2486371-2486393 CATTCATTCAGACACACACTGGG + Intronic
1092022614 12:5214888-5214910 CATTCCTCCTGGGCTTCACTTGG + Intergenic
1092159554 12:6308603-6308625 CACTCCTTCTGGGAGACACTGGG + Intergenic
1093017278 12:14167223-14167245 CATTCTCTCTAGCAGTCACTAGG - Intergenic
1093790078 12:23238442-23238464 GATTCCTTCTGGCTCACTCTTGG + Intergenic
1097262547 12:57727662-57727684 GCTGCCTCCTGGCACTCACTGGG + Exonic
1100779792 12:98011803-98011825 CCTTCTTTCTGCCAGTCACTGGG - Intergenic
1101019216 12:100535258-100535280 CATTTCTGCTGGCAAACACTAGG - Intronic
1102550966 12:113691978-113692000 CGTTACTTCTGACACTCTCTGGG + Intergenic
1105443482 13:20434140-20434162 CATTTCTCCTGGTACTGACTTGG - Intronic
1106596235 13:31141449-31141471 CCTTCCTTCAGGAATTCACTGGG + Intronic
1110016858 13:70416291-70416313 CACTACTTTTGCCACTCACTTGG - Intergenic
1112046309 13:95601737-95601759 CCTGCCTACTGGCACTCACTGGG + Intronic
1115293637 14:31801250-31801272 CTTGCCTTCTGGCTCTCAATGGG - Intronic
1116724197 14:48541548-48541570 CATGACTTCTTGCACTGACTAGG + Intergenic
1118529691 14:66689207-66689229 CATTCCTTCTGTATCTAACTTGG + Intronic
1120101772 14:80452582-80452604 TATTGCTTCTGGCACGCAGTAGG - Intergenic
1121519263 14:94574770-94574792 CATACCTCCTGGCAAGCACTCGG - Intronic
1122145741 14:99687959-99687981 CATTCCTTCTGGCACCTGCAGGG - Intronic
1124038783 15:26081387-26081409 CAATCATTGTGCCACTCACTTGG - Intergenic
1126256795 15:46636700-46636722 CATCCCTTCTGGGACACACTTGG + Intergenic
1126354540 15:47781426-47781448 CATGCCTTTTGCCACTCACATGG - Intergenic
1126756806 15:51933253-51933275 CATGCCTTCTGGACCTCATTGGG + Intronic
1127167378 15:56260228-56260250 CATGCCTTGTGGCACTGACTAGG + Intronic
1127821702 15:62663428-62663450 CTTTCCTTATTGCACTCATTAGG - Intronic
1128364430 15:66987285-66987307 CATCCCTGCAGACACTCACTAGG - Intergenic
1130401638 15:83560626-83560648 TATTTCTTCTGTAACTCACTGGG - Intronic
1131502197 15:92979280-92979302 CAATCTTCCTGGCACTTACTTGG - Exonic
1131698492 15:94906557-94906579 AATACCATCAGGCACTCACTAGG - Intergenic
1132949629 16:2553771-2553793 CAATCCATCTGCCACCCACTTGG - Intronic
1132964719 16:2646396-2646418 CAATCCATCTGCCACCCACTTGG + Intergenic
1133696859 16:8272869-8272891 CAGTCCTTCTGGCATCTACTGGG - Intergenic
1138271796 16:55701032-55701054 CATTCCTTTATCCACTCACTTGG + Intronic
1138577041 16:57914693-57914715 CATTCCTTCTGGCACTCACTGGG - Intronic
1139139018 16:64238654-64238676 CATTCCTTCTGACACTTAATAGG - Intergenic
1139446748 16:67002849-67002871 CATCCCCTCTGGAACCCACTGGG + Intronic
1141136657 16:81469992-81470014 CATTTCCTCTGGCCCTCACTGGG + Intronic
1141529585 16:84637009-84637031 CTTTCCATCTGTCACTGACTGGG - Intergenic
1141725812 16:85787617-85787639 CATCTCTTCTGACTCTCACTGGG - Intronic
1143019630 17:3910486-3910508 CAGTCCTTCTGGTCCTCCCTCGG + Intronic
1143273694 17:5694363-5694385 CATTTCTTCTGTTACTCTCTTGG - Intergenic
1144831274 17:18132563-18132585 GATGCCTGCTGGCACTCACCTGG - Exonic
1149459042 17:56812335-56812357 CATTGCTTTTGGCACCCAGTGGG - Intronic
1151489517 17:74424529-74424551 CATTCTTGCTGTCACTCACATGG - Intergenic
1153757153 18:8295554-8295576 CATACTTCCTGGCACCCACTGGG - Intronic
1156271724 18:35541072-35541094 TATTCCATCTGGCACTCACATGG - Intergenic
1156396646 18:36705276-36705298 CATTCCCTCCGGCACGCAGTGGG + Intronic
1157448829 18:47770002-47770024 CATTCTTACTGGCCCCCACTGGG - Intergenic
1158073853 18:53505786-53505808 CATTCCTTCTGTCACTCATGCGG - Intronic
1159132997 18:64302336-64302358 CACCCCTTCTGTCAGTCACTTGG + Intergenic
1159313641 18:66741910-66741932 CAATCCTTATGTCACTCACAGGG - Intergenic
1159530359 18:69647937-69647959 AATTCATTCTGGCTCTCCCTGGG - Intronic
1160440385 18:78884850-78884872 CTTTCCTTCTCCCACTCCCTAGG - Intergenic
1161609598 19:5234299-5234321 CATTCTATCTGGCACACAGTAGG - Intronic
1163120438 19:15214054-15214076 CACTCCTGCTGGTTCTCACTAGG - Intergenic
1163245158 19:16088917-16088939 CATTCCTTCTGCCCCCCACCGGG + Intronic
1163395756 19:17059959-17059981 CACCCCTTCTGTCACTCACTGGG - Intronic
1164710848 19:30356240-30356262 CTTTCCTTCTGGAAGTCACTGGG - Intronic
1166271189 19:41715203-41715225 CACTGCGCCTGGCACTCACTGGG - Exonic
1166431639 19:42732808-42732830 CACTGCGGCTGGCACTCACTGGG + Exonic
1166434754 19:42758026-42758048 CACTGCGGCTGGCACTCACTGGG + Exonic
1166444627 19:42848047-42848069 CACTGCGGCTGGCACTCACTGGG + Intronic
1166447610 19:42871791-42871813 CACTGCGGCTGGCACTCACTGGG + Exonic
1166452065 19:42910604-42910626 CACTGCGGCTGGCACTCACTGGG + Exonic
1166454520 19:42929466-42929488 CACTGCGGCTGGCACTCACTGGG + Exonic
1166484071 19:43198021-43198043 CACTGCGGCTGGCACTCACTGGG + Exonic
1166491181 19:43261884-43261906 CACTGCGACTGGCACTCACTGGG + Exonic
1166658418 19:44628923-44628945 CATTCCTTCAGACCCTCACGTGG - Intronic
1167062400 19:47157831-47157853 CATTCCTGCTGACAATCCCTGGG + Intronic
1167574385 19:50310798-50310820 CACCCCTTCTAGCACTCACTGGG - Intergenic
926883363 2:17573704-17573726 CATTTCTTCTGACACCTACTTGG + Intronic
927019903 2:19005721-19005743 CATCCCTACTGTCACTCAGTTGG + Intergenic
930353159 2:50283110-50283132 CATGCCTCCTGGCACACAGTAGG + Intronic
931759699 2:65405970-65405992 CTTTCTTCCTGGCACTCATTTGG + Intronic
933692338 2:85189231-85189253 CAATTCTTGTGTCACTCACTTGG - Intronic
934058657 2:88274005-88274027 CGTTCCTTCTGTCATACACTAGG + Intergenic
935936103 2:108184625-108184647 CATTCACTCAGGCCCTCACTTGG - Intergenic
939666221 2:144954886-144954908 CATTCCTTCTCACTGTCACTTGG - Intergenic
940040801 2:149358477-149358499 CCTTCTTTCTGGCCCTCTCTGGG - Intronic
944661387 2:201924542-201924564 CTTTCCTTCTGGCTGCCACTGGG + Intergenic
945348250 2:208746160-208746182 CATTCCTGCTGCCAATCCCTAGG - Intronic
947135287 2:226971274-226971296 TATTCCTTCTCTCACTCACTTGG - Intronic
948447954 2:238048160-238048182 CTTTCCTTTTGGAACTCAATAGG - Intronic
948692046 2:239712226-239712248 CCTTCCTTCTGGAACTTAGTGGG - Intergenic
1168749562 20:272860-272882 CATTTCTTCTGCCACACTCTTGG + Intronic
1170789876 20:19498885-19498907 ATTTCCTCCTGGCACTCTCTTGG + Intronic
1173027771 20:39325429-39325451 CCTTCTTTTTGTCACTCACTTGG - Intergenic
1173795174 20:45854951-45854973 CACACCTGCTGGGACTCACTGGG - Intronic
1173851294 20:46220072-46220094 CTTTCCTCCTGTCTCTCACTAGG - Intronic
1177901694 21:26924961-26924983 CATTCTTTCTGGCACAAAATGGG + Intronic
1178048766 21:28725647-28725669 CATTGCTTCTGACAGTAACTGGG - Intergenic
1178340249 21:31779831-31779853 CATTCCCCCTGGCACACCCTTGG + Intergenic
1178818643 21:35954795-35954817 CAGTCCTTCTGGTACTGGCTGGG - Intronic
1180934327 22:19614605-19614627 CTTTCTCTCTGACACTCACTGGG + Intergenic
1182429155 22:30289919-30289941 CTGTCCTTCTGGCACACACGTGG + Intronic
1183031499 22:35109885-35109907 CATTCCTCCTGGGCCTAACTTGG + Intergenic
1183692086 22:39396155-39396177 CATCCCTTCTGTCACTGCCTTGG + Intergenic
1184281253 22:43438756-43438778 CATCCCTTCTGTGACACACTTGG - Intronic
950374142 3:12556697-12556719 CATTCATACTCGCACTCACTGGG - Intronic
950676807 3:14558979-14559001 CATTACGCCTGGCACTGACTTGG + Intergenic
952293035 3:32036854-32036876 CATTCCTGATGATACTCACTCGG + Intronic
952961666 3:38595276-38595298 CATGGTTTCAGGCACTCACTAGG - Intronic
953127723 3:40108060-40108082 CTTTCCTTCTGTCTCCCACTTGG - Intronic
953752321 3:45618268-45618290 CATTCATTCCTTCACTCACTTGG + Intronic
955493628 3:59508240-59508262 CAGTCCTTCTGGCAGGTACTGGG - Intergenic
955813361 3:62815800-62815822 CATGCCTTCCTGCACTCCCTAGG + Intronic
956226226 3:66962030-66962052 CATGCCTTCCCACACTCACTCGG + Intergenic
956584705 3:70852161-70852183 CATTCCATCTGGCACACGATTGG + Intergenic
957668439 3:83268109-83268131 CCTTCCTTCTGGAACTGAGTTGG + Intergenic
959974229 3:112439872-112439894 CATTTCTTATTGCACTTACTTGG - Intergenic
962134803 3:132722376-132722398 CAGTCCTGCTGGTACTCACTAGG - Exonic
962824773 3:139090490-139090512 CATTCTTCTTGGCACTCAATGGG + Intronic
963613393 3:147502332-147502354 AATTCTGCCTGGCACTCACTTGG - Intronic
970345871 4:15151369-15151391 GTTTCCTTCTTGCAATCACTTGG - Intergenic
970506868 4:16740264-16740286 TTTTTCTTCTGGCACACACTCGG + Intronic
971736444 4:30459465-30459487 CACTTTTTCTGCCACTCACTTGG + Intergenic
975180690 4:71340530-71340552 CATGCCTTCAGGAATTCACTGGG + Intronic
975567081 4:75768628-75768650 CCTGCCTTATGGCACTGACTAGG + Intronic
975803775 4:78091255-78091277 TATTTCTTCTGCCACTCCCTTGG + Intronic
976857986 4:89627636-89627658 CATCCTTTCTGGCACACAGTAGG + Intergenic
984752921 4:183296272-183296294 CAGGCCTTCTGGCACCCACATGG + Intronic
989358278 5:40569623-40569645 ATTTCAATCTGGCACTCACTGGG - Intergenic
990797525 5:59561213-59561235 CATTGCTTTTGGCAATCACATGG + Intronic
996203396 5:120702030-120702052 CATTCCTTCTTCTACTCCCTTGG - Intergenic
996923034 5:128790859-128790881 CATTCCTGCTACTACTCACTTGG + Intronic
997845254 5:137280065-137280087 CATGGCCTCTGGCTCTCACTCGG + Intronic
1000019861 5:157309831-157309853 CATTACGGCAGGCACTCACTTGG - Exonic
1002269247 5:178058977-178058999 CATTCATTAGGGCACTTACTTGG - Intergenic
1004197328 6:13516629-13516651 CATTCATTCAGGTACTCACATGG + Intergenic
1005807703 6:29490493-29490515 CTTTCCTTCTGGCTGTCACCTGG - Intergenic
1006250527 6:32779501-32779523 CATTCCTTCAGACACACCCTTGG + Intergenic
1006641294 6:35491117-35491139 CTTTCTGTCTGTCACTCACTGGG - Intronic
1010512601 6:76738978-76739000 TATTCCATCTGGCACTCACATGG + Intergenic
1010674778 6:78729499-78729521 CTTTCCATCTTGCACTGACTAGG + Intergenic
1016321736 6:142853990-142854012 CATTCACTCTGTCACTGACTGGG + Intronic
1016767778 6:147814535-147814557 CCTTCATTATGGCTCTCACTGGG + Intergenic
1025936288 7:66040439-66040461 CATTGCATCTGGCACACAGTAGG - Intergenic
1025947880 7:66118466-66118488 CATTGCATCTGGCACACAGTAGG + Intronic
1031950976 7:127891927-127891949 CATTCGTTCTGACACTCTTTAGG + Intronic
1035300283 7:157892930-157892952 CATTGCTTTCTGCACTCACTTGG + Intronic
1035301187 7:157898290-157898312 CTTTCCTCCTGGGACTCAGTGGG - Intronic
1035547606 8:495793-495815 CATTGCACCTGGCAATCACTGGG - Intronic
1035578709 8:725871-725893 CATTCATTCAGTCATTCACTTGG + Intronic
1037685616 8:21137218-21137240 CATTCCTTCTGGGATTAACAGGG - Intergenic
1040071376 8:43191565-43191587 CATTCCTCCTGCCAGTCCCTGGG + Exonic
1042353583 8:67802183-67802205 CTTTCCTTCTTTCACTCAGTTGG - Intergenic
1042501929 8:69517882-69517904 TCTTCCTTCTGCCAATCACTTGG - Intronic
1044309393 8:90676213-90676235 TATTTCATCTGGCACTCATTAGG + Intronic
1048149936 8:131884422-131884444 GCTTCCACCTGGCACTCACTAGG + Intergenic
1050069519 9:1795858-1795880 CATTCCTTCTGGCACTCATCAGG + Intergenic
1051399762 9:16668018-16668040 CATTGCGTCTGGCACTTAGTAGG - Intronic
1051677824 9:19576467-19576489 TATTGCTTATGGCACACACTTGG - Intronic
1054845382 9:69790962-69790984 CATAGTTTCTGGCATTCACTGGG + Intergenic
1057372777 9:94489108-94489130 CATTTCTTCTGGAGCTCAGTGGG + Intergenic
1057530372 9:95839710-95839732 CATTCCTTCAGCCACTGACCAGG - Intergenic
1059990162 9:119857836-119857858 AATTCAATCTGGAACTCACTGGG + Intergenic
1061433693 9:130547295-130547317 CACTCCTTCTAGCACTCTCTGGG + Intergenic
1186859355 X:13656063-13656085 CTGTACTTCTGGCACTCACAAGG - Intronic
1187247570 X:17566794-17566816 AATTCCTTCTTGGACTCAATGGG + Intronic
1188443651 X:30235027-30235049 CAACCTTTCTGGCACTCTCTAGG - Intronic
1194380622 X:93186620-93186642 CATTCCTTATTGCACTGGCTAGG - Intergenic
1194604962 X:95966939-95966961 CATTCCCTCTTGAACTCACTGGG + Intergenic
1196282703 X:113841433-113841455 CATGCCTTTTGGCAGTCACTAGG + Intergenic
1197572927 X:128171718-128171740 CATTAAATCTGTCACTCACTTGG - Intergenic
1200049189 X:153419760-153419782 GATTCCTTCTGACACTCACCAGG + Intronic
1200752679 Y:6961119-6961141 CCTTAATTCGGGCACTCACTTGG - Intronic