ID: 1138577042

View in Genome Browser
Species Human (GRCh38)
Location 16:57914694-57914716
Sequence CCATTCCTTCTGGCACTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 191}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138577042_1138577049 15 Left 1138577042 16:57914694-57914716 CCAGTGAGTGCCAGAAGGAATGG 0: 1
1: 0
2: 3
3: 12
4: 191
Right 1138577049 16:57914732-57914754 GGCCTGGCCAGTGATGAAACGGG 0: 1
1: 0
2: 0
3: 12
4: 190
1138577042_1138577047 -1 Left 1138577042 16:57914694-57914716 CCAGTGAGTGCCAGAAGGAATGG 0: 1
1: 0
2: 3
3: 12
4: 191
Right 1138577047 16:57914716-57914738 GCTGGAATGACACTGAGGCCTGG 0: 1
1: 0
2: 4
3: 24
4: 267
1138577042_1138577046 -6 Left 1138577042 16:57914694-57914716 CCAGTGAGTGCCAGAAGGAATGG 0: 1
1: 0
2: 3
3: 12
4: 191
Right 1138577046 16:57914711-57914733 GAATGGCTGGAATGACACTGAGG 0: 1
1: 0
2: 1
3: 17
4: 216
1138577042_1138577048 14 Left 1138577042 16:57914694-57914716 CCAGTGAGTGCCAGAAGGAATGG 0: 1
1: 0
2: 3
3: 12
4: 191
Right 1138577048 16:57914731-57914753 AGGCCTGGCCAGTGATGAAACGG 0: 1
1: 0
2: 0
3: 26
4: 201
1138577042_1138577052 22 Left 1138577042 16:57914694-57914716 CCAGTGAGTGCCAGAAGGAATGG 0: 1
1: 0
2: 3
3: 12
4: 191
Right 1138577052 16:57914739-57914761 CCAGTGATGAAACGGGTGTCTGG 0: 1
1: 0
2: 0
3: 8
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138577042 Original CRISPR CCATTCCTTCTGGCACTCAC TGG (reversed) Intronic
901401043 1:9015215-9015237 CCGGTGCTTCTGGCGCTCACAGG - Exonic
902786532 1:18735912-18735934 CCATTCCTTCTCCCACCCCCAGG + Exonic
904300147 1:29549013-29549035 CCCTTCCTCCTGGTCCTCACTGG + Intergenic
905196534 1:36282782-36282804 CCAGTCCATTTGACACTCACAGG - Intronic
905365203 1:37447656-37447678 CCATTAGTACTGGCACCCACTGG + Intergenic
905732153 1:40304622-40304644 CCATTCCTGCTGTCACTGGCAGG + Intronic
905868979 1:41392097-41392119 CCGTTCCTTCTCGCACACCCAGG - Intergenic
906227156 1:44131558-44131580 TCATTCTCCCTGGCACTCACTGG + Intronic
910393789 1:86771575-86771597 CATTTCCTTCTGGCACCCATGGG + Intergenic
911950724 1:104170799-104170821 TCATTCTTTCTGTCACTCATAGG - Intergenic
915990606 1:160512166-160512188 CCAGTCCCTCTGGCACTGGCAGG - Intronic
916825547 1:168438532-168438554 TCTTTCCTCCTGGTACTCACTGG + Intergenic
918345500 1:183604103-183604125 CCATTTCCTGTGGCAGTCACGGG - Intergenic
918388446 1:184035153-184035175 CCATACCATCTGGAACTTACAGG + Intronic
919745770 1:201008377-201008399 CCCTTCCTTCTGGCCTTCTCTGG - Intronic
920166367 1:204039052-204039074 CTATTCCTTCTGGCTCTAATAGG + Intergenic
921308301 1:213818842-213818864 CCATTTCTTCTGTAACTCAAAGG - Intergenic
921375713 1:214471356-214471378 CCATTCATTCTGCCCCTCTCTGG - Intronic
922600250 1:226845793-226845815 CACTTCCTCCTGGCCCTCACTGG - Intergenic
1065466999 10:26035039-26035061 CCTTTCCTTCTAGCACTGACAGG - Intronic
1065809453 10:29427900-29427922 CCAAACCACCTGGCACTCACTGG - Intergenic
1067825418 10:49568895-49568917 CACTTCCTTATGGCTCTCACTGG + Intergenic
1067831552 10:49613797-49613819 CCATTCCTGCTGGCACTATGGGG - Intronic
1068763274 10:60735249-60735271 CTATTCCCTCAGGCACTCATAGG + Intergenic
1069908977 10:71748484-71748506 CCATTCCTTCAGCCTCTCCCTGG + Exonic
1070167464 10:73909628-73909650 GCCTTCCTTCTGTCACTCTCAGG + Intronic
1072974518 10:100046183-100046205 CCATCCCTTCTGGTGCTCCCTGG - Intronic
1074533479 10:114312505-114312527 CCATTCCCTCTGGGCCTCAGTGG + Intronic
1076437045 10:130453662-130453684 CCAGCCCTTCTGGGACTCAGTGG + Intergenic
1076695725 10:132246427-132246449 TCAGCCCTGCTGGCACTCACTGG + Intronic
1080050680 11:27855930-27855952 CCATCCCTTCTGACAGTCACAGG - Intergenic
1081679832 11:44994442-44994464 CTAAGCCTTCTGGCACGCACTGG + Intergenic
1082807557 11:57460473-57460495 CCACTCCTTCCCGCACTCGCTGG - Intergenic
1083685594 11:64373231-64373253 CCATTCATTAGGGCCCTCACTGG + Intergenic
1085699624 11:78734573-78734595 CCATTCCTTCTGTCACACCCTGG + Intronic
1088011967 11:105014486-105014508 GCACTACTTCTGGCACTCAAGGG + Intronic
1090048434 11:123357086-123357108 CCCTTCCCTCGGGCATTCACTGG - Intergenic
1090439030 11:126711181-126711203 CCATTCCTTCTGCCACCCACTGG - Intronic
1091675541 12:2486370-2486392 CCATTCATTCAGACACACACTGG + Intronic
1091838303 12:3601486-3601508 CCATTCCTCCGGCTACTCACTGG - Intergenic
1092159553 12:6308602-6308624 CCACTCCTTCTGGGAGACACTGG + Intergenic
1096604310 12:52753899-52753921 CCTTTCCTTCTGCCCCACACAGG + Intergenic
1096719253 12:53508846-53508868 CCTGTCCTTCTGGGACTCCCTGG - Intronic
1097262546 12:57727661-57727683 CGCTGCCTCCTGGCACTCACTGG + Exonic
1098182844 12:67866415-67866437 CCATTCCTTCTGAAACTAAGAGG - Intergenic
1099071203 12:78047816-78047838 CCATTCTTTCTGTCACTTTCAGG + Intronic
1101113810 12:101512057-101512079 ATATTCCTTCTGCCACTCAGGGG - Intergenic
1102550965 12:113691977-113691999 CCGTTACTTCTGACACTCTCTGG + Intergenic
1102799869 12:115722680-115722702 CCATTCCTGCTTCCACTCCCTGG + Intergenic
1104792392 12:131492308-131492330 CCACTCCCTCTGGCACGCAGAGG - Intergenic
1106378655 13:29214969-29214991 CCATTCTTTCTGTCACTTTCAGG + Intronic
1108559195 13:51626760-51626782 CCATTCCTTGTAGAAGTCACGGG + Intronic
1112046307 13:95601736-95601758 GCCTGCCTACTGGCACTCACTGG + Intronic
1113077165 13:106478288-106478310 CCATTAATTCTGGAACTCGCGGG + Intergenic
1113443578 13:110348167-110348189 TCATAACTGCTGGCACTCACTGG + Intronic
1114631058 14:24159958-24159980 CATGTCCTGCTGGCACTCACTGG - Exonic
1115293638 14:31801251-31801273 CCTTGCCTTCTGGCTCTCAATGG - Intronic
1115642639 14:35344437-35344459 CCAGTCCCTCTGGCAGTGACAGG - Intergenic
1121946263 14:98125463-98125485 CCAGTCCTGGTGGCACTCAAAGG + Intergenic
1122145742 14:99687960-99687982 CCATTCCTTCTGGCACCTGCAGG - Intronic
1202880513 14_KI270722v1_random:54720-54742 CCATTCTCTCTGTCACTTACAGG - Intergenic
1131194894 15:90347870-90347892 CCCTTCATTCTCACACTCACAGG - Intergenic
1131399412 15:92112575-92112597 CCACTGCTTCTGGCATTCATTGG - Intronic
1133423328 16:5665753-5665775 CCAGTCCCTCAGGCCCTCACAGG + Intergenic
1133998614 16:10765913-10765935 CCTTCCTTTCTGGCACTCCCTGG - Intronic
1138577042 16:57914694-57914716 CCATTCCTTCTGGCACTCACTGG - Intronic
1140104376 16:71946313-71946335 GCATTCCTTCTTTCCCTCACAGG + Intronic
1141136656 16:81469991-81470013 GCATTTCCTCTGGCCCTCACTGG + Intronic
1144142417 17:12362628-12362650 CCAAAGCTTCTGGCACTCATGGG + Intergenic
1147667440 17:42157554-42157576 ACATTCCATCTGGCAATAACTGG - Intronic
1148559613 17:48598282-48598304 TATTTCCTTCTGGCCCTCACTGG - Intronic
1150661675 17:67086219-67086241 CCATTTCTTCTTTCAATCACAGG + Intronic
1151349970 17:73525849-73525871 CCATTCATTCTTTCACTCAAAGG + Intronic
1151966298 17:77433493-77433515 CCATCCCTTTTGGCCGTCACAGG - Intronic
1153045774 18:854581-854603 CACTTCCTTCTGTCAGTCACTGG + Intergenic
1153988655 18:10375856-10375878 CCCTTCCTTCTGGCCCTCTCAGG + Intergenic
1154294783 18:13138486-13138508 CCATCCTTTCTAGGACTCACGGG - Intergenic
1156908499 18:42382817-42382839 CTTTTCCTTCTGGCCCTGACAGG + Intergenic
1158954643 18:62526211-62526233 CCATCCCTCCCAGCACTCACTGG - Intronic
1159313642 18:66741911-66741933 ACAATCCTTATGTCACTCACAGG - Intergenic
1160395457 18:78567710-78567732 CCTTTCCTTCTGGGACTCTGAGG - Intergenic
1163040650 19:14599701-14599723 CCATCCCTTCTGACAGTGACTGG + Exonic
1163245157 19:16088916-16088938 ACATTCCTTCTGCCCCCCACCGG + Intronic
1163395757 19:17059960-17059982 TCACCCCTTCTGTCACTCACTGG - Intronic
1164710849 19:30356241-30356263 CCTTTCCTTCTGGAAGTCACTGG - Intronic
1165407171 19:35637970-35637992 CCTTCCCTTCTGGAGCTCACAGG + Intergenic
1167574386 19:50310799-50310821 ACACCCCTTCTAGCACTCACTGG - Intergenic
929038323 2:37718691-37718713 CCTTTTTCTCTGGCACTCACAGG - Intronic
929703261 2:44183623-44183645 CCCTTCCTCCTGGGGCTCACTGG - Intronic
931968951 2:67564908-67564930 ACATTCCATCTGGCACTCACTGG + Intergenic
932813972 2:74846869-74846891 CCATACCTTCTGGAAGTCAGGGG - Intronic
932910891 2:75805135-75805157 CCCTTCCTTCGGACACACACTGG - Intergenic
933580499 2:84120804-84120826 CCATTTCTTTTGGCATTCAGAGG + Intergenic
935384355 2:102485571-102485593 CCATTCCCTCCTGCAGTCACAGG + Intronic
936806294 2:116336411-116336433 CCATTCTCTCTGTCACTCTCAGG + Intergenic
937313487 2:120916415-120916437 CCCTTCCTTCTGGCTCTGCCAGG + Intronic
939260292 2:139799332-139799354 CCATTCCTTATGACACTAAGTGG + Intergenic
943968291 2:194367508-194367530 TCCTTGCTTCTGGCACTCCCAGG - Intergenic
944661386 2:201924541-201924563 CCTTTCCTTCTGGCTGCCACTGG + Intergenic
945302398 2:208226833-208226855 CCATTTCCTCTGGCAGTTACTGG - Intergenic
947991413 2:234490602-234490624 CCTCTCCTTCTGGCTCTCCCTGG - Intergenic
948665029 2:239529232-239529254 CCCTTGCTCCTGGCACACACAGG - Intergenic
948692048 2:239712227-239712249 CCCTTCCTTCTGGAACTTAGTGG - Intergenic
948922951 2:241074333-241074355 CCAGTCCTCCTGGTGCTCACAGG - Intronic
1170289414 20:14751642-14751664 CTATTTCTTCTGGAACTCAATGG + Intronic
1171436972 20:25131450-25131472 CCACCCCTCCTGGCACTCAGAGG + Intergenic
1173178817 20:40786222-40786244 CTATTCTTTCTGGAACTCCCTGG + Intergenic
1175139180 20:56847140-56847162 CCATTCCAGCTGGGACTCAGGGG - Intergenic
1176641843 21:9312272-9312294 CCATTCTTTCTGTCACTTTCAGG - Intergenic
1177901693 21:26924960-26924982 CCATTCTTTCTGGCACAAAATGG + Intronic
1178148352 21:29765764-29765786 GCATTGCTCCTGGCTCTCACAGG - Intronic
1180350856 22:11801624-11801646 CCATTCTTTCTGTCACTTTCAGG - Intergenic
1180387350 22:12190446-12190468 CCATTCTTTCTGTCACTTTCAGG + Intergenic
949558635 3:5182482-5182504 CCATAACTTCTGCCACTGACAGG + Intergenic
950374143 3:12556698-12556720 CCATTCATACTCGCACTCACTGG - Intronic
951098393 3:18658159-18658181 CCATTCCTTCCAGAACTCAGAGG - Intergenic
951527569 3:23668486-23668508 TCATTCCTCCTGGGACTCAGGGG + Intergenic
953251318 3:41247704-41247726 GCATTCCTTCTGTCACACAGGGG - Intronic
953658627 3:44873890-44873912 CCATTCCTTCTGTAGCTCAGGGG + Intergenic
955281632 3:57599819-57599841 CCATTTCTTCTGGTATTAACTGG + Intergenic
955493629 3:59508241-59508263 CCAGTCCTTCTGGCAGGTACTGG - Intergenic
961456835 3:127028631-127028653 CCATCCCCTCTGGCCCTCAATGG - Intronic
961725306 3:128924391-128924413 TCCTTCCTTCTAGCACTCCCAGG + Intronic
964764463 3:160166194-160166216 CCTTTCCTTTTGGGACTCCCAGG - Intergenic
966686723 3:182703591-182703613 CCATTCCTTCCTGGCCTCACAGG - Intergenic
1202745052 3_GL000221v1_random:92746-92768 CCATTCTTTCTGTCACTTTCAGG + Intergenic
970770043 4:19601500-19601522 CCCTTCCTTCTGGCTCTCTAAGG + Intergenic
970852393 4:20617126-20617148 CCATCCTTCCTGGCACTCGCAGG - Exonic
971892163 4:32538748-32538770 CCATTCCTGCTGCCTCTCCCAGG - Intergenic
972759148 4:42084776-42084798 CCCTTCCTTTGTGCACTCACAGG + Intronic
975180689 4:71340529-71340551 CCATGCCTTCAGGAATTCACTGG + Intronic
975512048 4:75205030-75205052 CGATTCCTTCAGGAAGTCACAGG + Intergenic
980398051 4:132241282-132241304 CCACTCATTCTGGAACTCAGAGG + Intergenic
983661921 4:170137263-170137285 CCTATCCTTTTGGCACTCATGGG + Intergenic
986138901 5:5011026-5011048 CACTTCCTCATGGCACTCACTGG + Intergenic
986190296 5:5490910-5490932 AGACTCCTTCTGGCACTCATGGG - Intergenic
987577667 5:19752170-19752192 CCATTCCTGCTTGGACTCAGGGG + Intronic
988318452 5:29661383-29661405 CCATTCAGTCTGGCACTCACAGG - Intergenic
988902135 5:35745192-35745214 CCATTCCTGCTGGGCATCACAGG + Intronic
990079798 5:51899200-51899222 TCATTCCTGCTGGCACCCATAGG - Intergenic
991544383 5:67765289-67765311 CCAGTCCATCTGGGGCTCACTGG + Intergenic
993748821 5:91639990-91640012 ACATTCCCTCTGACACTCAGAGG - Intergenic
994027710 5:95104055-95104077 GCATTCCTGTTGGCAATCACAGG - Intronic
996854721 5:127992503-127992525 CCATTGCCTCTGGCTGTCACGGG - Intergenic
997499613 5:134362639-134362661 CCACTGCACCTGGCACTCACTGG - Intronic
1000128916 5:158275744-158275766 ACATGCCTCATGGCACTCACTGG + Intergenic
1002014483 5:176308659-176308681 CTCTTCCTTCTGGCCCTCAATGG - Intronic
1003521113 6:6859322-6859344 GCGTTCCTTCTGCCACTCAGAGG - Intergenic
1004185808 6:13420107-13420129 CCATACCTTCTGGCTCGCATGGG + Intronic
1007104618 6:39274944-39274966 CCCTGCCCTCGGGCACTCACAGG - Intergenic
1010080724 6:71857753-71857775 CCCTTCCCACTGGCAATCACTGG + Intergenic
1011653706 6:89530668-89530690 CCCTTCCTGCTGGCCCTGACTGG - Intronic
1012909348 6:105101863-105101885 TCATTCATTCAGTCACTCACTGG + Intronic
1015096223 6:129417543-129417565 CCCTTCCTTCAGGCAGTCCCTGG + Intronic
1015796708 6:137019936-137019958 CCCTTCCTCTTGGCATTCACAGG + Intronic
1016321735 6:142853989-142854011 CCATTCACTCTGTCACTGACTGG + Intronic
1017197259 6:151715445-151715467 CCATTCTTTCTGTCACTTTCAGG + Intronic
1018149173 6:160922447-160922469 CCTTACCTGCTGGCACACACGGG - Intergenic
1022459078 7:30587024-30587046 CCATTTATTCTGGCATCCACAGG + Intergenic
1023744707 7:43311996-43312018 CTATTCCATCGGGCACTCTCAGG + Exonic
1025593983 7:62901374-62901396 CCATTCTTCCTGTCACTCTCAGG - Intergenic
1031433768 7:121707443-121707465 CCATTCTTTATGGTATTCACAGG - Intergenic
1032062703 7:128738202-128738224 CTAATCCTTCTGGCATTCAAAGG - Intergenic
1032278581 7:130482470-130482492 CAGTTCCTTCTGGCCCTCAGAGG - Intergenic
1033473195 7:141667224-141667246 CTCTTCCTTCTGTCACTAACTGG + Intronic
1033680194 7:143585925-143585947 CCATTCTTTGTGTCACTCTCAGG - Intergenic
1033691642 7:143743517-143743539 CCATTCTTTGTGTCACTCTCAGG + Intergenic
1034900007 7:154902304-154902326 AAATTCCTTCAGGCACTAACTGG + Intergenic
1035672488 8:1430553-1430575 CCATTGCTTCTGGGCCTCAGAGG + Intergenic
1036106801 8:5849463-5849485 GCATTCCTTCTGGCATGCTCTGG + Intergenic
1036612640 8:10363339-10363361 CTATTCCTTCCGTGACTCACAGG + Intronic
1037685617 8:21137219-21137241 CCATTCCTTCTGGGATTAACAGG - Intergenic
1038208526 8:25492458-25492480 CCATTCATTCTTTCAATCACAGG - Intronic
1039806544 8:41004866-41004888 CCATTCCTCCTGGCCCTGACTGG + Intergenic
1040633938 8:49249930-49249952 CCTTTCCTGCTGGCACTGAAAGG + Intergenic
1047954534 8:129963414-129963436 CCATCCTTCCAGGCACTCACAGG + Intronic
1048849466 8:138630675-138630697 CCATTCCTTGAGGAACTTACAGG + Exonic
1049018853 8:139940423-139940445 TCATTCCTTCTGGCACTATGAGG - Intronic
1052371835 9:27674316-27674338 CAGTTACTTCTGGCACTGACAGG + Intergenic
1052769960 9:32678533-32678555 GCAGCCCTTCTGGCACACACGGG + Intergenic
1054845381 9:69790961-69790983 CCATAGTTTCTGGCATTCACTGG + Intergenic
1057005329 9:91552515-91552537 CCATAGCTTCTGGCATCCACTGG - Intergenic
1057372776 9:94489107-94489129 CCATTTCTTCTGGAGCTCAGTGG + Intergenic
1059545112 9:115168031-115168053 CCTTTCCTTCTGCCACTGAATGG - Intronic
1059761766 9:117344434-117344456 CTTTTCCTTCTGGAACTCCCAGG - Intronic
1061433692 9:130547294-130547316 CCACTCCTTCTAGCACTCTCTGG + Intergenic
1061724510 9:132574778-132574800 CCAGTCCCTCAGTCACTCACAGG - Intergenic
1203713677 Un_KI270742v1:122696-122718 CCATTCTTTCTGTCACTTTCAGG + Intergenic
1185512880 X:676410-676432 CCATTGCGTCTGGCCCTCACTGG - Intergenic
1186081789 X:5941729-5941751 CCATTCCTTTGGGTAATCACAGG - Intronic
1188340451 X:28994365-28994387 CCAGTCATTCCGGCAATCACAGG - Intronic
1188461717 X:30434730-30434752 CCATTCCTTCTGCAAGTCTCAGG - Intergenic
1189887602 X:45564125-45564147 ACATTCCATCTGGAACTCTCAGG - Intergenic
1192140012 X:68639077-68639099 CCAATCCTGCTGGGCCTCACAGG - Intergenic
1192558339 X:72108087-72108109 CTGTTCCTTCTCCCACTCACTGG - Intergenic
1193394375 X:80967103-80967125 CCATTCTTTCTGTCACTTTCAGG + Intergenic
1194604961 X:95966938-95966960 CCATTCCCTCTTGAACTCACTGG + Intergenic
1195948350 X:110239585-110239607 CCATTCTTTCTGTCACTTTCAGG - Intronic
1196652259 X:118180029-118180051 CCATCCCTTCTGCCATTCAAAGG - Intergenic
1196719371 X:118839487-118839509 CCATTGCTTCTGGCGCCCCCTGG - Intergenic
1200313044 X:155099362-155099384 CTCTTCCTTCTGGCCCTCAATGG - Exonic
1200917653 Y:8585469-8585491 CCCTTCCTCCTGGGCCTCACAGG - Intergenic
1200921838 Y:8620233-8620255 CCCTTCATTCTGGGCCTCACTGG - Intergenic
1200936731 Y:8744824-8744846 CCCTTCCTCCTGGGGCTCACAGG + Intergenic
1200939206 Y:8764777-8764799 CCCTTCATCCTGGGACTCACAGG + Intergenic
1200981390 Y:9266089-9266111 CCCTTCATTCTGGGCCTCACAGG + Intergenic
1200982317 Y:9273466-9273488 CCCTTCATTCTGGGCCTCACAGG + Intergenic