ID: 1138577045

View in Genome Browser
Species Human (GRCh38)
Location 16:57914704-57914726
Sequence GTCATTCCAGCCATTCCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 164}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138577045_1138577052 12 Left 1138577045 16:57914704-57914726 CCAGAAGGAATGGCTGGAATGAC 0: 1
1: 0
2: 0
3: 15
4: 164
Right 1138577052 16:57914739-57914761 CCAGTGATGAAACGGGTGTCTGG 0: 1
1: 0
2: 0
3: 8
4: 73
1138577045_1138577049 5 Left 1138577045 16:57914704-57914726 CCAGAAGGAATGGCTGGAATGAC 0: 1
1: 0
2: 0
3: 15
4: 164
Right 1138577049 16:57914732-57914754 GGCCTGGCCAGTGATGAAACGGG 0: 1
1: 0
2: 0
3: 12
4: 190
1138577045_1138577048 4 Left 1138577045 16:57914704-57914726 CCAGAAGGAATGGCTGGAATGAC 0: 1
1: 0
2: 0
3: 15
4: 164
Right 1138577048 16:57914731-57914753 AGGCCTGGCCAGTGATGAAACGG 0: 1
1: 0
2: 0
3: 26
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138577045 Original CRISPR GTCATTCCAGCCATTCCTTC TGG (reversed) Intronic
900551563 1:3259075-3259097 GCCAATCCAGGCCTTCCTTCTGG - Intronic
900670787 1:3853215-3853237 GTCATTCCTGCTCTTCCTTCTGG - Intronic
901760705 1:11469368-11469390 GACACTCCAGCCACTCCTGCCGG - Intergenic
902951029 1:19882811-19882833 GTCCATCCATCCATTCATTCGGG + Intronic
906303087 1:44697884-44697906 GTAATTCCAGTCTTTCCTGCTGG + Intronic
906313982 1:44774478-44774500 GTAATTCCAGCAACTCCGTCTGG - Intergenic
906648737 1:47495118-47495140 GCCATTCCACCCATGCCTCCTGG - Intergenic
910821112 1:91348323-91348345 GTTTCTCCAGCCTTTCCTTCAGG - Intronic
910886863 1:91973060-91973082 CTCATTCCAACATTTCCTTCAGG - Intronic
912529668 1:110311169-110311191 CTCATTCCAGCCTATCCTTTAGG - Intergenic
913508634 1:119542295-119542317 GTAATTCCAGCCAGCACTTCGGG - Intergenic
915992879 1:160533944-160533966 GTCATTTCAACAATTCGTTCTGG - Intergenic
917462177 1:175241549-175241571 CTCATTCCACTTATTCCTTCTGG + Intergenic
920917002 1:210265846-210265868 CCCATTCCAGGCATTCCTCCGGG + Intergenic
924030941 1:239885056-239885078 GTCTTTCCAAGCATTCCTCCTGG - Intronic
1069123936 10:64605888-64605910 GTGATCCCAGCCATACCTCCTGG - Intergenic
1069892025 10:71657955-71657977 GTCATTCCAGCCCTGCCCCCAGG + Intronic
1070248564 10:74753811-74753833 GTCCTTCAGGCCATTCATTCAGG - Intergenic
1070607403 10:77908466-77908488 GTCCTTCCAGTCATTCTCTCTGG - Intronic
1070857589 10:79619671-79619693 GGCTTTCCAGCCATTCCCACTGG - Intergenic
1071238516 10:83677837-83677859 GTAATTCCAGCAAGTCCTTTGGG - Intergenic
1075445135 10:122507834-122507856 CTCATTCCAGCCAGGCCTTAAGG - Intronic
1076181807 10:128415181-128415203 CGCATTCCAGCTACTCCTTCAGG - Intergenic
1076851116 10:133093612-133093634 GGCATTCCGGCCATTTCATCTGG + Intronic
1077119285 11:899440-899462 GTCTTTCCACCCATCCCTCCTGG - Intronic
1079189084 11:18262861-18262883 CCCATTCCAGGCATTCCTCCGGG - Intergenic
1080006541 11:27413833-27413855 GTTATTCCATCCATTCCATCAGG + Intronic
1080020277 11:27552819-27552841 GTCATTCCAATTATTTCTTCTGG + Intergenic
1081661586 11:44891807-44891829 GTCACTCCTTCCATTCTTTCTGG + Intronic
1087478378 11:98666836-98666858 GTCATTTCAGCCACTCATTAGGG + Intergenic
1088357460 11:108958976-108958998 GCCACTCCAGCCAGTCATTCAGG - Intergenic
1089641539 11:119850953-119850975 ATCAATCATGCCATTCCTTCTGG - Intergenic
1090364421 11:126193584-126193606 CTCACTCCTGCCATTCCTGCAGG - Intergenic
1092576485 12:9789361-9789383 GTAATTACAGCCATTCTTGCAGG + Intergenic
1093384616 12:18536936-18536958 GGTATTCCAGCCTTTCCTCCAGG + Intronic
1096422259 12:51468962-51468984 GGCATTTCAGCCATGACTTCAGG - Intronic
1100386192 12:94106290-94106312 GTCATTCCCTCCCTTCCTTCAGG + Intergenic
1101702341 12:107186101-107186123 GGCTTTCCAGCCCTTCTTTCTGG - Intergenic
1104040217 12:125125045-125125067 GTCCTTCCAGCCATCCCCGCCGG + Intronic
1104626967 12:130365007-130365029 GCCATTTCTGCCAGTCCTTCTGG - Intronic
1108413397 13:50172956-50172978 CCCATTCCAGCCATTCCTCCAGG - Intronic
1108884773 13:55166059-55166081 GTCATTTCAGCCGTTTCATCTGG - Intergenic
1110480588 13:75970249-75970271 TTCATTTCATCCATTGCTTCTGG + Intergenic
1112408612 13:99142976-99142998 GTGATTCCAGCCCTGCCTTCAGG - Intergenic
1113610429 13:111640930-111640952 CTCATTACAGCCATTTCTTTGGG + Intronic
1115668118 14:35576574-35576596 GTCATTACAGACTTTCCTCCTGG + Intronic
1117819347 14:59631644-59631666 TTTATCCCATCCATTCCTTCAGG - Intronic
1119473540 14:74913693-74913715 GTCATAGCAGCACTTCCTTCAGG + Intronic
1121888217 14:97563940-97563962 GTCATTCCAAACATCCCTTTTGG + Intergenic
1122118861 14:99541238-99541260 CTCATTGCAGCTACTCCTTCTGG - Intronic
1123736447 15:23188866-23188888 GTCAGGCTAACCATTCCTTCTGG + Intergenic
1124021285 15:25926506-25926528 GTCATTCCAGTCATTATGTCAGG - Intergenic
1124287153 15:28411841-28411863 GTCAGGCTAACCATTCCTTCTGG + Intergenic
1124295549 15:28499791-28499813 GTCAGGCTAACCATTCCTTCTGG - Intergenic
1125758587 15:42082363-42082385 CCCATTCCAGCCATTGCTTCTGG + Exonic
1127668115 15:61169099-61169121 GTCAGGCCAGCCCTGCCTTCAGG - Intronic
1128468984 15:67936171-67936193 CTAATTCCTGCCATTCCTCCTGG - Intergenic
1129903930 15:79172783-79172805 GACATCCCAGCAATTTCTTCTGG + Intergenic
1132013786 15:98298584-98298606 GGGATGGCAGCCATTCCTTCTGG + Intergenic
1133107607 16:3523316-3523338 CTCTGTTCAGCCATTCCTTCTGG + Intronic
1133748527 16:8706329-8706351 CTCATTGCAGCCTTACCTTCAGG - Intronic
1135175280 16:20222227-20222249 GTGATCCCTACCATTCCTTCTGG - Intergenic
1135325055 16:21520701-21520723 GTCATCCCAGCCCGTCCTCCCGG + Intergenic
1135389475 16:22077862-22077884 GTCACCCCAGCCACTCGTTCTGG - Intronic
1138577045 16:57914704-57914726 GTCATTCCAGCCATTCCTTCTGG - Intronic
1140723960 16:77795584-77795606 TTCATTCCTGCTCTTCCTTCAGG - Intronic
1142037265 16:87869753-87869775 GTCATCCCAGCCCGTCCTCCCGG + Intergenic
1144132964 17:12265837-12265859 CTCATTCCCTCCATTTCTTCAGG - Intergenic
1146121738 17:30201612-30201634 GTCATTGAACGCATTCCTTCCGG - Intronic
1147592999 17:41697233-41697255 GTAATTCCAGCCTTTCCCTCCGG - Intergenic
1150510643 17:65749092-65749114 ATTATTCCAGCCCTTCCTTGAGG - Intronic
1152161160 17:78669495-78669517 CCCATCCCAGCAATTCCTTCAGG + Intergenic
1152669195 17:81591709-81591731 GTCCTGCCAGCCATTCCGGCAGG - Intronic
1157141722 18:45114854-45114876 TTAATTCCAGCCTTTCCTTCTGG - Intergenic
1161777803 19:6273258-6273280 CTTTTTCCAGCCACTCCTTCTGG - Intronic
1162150217 19:8639701-8639723 GTCCTTCCAACAACTCCTTCAGG - Intergenic
1165253278 19:34557484-34557506 TTCATTCCAGCAAATCCCTCCGG + Intergenic
1166052270 19:40267410-40267432 GTCACTCAAGCCCTTCCCTCTGG + Intronic
1167964626 19:53132941-53132963 CCCACTCCAGCCATTCCTTCAGG - Intronic
926354166 2:12024429-12024451 GCCATTCCAGGCATTCCTCTGGG - Intergenic
927199113 2:20567622-20567644 GGCATTCCAGGCATTCTTTGGGG - Intronic
927397474 2:22670317-22670339 GTCATTGCATCCTTTACTTCTGG - Intergenic
929627496 2:43424538-43424560 GTCATTCCAGGCAGTGCTTGTGG - Intronic
929911339 2:46091832-46091854 GTGATTTCAGGCATTCCTTTTGG - Intronic
930443455 2:51439215-51439237 GTCATGCCAGCCAATCCAACAGG + Intergenic
932714681 2:74092758-74092780 GTCTTTCTGGCCTTTCCTTCAGG - Intronic
933042728 2:77488462-77488484 TTCATTCCACCCATTCGTCCTGG - Intronic
938752101 2:134342424-134342446 TTCATTCAAGGTATTCCTTCTGG - Intronic
940194774 2:151081471-151081493 GTCATTTCCACCATTGCTTCTGG - Intergenic
944493173 2:200278938-200278960 TTCATTCCAGAGATTCCTTAGGG + Intergenic
945037241 2:205714882-205714904 CTCACACCAGCCACTCCTTCCGG + Intronic
945310349 2:208305072-208305094 CTCATGCCAGCCTGTCCTTCTGG + Intronic
1168874477 20:1161351-1161373 GTTGTTCCAGCCCTTCTTTCTGG + Intronic
1169277164 20:4241609-4241631 GTAATGCCAGCCCTTTCTTCAGG + Intronic
1170812821 20:19687879-19687901 GACCTTCCAGCCACACCTTCTGG + Intronic
1172474219 20:35225719-35225741 TTAAATCCAGCCTTTCCTTCAGG + Intergenic
1172589072 20:36105036-36105058 ATCATTCCAGGCTTTCCTTCCGG + Intronic
1172634359 20:36400024-36400046 GTCCTGCCAGCCATTCCTGTAGG + Intronic
1173307638 20:41865157-41865179 GTCAGACCATCCATTCCTCCAGG - Intergenic
1176006230 20:62864403-62864425 GTGATTGCAGACATTTCTTCAGG + Intergenic
1177571568 21:22893686-22893708 GCAATTCCAGCCTTTCCTTTTGG - Intergenic
1178474106 21:32921286-32921308 GTCATTCCAGCAAGTTCTACTGG - Intergenic
1178588026 21:33886085-33886107 GTAATACCAGCTATTCATTCAGG + Intronic
1178822790 21:35990855-35990877 GTCAGGCCAGCCATTCCGTAGGG + Intronic
1179063761 21:38004942-38004964 GTCATTCCTGCCATTCAAACAGG + Intronic
1181264620 22:21623756-21623778 CTCCTGCCAGCCATGCCTTCAGG + Exonic
1183880814 22:40827175-40827197 CCCATTCCAGGCATTCCTCCGGG + Exonic
1183919393 22:41152560-41152582 GTCATTCCCCTCATTTCTTCAGG + Intronic
953076815 3:39579180-39579202 GTCATTTCTTCCCTTCCTTCAGG - Intergenic
953462275 3:43090892-43090914 GCCAGTCCAGTCATTCCTTTAGG - Intronic
955080455 3:55653618-55653640 GTCATTCCAGAGATTCTTCCAGG - Intronic
956044560 3:65181555-65181577 GTCTTTCTAGCCTGTCCTTCAGG - Intergenic
962162088 3:133011197-133011219 GTAAATACAGCCATTCCTTATGG + Intergenic
962455781 3:135564267-135564289 GGTATTCCAGCCATCCCTTGGGG - Intergenic
962697548 3:137965274-137965296 GGCATTCCAGACATCACTTCAGG + Intergenic
963293358 3:143517328-143517350 CCCATTCCAGGCATTCCTCCAGG + Intronic
964106483 3:153045902-153045924 GTCATTTCAGCCATCACTTGAGG - Intergenic
965604482 3:170485021-170485043 TTCATTCCCGCCCTTCCTCCAGG - Intronic
975156179 4:71075616-71075638 CTCACTCCAGCTCTTCCTTCAGG + Intergenic
981281590 4:142965747-142965769 GTAATTACAGCCATTCCATATGG + Intergenic
981497913 4:145414148-145414170 CTCATTCCAACCATCCCTGCAGG + Intergenic
981739035 4:147983791-147983813 GTCATTTCAGACATTCATTCCGG + Intronic
982692434 4:158564143-158564165 GGCATTCCAGCCATACCTGAAGG + Intronic
986030977 5:3892290-3892312 GTCATCCCGGCCATGCCTTGGGG + Intergenic
990701225 5:58476817-58476839 GTCTTTCCTGCCATCTCTTCTGG - Intergenic
991612379 5:68462823-68462845 TCCATTCCAGCCATTACTTTAGG - Intergenic
992259104 5:74952398-74952420 GTCATTCATGTCATTCATTCTGG - Intergenic
993055711 5:82976944-82976966 GCCATTCCAGACATTCCTCAGGG - Intergenic
994343118 5:98655117-98655139 TTTACTCCAGCCATTGCTTCAGG + Intergenic
1001823499 5:174727398-174727420 GTAATTCCAGCTGGTCCTTCGGG - Intronic
1002719094 5:181247005-181247027 GTCAACCCAGCGATTCCTCCCGG - Intronic
1003608036 6:7583280-7583302 TGAAATCCAGCCATTCCTTCGGG + Exonic
1003629060 6:7770370-7770392 GTGGTTCCAGTCATTCCTTAAGG - Intronic
1003629522 6:7774014-7774036 GTCATTCCAGCCTCACCTGCCGG + Intronic
1004716132 6:18218056-18218078 AACCTTCCAGCTATTCCTTCTGG + Intronic
1004748191 6:18533977-18533999 GTCATTCCCTGCATTCCTTTGGG + Intergenic
1004969803 6:20897188-20897210 GTCATGACAGCTATTCCCTCAGG - Intronic
1005059009 6:21758556-21758578 TTCATTCCACCCTTTCCTTCTGG + Intergenic
1005953758 6:30649439-30649461 GTAATTCCATCCATTCTGTCAGG + Intronic
1006067306 6:31471424-31471446 CTCATTGCAGCCATTCCCTGTGG - Intergenic
1007249728 6:40487614-40487636 GGGCTTCCAGCCATCCCTTCTGG - Intronic
1008416592 6:51247934-51247956 GTCATTCCAGCAATCCCATGGGG + Intergenic
1008441239 6:51533977-51533999 CCCATTCCAGCCATTGCTCCAGG + Intergenic
1013084733 6:106846699-106846721 GTCATCCCACCCATTTATTCTGG - Intergenic
1015866052 6:137727837-137727859 GTCTTTCCTTCCATTCCTGCAGG - Intergenic
1017072826 6:150591484-150591506 TTCATTGCAACCTTTCCTTCTGG + Intergenic
1017746615 6:157452549-157452571 GTAATTTCAGCCTTTCCTTTTGG + Intronic
1018022626 6:159776251-159776273 GTCACCCCAGCCAATGCTTCAGG + Exonic
1019628466 7:2033392-2033414 GTCATTCCTTCCACTGCTTCGGG - Intronic
1020272228 7:6603877-6603899 GTAATCCCAGCTATTCATTCGGG + Intronic
1022205338 7:28158361-28158383 GGCCTTCCTGCCCTTCCTTCTGG + Intronic
1023368087 7:39485091-39485113 GGTATTCCAGCCATCCCTTGGGG - Intronic
1023563831 7:41503997-41504019 TTCATTCCAGCATTTTCTTCAGG + Intergenic
1023624487 7:42102474-42102496 GTCATCCCAGCAATTCCTGTTGG + Intronic
1023763920 7:43493214-43493236 GTCTTTCCAGCCATTTTTCCCGG + Intronic
1024777071 7:52799929-52799951 GTCATGCCACACATCCCTTCAGG + Intergenic
1027431381 7:78116390-78116412 TTCATTCCATCCATTCTTTCTGG - Intronic
1033604614 7:142917507-142917529 GTCACAGCAGCCATTCCTTCAGG + Intronic
1035151755 7:156879815-156879837 GTGATTACAGCCATTCTTGCAGG - Intronic
1035753914 8:2017115-2017137 GTCATTGCAGCCATATCTTAGGG + Intergenic
1037019016 8:13944886-13944908 GTCATTCAGGGCATTCATTCAGG - Intergenic
1038855101 8:31322310-31322332 GTCATGCCAGCCATTCCTGAGGG - Intergenic
1042128071 8:65558864-65558886 TCCCTTCCATCCATTCCTTCAGG + Intergenic
1044887363 8:96793783-96793805 GTAAATACAGCCATTCCTTGTGG + Intronic
1048230881 8:132640016-132640038 TTCATTCAAGCCATTGTTTCTGG + Intronic
1052733652 9:32318460-32318482 GTCAGAGCAGCCCTTCCTTCTGG + Intergenic
1052912812 9:33898989-33899011 GTCATTCTAACCATACCTTGAGG + Intronic
1054856026 9:69900556-69900578 GTCATCCCAGACAGGCCTTCTGG - Intronic
1054856457 9:69904771-69904793 GTCATTCGGGCTATTTCTTCAGG - Intronic
1057197961 9:93125504-93125526 GTCATGCCAGTCCTACCTTCTGG - Intronic
1060691346 9:125663745-125663767 GTCATGAGAGCCCTTCCTTCTGG + Intronic
1187029315 X:15469426-15469448 GTCATTGCTTCCATACCTTCAGG + Intronic
1188869584 X:35358217-35358239 GTCATTCCAGCCAGTTCAGCTGG + Intergenic
1190757339 X:53412449-53412471 GGCATTCCAGCCACTCCATAAGG + Intronic
1193888239 X:87009532-87009554 GACATTCCAGTCATTCATTTGGG - Intergenic
1194388543 X:93287941-93287963 CCCATTCCAGGCATTCCTCCAGG + Intergenic
1194756637 X:97746104-97746126 AACTCTCCAGCCATTCCTTCTGG - Intergenic
1195936703 X:110132402-110132424 TTCAGGCCAGCGATTCCTTCAGG - Intronic
1196911457 X:120488391-120488413 GTCACTCCAGACATTCCTGTGGG - Intergenic
1200169046 X:154058746-154058768 GTCATTGCATCCACTCCTCCAGG - Intronic