ID: 1138577052

View in Genome Browser
Species Human (GRCh38)
Location 16:57914739-57914761
Sequence CCAGTGATGAAACGGGTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 73}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138577042_1138577052 22 Left 1138577042 16:57914694-57914716 CCAGTGAGTGCCAGAAGGAATGG 0: 1
1: 0
2: 3
3: 12
4: 191
Right 1138577052 16:57914739-57914761 CCAGTGATGAAACGGGTGTCTGG 0: 1
1: 0
2: 0
3: 8
4: 73
1138577041_1138577052 23 Left 1138577041 16:57914693-57914715 CCCAGTGAGTGCCAGAAGGAATG 0: 1
1: 0
2: 1
3: 20
4: 181
Right 1138577052 16:57914739-57914761 CCAGTGATGAAACGGGTGTCTGG 0: 1
1: 0
2: 0
3: 8
4: 73
1138577045_1138577052 12 Left 1138577045 16:57914704-57914726 CCAGAAGGAATGGCTGGAATGAC 0: 1
1: 0
2: 0
3: 15
4: 164
Right 1138577052 16:57914739-57914761 CCAGTGATGAAACGGGTGTCTGG 0: 1
1: 0
2: 0
3: 8
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138577052 Original CRISPR CCAGTGATGAAACGGGTGTC TGG Intronic
900160930 1:1223497-1223519 CAGGTGAGGAAACGGGTGTGGGG - Intronic
900697578 1:4021735-4021757 CCAGTGAGGAAATGGGTGGCAGG + Intergenic
900927067 1:5712427-5712449 CCGGTCATAAAGCGGGTGTCTGG + Intergenic
903536617 1:24071235-24071257 CCAGTGATCAAACTGATCTCCGG - Exonic
904725130 1:32540866-32540888 CCCTTGATCAAATGGGTGTCTGG + Intronic
906490377 1:46263672-46263694 ACAGTGATGAAGCAGATGTCAGG - Intronic
912013687 1:105005198-105005220 TGAGTGATGAAACAGCTGTCAGG + Intergenic
920208460 1:204310911-204310933 CCGGTGATGATGCGGGTGTGGGG + Intronic
923934819 1:238748455-238748477 CCAGTGATGAAATGGGGGAATGG + Intergenic
1063336038 10:5215274-5215296 CCAGTGATGGAAGTGGGGTCTGG + Intronic
1063627534 10:7704536-7704558 CCAGTGATTAGGTGGGTGTCTGG - Intronic
1065289246 10:24213775-24213797 CCAGTGATGAAGAGGATTTCTGG - Intronic
1065355411 10:24835518-24835540 CCAGTCTTGACAGGGGTGTCTGG - Intergenic
1071582823 10:86789019-86789041 TCAGGGATGAAAAGGGTGTCAGG + Intronic
1072415860 10:95246236-95246258 CCAGGGAAGAAGCGGGTGTGAGG + Intronic
1095453995 12:42363213-42363235 ACAGTGATGATACTGGTGTCAGG - Intronic
1100429651 12:94519267-94519289 CCAGTGTTGAAAGTGGGGTCTGG - Intergenic
1104798626 12:131537617-131537639 CCTGTGAGGAAACTGGTTTCCGG + Intergenic
1112081705 13:95979415-95979437 CCAGGGATGAAACGGGTGAAGGG - Intronic
1114586331 14:23817321-23817343 CCAGTGATGTGGCCGGTGTCTGG + Intergenic
1119644158 14:76336543-76336565 CCAGCCATGAAGAGGGTGTCAGG - Intronic
1122617952 14:103033840-103033862 CCAGTGAGGAAACTGCTGTGTGG - Intronic
1125965423 15:43871530-43871552 CCAGAGATGAAAAGGCTGTCAGG - Exonic
1128784908 15:70387671-70387693 CCAGTGAGGAAACTTGTGTCTGG + Intergenic
1129572725 15:76706174-76706196 TCAGTTATGAAATGGGTTTCTGG + Intronic
1138577052 16:57914739-57914761 CCAGTGATGAAACGGGTGTCTGG + Intronic
1143336743 17:6177111-6177133 CCAGTTGTGAAAGGGGTGTCTGG + Intergenic
1146017310 17:29244348-29244370 CCACTGATGAAACTTGAGTCGGG + Intergenic
1150650471 17:67006589-67006611 CAAGTGCTGAATGGGGTGTCTGG - Intronic
1166594730 19:44035357-44035379 CAAGTGAAGAAAAGGGTGACTGG + Intergenic
926528569 2:14012489-14012511 CCAGTGTTGAAATGGCTGGCTGG + Intergenic
941287043 2:163627686-163627708 CAAGTGATGAAACTGGTAACGGG - Intronic
948362427 2:237432573-237432595 CAAGTGATGACACGGAGGTCGGG - Intergenic
1179445105 21:41425652-41425674 CCAGGGTGGAAACGGGTGTGTGG - Intronic
1183186912 22:36297097-36297119 CTCGTTATGAAACGTGTGTCAGG + Intronic
1183614910 22:38938161-38938183 TCAGTGATGAACTGGGTGTCAGG + Intergenic
1183958961 22:41399445-41399467 ACTGTGATGAAGGGGGTGTCTGG - Intergenic
1184832680 22:46999605-46999627 CAAGTGATGAAACAGGTGAGGGG - Intronic
952003175 3:28809834-28809856 CCAGTGATGAAATGGGAGATTGG - Intergenic
957191826 3:77019634-77019656 CCACTGGTGAAACCAGTGTCAGG + Intronic
961122797 3:124387250-124387272 CCAGTGAGGAAACAAGTCTCAGG - Intronic
967241032 3:187439725-187439747 CCAGTGGTGGAAGGGTTGTCAGG + Intergenic
968544779 4:1193319-1193341 CCAGTGATGAAGGGTGTGTGGGG - Intronic
969345651 4:6568275-6568297 CCAGTGATGAATCTGGTGGGCGG - Intergenic
969897334 4:10317610-10317632 CCAGGCATGAAAGGAGTGTCTGG - Intergenic
973775609 4:54238663-54238685 CCAGTGATAAAACAGGTTGCAGG + Intronic
974250265 4:59376149-59376171 CCAGTGATGAGATGGGAGACTGG - Intergenic
977880899 4:102204542-102204564 CCAGAGAAGCAACAGGTGTCAGG - Intergenic
979715917 4:123837639-123837661 CCATTGCTGAAACTGGTGTGGGG + Intergenic
982631147 4:157830905-157830927 CTTGTGATGAAATGGGTTTCTGG - Intergenic
984693297 4:182753335-182753357 CCAGTGACAACACGGGTGACAGG - Intronic
987007421 5:13724634-13724656 CCAGTGATGAAAGTGGGGCCTGG + Intronic
988922998 5:35962007-35962029 CCAGTGTTGAAATGGGAGACTGG - Intronic
992812515 5:80403700-80403722 TAAGTGATGATACGTGTGTCTGG + Intergenic
996401630 5:123069229-123069251 CCAGGGAGTAAACGGGTGTGTGG + Intergenic
996825669 5:127678619-127678641 TCAGTGATGACAGGGGTGGCTGG - Intergenic
1000409568 5:160923988-160924010 CCCTTGATGAAAGGGTTGTCTGG + Intergenic
1001563510 5:172685213-172685235 CCACTGATTAAACCAGTGTCAGG - Intronic
1003141722 6:3477478-3477500 CCATTGATGGAACGGGGCTCGGG + Intergenic
1004031553 6:11874974-11874996 ACAGTGATGAAATGTGTTTCAGG + Intergenic
1004979754 6:21010462-21010484 CAAGTGATGAAATGGATCTCTGG - Intronic
1007631474 6:43275557-43275579 GCAGTGAGGTAACGGGAGTCAGG - Intronic
1018183676 6:161246118-161246140 GCAGTGATCAAACATGTGTCAGG + Intronic
1031084678 7:117290825-117290847 CCAGTGATTATAAGAGTGTCTGG + Intronic
1031713192 7:125075139-125075161 CCAGTGTTGAAAAGGGGGCCTGG + Intergenic
1034276761 7:149827240-149827262 CCAGTGAGGAAACTGAGGTCTGG + Intergenic
1039374962 8:37024007-37024029 CCACTGATGATACTGGTGTTCGG + Intergenic
1040959778 8:53019326-53019348 CCAGTGAGGAAGGGTGTGTCAGG - Intergenic
1044008434 8:86964297-86964319 CCAATGATGAAACGGGAGAATGG - Intronic
1045312731 8:101017293-101017315 GCAGGGAAGAAACGGGTCTCTGG + Intergenic
1048630302 8:136234957-136234979 CCAGTGAAGAAACATATGTCAGG - Intergenic
1048883681 8:138891331-138891353 CCAGTGATGAACCTGGGTTCAGG + Intronic
1049749491 8:144276555-144276577 CCTGGGCTGACACGGGTGTCAGG + Intronic
1055717184 9:79130988-79131010 CAAGTGATGAAACTGGTCTAGGG - Intergenic
1057495813 9:95560102-95560124 CAAGTGAGGAAACGGGAGGCCGG + Intergenic
1060280086 9:122209802-122209824 GCAGAGATGAAACTGGTTTCAGG - Intronic
1061310003 9:129755900-129755922 CCAGAGATAAAACGTGTCTCAGG - Intergenic
1062407801 9:136405298-136405320 CCTGTGATGGAATGGGTCTCAGG + Intronic
1188340410 X:28993963-28993985 CCAGTGATGAAAAGAGTACCTGG - Intronic
1195846527 X:109235014-109235036 CCAGTGCTGAAAGTGGGGTCTGG - Intergenic
1195978522 X:110553788-110553810 CAGGGGATGAAACGAGTGTCTGG + Intergenic
1202092536 Y:21208943-21208965 CCAGTGAAGAAAGATGTGTCAGG - Intergenic