ID: 1138577171

View in Genome Browser
Species Human (GRCh38)
Location 16:57915410-57915432
Sequence AGTCTCTCCCTTCCATGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 148}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138577167_1138577171 9 Left 1138577167 16:57915378-57915400 CCAGGGTGGAAGGTGAGGGGAGT 0: 1
1: 1
2: 1
3: 45
4: 536
Right 1138577171 16:57915410-57915432 AGTCTCTCCCTTCCATGGAAAGG 0: 1
1: 0
2: 1
3: 27
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138577171 Original CRISPR AGTCTCTCCCTTCCATGGAA AGG Intronic
902721619 1:18308059-18308081 AGCCTCTCTCTTCCATGGTTTGG + Intronic
903811750 1:26038592-26038614 AGCCTCTCCCCTCCAGGAAAGGG + Exonic
904282989 1:29434325-29434347 AGTCTCTCACTTCCTGGGAATGG - Intergenic
904979432 1:34484511-34484533 AAACTCTTCCTTACATGGAAGGG - Intergenic
905081445 1:35324615-35324637 AGTCTCTCCCTTGAATGGGGTGG + Intronic
908428199 1:64029629-64029651 TGTCTCTCTCTGCCATGTAAGGG - Intronic
908743238 1:67350046-67350068 AGGCTGTCCCTTCCATGGGTGGG - Intronic
911339408 1:96618684-96618706 AGTCTCTCCCTTGCATGCCTAGG + Intergenic
911563654 1:99436253-99436275 AGTCTCTCCTTCCCCTGGAGTGG - Intergenic
913250863 1:116910721-116910743 ATTCTCTCGCTTCCCTGGAAAGG - Intronic
916585325 1:166144911-166144933 AACTTCTCCCTTCCATGGACAGG - Intronic
916831480 1:168496505-168496527 AGTCTCTCCCTTTCAGGCAAGGG + Intergenic
918465063 1:184812619-184812641 GGTCTCTGCCTTCCAGGGAATGG + Intronic
919824485 1:201493767-201493789 AGCCTCTCCCTTCCTCGGGAGGG + Intronic
920705595 1:208248370-208248392 AGTCTCTCTCTTCCATTCACAGG - Intergenic
1066462466 10:35623966-35623988 ACTCACTCACTACCATGGAAGGG + Intergenic
1066984814 10:42455351-42455373 TGTTTCTTCCTTCCATGGCAAGG + Intergenic
1068738932 10:60447143-60447165 AGTCACCCCCTTCCCTGAAATGG - Intronic
1072458089 10:95594059-95594081 TGCCTCTCCTTTCCGTGGAAGGG - Intergenic
1073412155 10:103351058-103351080 TGTCTCTCCCGACCATGGAGGGG - Exonic
1074116606 10:110461129-110461151 ACTCTCTCCCTTCCCCAGAATGG - Intergenic
1074774381 10:116756215-116756237 TGCCTCTCACTTCCAGGGAAGGG + Intergenic
1075880559 10:125847221-125847243 CCTCCCTCCCTTCCATGGTATGG - Intronic
1078148096 11:8735869-8735891 ACTCTCTCCCATCCATGCCAGGG - Intronic
1078452478 11:11450432-11450454 AGGCTCCCCCTACCATGGAAGGG + Intronic
1080171238 11:29305603-29305625 AGACTCTTCCTTTCATGAAAAGG - Intergenic
1080453573 11:32398688-32398710 ATTCTCTCCATTTCATGGATGGG - Intronic
1081330679 11:41796117-41796139 AGTCTCTCCCTGCCATGTAGAGG - Intergenic
1083090710 11:60197247-60197269 TCTCTCTCCCTACCATGGTATGG - Intergenic
1084510766 11:69602152-69602174 ACTCTGTCCCCTCCATGGAAAGG + Intergenic
1086543805 11:87944675-87944697 ACTCTATACCTTCCATGAAATGG + Intergenic
1089070125 11:115693326-115693348 AGCCTCTCCTACCCATGGAAAGG + Intergenic
1089559598 11:119337169-119337191 TGTCTCTCCCTGGCATGGAGAGG + Exonic
1089838639 11:121394134-121394156 TGTTTCTCCCTTCCATGGTGGGG + Intergenic
1091756668 12:3056836-3056858 AGAGACTTCCTTCCATGGAAAGG + Intergenic
1093429534 12:19069087-19069109 AGTGTGTTCCTTCTATGGAAAGG - Intergenic
1100330791 12:93580114-93580136 AGTCTCACCCCACCATGGCAAGG - Intronic
1100352577 12:93798635-93798657 AGTCTCTTCCAACCTTGGAAAGG - Intronic
1100505743 12:95218153-95218175 TGTCTCTTCCTTCCTGGGAATGG + Intronic
1103740062 12:123085023-123085045 TGTCTCTCCCATCTGTGGAATGG - Intronic
1105525373 13:21173219-21173241 AGTCTCTCCCTTCCCCACAAGGG + Intronic
1106424282 13:29610944-29610966 CGTGTCTCCCTTCTCTGGAATGG - Intergenic
1106477629 13:30112048-30112070 CTTCTCTCCCTTCCATCCAATGG + Intergenic
1107951634 13:45467099-45467121 AGGCTGTCACTTCCTTGGAAAGG - Intronic
1118302903 14:64631073-64631095 AGTCTCCCTCCTCTATGGAATGG + Intergenic
1118593446 14:67418793-67418815 AGCCTCTCCCTGCCATGGAGGGG + Intergenic
1118814847 14:69303534-69303556 AGCCTCTCCCCTTCTTGGAATGG - Intronic
1123103896 14:105827332-105827354 GGTCTTTCCCTTCCTTGGTAAGG + Intergenic
1124849978 15:33327045-33327067 CGTCTTTCACTTCCATGCAAGGG - Intronic
1125193927 15:37024723-37024745 AGACTTTGCCTTCCTTGGAATGG + Intronic
1125687295 15:41571008-41571030 AGACTCTCCCTTACTTGGATTGG + Intronic
1125800585 15:42443327-42443349 AGTTTCTTCCTTCTATAGAAAGG - Intronic
1129219248 15:74121919-74121941 AGTCTCTCCCACACATGGATGGG + Intronic
1129978751 15:79846946-79846968 AGTCTCTTCCCTTCATGAAATGG + Intronic
1131021961 15:89106529-89106551 AGTCTTTCACTGCCATGGGATGG - Intronic
1131981466 15:97998828-97998850 TGTCTCTACCTTTCATGGTATGG - Intergenic
1132458604 16:38202-38224 AGACTCACCCTTCCCTAGAATGG + Intergenic
1132824264 16:1895384-1895406 AGCCTCTCCAGTCCACGGAAGGG + Intergenic
1134770485 16:16804943-16804965 AGTCTCTCACTTCCCAGGAAAGG + Intergenic
1134837962 16:17377594-17377616 CGACCCTGCCTTCCATGGAATGG + Intronic
1137774609 16:51044681-51044703 AGGCTCTCCTTTCCCTGGATGGG + Intergenic
1138577171 16:57915410-57915432 AGTCTCTCCCTTCCATGGAAAGG + Intronic
1139194988 16:64908016-64908038 TATCTCTCCCATCCATGCAAGGG - Intergenic
1140209639 16:72960130-72960152 AGTCACAGCCTTCCATGGTAAGG + Exonic
1141277197 16:82599062-82599084 TATCTCTGCCTTCCTTGGAAAGG + Intergenic
1145247349 17:21278232-21278254 TGTCTCACCCTTTCATGGCAGGG - Intergenic
1146426973 17:32749643-32749665 AGTCTCTGCCTTCCATGGTCAGG - Intronic
1147738068 17:42653568-42653590 AGTCTCGCCCTTTCAGGGAAGGG - Intergenic
1149184356 17:53979621-53979643 AGTCTCTCCCTTCAAGGAAATGG + Intergenic
1158426884 18:57348246-57348268 AGTCTTTCCTTTACTTGGAATGG + Intergenic
1159300867 18:66565818-66565840 GGCCTCTCCCTCTCATGGAAAGG + Intronic
1160372651 18:78387716-78387738 AGTCTATCTCTTCCTTTGAAAGG - Intergenic
1162353300 19:10164886-10164908 AGTCTCTCTCTGTCATGCAATGG - Intronic
1163142629 19:15360714-15360736 AGTCTATCACTTCCATCGATGGG - Intronic
1164404852 19:27935776-27935798 TGTGTCTTCCTTCCATGGCAGGG - Intergenic
1168633198 19:57973274-57973296 AGCATTTCCCTTGCATGGAATGG + Intronic
925404408 2:3596711-3596733 AGTCTGCCCCTTCCATTGATGGG + Intronic
925837477 2:7960072-7960094 AGTCTCTCCCCTGCTTTGAATGG - Intergenic
925966541 2:9072018-9072040 TGGCTCTCCCTCCCAGGGAAAGG + Intergenic
926605898 2:14898248-14898270 AGCCTCTCTCTTCCTTGAAAAGG + Intergenic
927858383 2:26541821-26541843 AGCCTCTTCCTTGCATGGAAAGG + Intronic
933150850 2:78913086-78913108 AGTGTCTCCCTTTGATGAAAGGG - Intergenic
933888880 2:86746676-86746698 TTTCTCTCCTTTCCATAGAATGG + Intronic
935190998 2:100778805-100778827 ATGCTCTCCCTCCCATGGCAGGG - Intergenic
935976128 2:108580785-108580807 ACTCTCTCTCCTCCATGCAAGGG - Intronic
936508675 2:113128497-113128519 AGTCTCTCCCTTCCAGATATGGG + Intronic
938398972 2:130972604-130972626 AGTCTGTCTCTTCTTTGGAAAGG - Intronic
938643417 2:133306714-133306736 TGACTCTCCCTACCATGAAATGG + Intronic
940616950 2:156060508-156060530 AGTCTCCCACTTCAATGTAATGG + Intergenic
944917537 2:204376478-204376500 AGTCTCTGGCTTCCATTTAAAGG - Intergenic
948079660 2:235195484-235195506 AGTCTCCCCCTGCCACGGAAGGG + Intergenic
1169084651 20:2819213-2819235 CCTCTCTCCCTTCATTGGAATGG - Intronic
1170437242 20:16342875-16342897 AGTCTTTCCATTCAAGGGAAAGG - Intronic
1170534814 20:17330260-17330282 AGTCTCTCTCTCACATAGAAAGG - Intronic
1172761882 20:37328794-37328816 AGTCTCTCCTGGCCATGGACGGG - Intergenic
1172922126 20:38492967-38492989 AGTCTCTCCATCCAATGGAAGGG - Exonic
1173277618 20:41598310-41598332 AGTCTCTCCCTACAATGCAATGG + Intronic
1175107975 20:56627992-56628014 TGACTCTCCCATCCACGGAATGG - Intergenic
1176052802 20:63129464-63129486 AATCTTTCCAATCCATGGAAGGG + Intergenic
1179514957 21:41899919-41899941 ACTTTCTCCCCTCCAAGGAAGGG - Intronic
1180736502 22:18021735-18021757 AGGGTCTCCCTACCATAGAATGG - Intronic
1180992029 22:19942432-19942454 AGCCTCTCTCTTGCAGGGAAAGG - Intronic
1183012620 22:34959468-34959490 AGTGTCTGCCTGCCATTGAAAGG + Intergenic
1184886999 22:47352474-47352496 AGTCACTCCCTTCCCTGACAGGG + Intergenic
949254059 3:2023983-2024005 ACTTTCTGCCTTCCAAGGAAGGG - Intergenic
950077254 3:10195921-10195943 AGTCTCTCCCTGCCAGAGAGGGG + Intronic
950605762 3:14078669-14078691 GGTCTCCGCCTTCCAGGGAATGG - Intronic
952124911 3:30289359-30289381 AGTCTTTCCCTACCAGGGAGTGG - Intergenic
953712929 3:45290167-45290189 ACTCTCTACCTTACAGGGAAAGG + Intergenic
953736000 3:45494520-45494542 AGGCTCTCCCTTCTAAGGCATGG - Intronic
954371225 3:50170502-50170524 TGTCTCTGCCTTTCAGGGAAAGG - Intronic
956748100 3:72325426-72325448 AGTCTATCCATTGCATGGACTGG - Intergenic
956809164 3:72847826-72847848 AGTCTCTCCCTTCCTGGGAACGG - Intronic
960411948 3:117337850-117337872 TCTCTTTCCCTTCCTTGGAATGG - Intergenic
960543876 3:118889872-118889894 AGTCACTCCCTTCCAGGAAAAGG - Intergenic
966318650 3:178676803-178676825 TGTCTCTCCCTAGTATGGAAAGG - Intronic
966731075 3:183151903-183151925 TGTCTGTCCCTTCCAGGGTATGG + Intronic
967327726 3:188258830-188258852 AATCCCACCCTTCAATGGAATGG - Intronic
967891222 3:194365849-194365871 AGTCCCTGGGTTCCATGGAACGG - Intronic
969418625 4:7076948-7076970 AGTCGGTTCCTTCCCTGGAAAGG + Intergenic
969601094 4:8176849-8176871 CCCCTCTCCCATCCATGGAAGGG + Intergenic
969670938 4:8590025-8590047 GGTGTCTCATTTCCATGGAAAGG + Intronic
969716604 4:8871097-8871119 ATCCTCTCCCTTCTGTGGAACGG - Intronic
975993763 4:80290018-80290040 ATTCCCTCCCTTCTATGGAAGGG - Exonic
976498547 4:85758867-85758889 AGCCTCTCTTTTCCTTGGAACGG - Intronic
977468283 4:97409345-97409367 AGTATATTCCTTCCATAGAAAGG - Intronic
980640181 4:135566765-135566787 AGTCTTTCCCTTCTGAGGAATGG + Intergenic
982195728 4:152911208-152911230 TGTCTATTCCTTCCATGGAATGG + Exonic
985881572 5:2642303-2642325 AGTCCCTGCCTGCCATGGAGGGG + Intergenic
986616711 5:9624821-9624843 CCTCTCTCCCTCCCATGGATCGG - Intergenic
986831567 5:11585187-11585209 AGTATTTCCCTTCTATGGCATGG - Intronic
988936649 5:36090116-36090138 AGTAACTTCCTGCCATGGAAAGG + Intergenic
990773693 5:59281039-59281061 AGTCTCTGTCTTCCATGGAGAGG + Intronic
992857303 5:80875600-80875622 AGTGTCACCCTTCCAGTGAAAGG - Intronic
993301174 5:86212594-86212616 AGACTCTTCCTTCCATGGTTAGG + Intergenic
995576593 5:113542804-113542826 TGTCTTTCCCTTCCTTGGAAAGG + Intronic
995950892 5:117712465-117712487 AGTTTCTCTCTTTCATGGAATGG + Intergenic
996650169 5:125866173-125866195 AGTCTCTTCCTTCTATGCAGTGG + Intergenic
997251173 5:132389765-132389787 AGTCACCCGCTTCCAAGGAATGG + Intronic
998639750 5:143996122-143996144 GTTCTCTCCCTTCCCTGGGAAGG + Intergenic
998685920 5:144524826-144524848 GGTCTCTCCCTTCCACTGAATGG - Intergenic
1001666548 5:173438043-173438065 AGTCTCTCCCAGGAATGGAAGGG - Intergenic
1004470282 6:15922859-15922881 AGTCTCTCCTTCCCATGGTATGG - Intergenic
1008563615 6:52746336-52746358 AGTAGCTCCCTCCCATTGAAAGG + Intergenic
1011920553 6:92570788-92570810 AGTCTCTTACTTTCATGGAAAGG + Intergenic
1014565696 6:122945297-122945319 TGTCACTCCTTTCCATGGCAAGG + Intergenic
1015754917 6:136597288-136597310 ACTGTCTCCCTTCCATAGATGGG - Intronic
1016110606 6:140218914-140218936 AGGCTCACCCTTCCATAGCAAGG - Intergenic
1016982514 6:149865561-149865583 AATTTCTCCCTTTGATGGAATGG - Intergenic
1017091733 6:150764786-150764808 AGCCTCTCCCCTCCCTGGAACGG + Intronic
1017867429 6:158456013-158456035 TTTCCCTCCTTTCCATGGAAAGG - Intronic
1019539028 7:1543323-1543345 AGCCTCTCCCTTCCAGTGGAAGG + Exonic
1022111762 7:27236375-27236397 AGCCTCTCCCTCCCGTGAAATGG - Intergenic
1022952359 7:35351062-35351084 TCTCTCTCACTCCCATGGAAGGG + Intergenic
1023475126 7:40569256-40569278 AGTCTCTCCTTTCCATCCAGTGG + Intronic
1025866748 7:65389417-65389439 AGTCTCTTCCTCCCATGAAAAGG - Intronic
1031078089 7:117231997-117232019 AGCCTCACCTTTCCATGAAATGG - Intergenic
1032334825 7:131015847-131015869 CGTCTCTCCCTGCCTTGTAAGGG - Intergenic
1036133574 8:6138794-6138816 AGTGTCTCCCCACAATGGAAAGG - Intergenic
1037913603 8:22758855-22758877 GGCCTCTCCCTTCCAAGGCAAGG - Intronic
1041472601 8:58227169-58227191 AGTCACTTCCTTACCTGGAAAGG - Intergenic
1044096233 8:88069509-88069531 AGTGTCTCCCTTCACTGCAAAGG + Intronic
1046227039 8:111295842-111295864 GTTCTCTCTCTTCCATGGCATGG + Intergenic
1049755137 8:144308088-144308110 GGTTTCTCCCTGCCAGGGAAGGG - Intronic
1050709086 9:8439433-8439455 ACTCTCTCCCTTCAAAGAAAAGG - Intronic
1051671170 9:19512165-19512187 ACTCTCTCCCTGCCCAGGAATGG + Exonic
1053052869 9:34976406-34976428 AGTCTCTGCCTCCCATGGCCAGG - Intronic
1055286927 9:74738742-74738764 ATCCTATCCCTTCCATAGAAAGG - Intronic
1058148022 9:101432790-101432812 ACTCTTTCCCTTGAATGGAAAGG - Intronic
1058285230 9:103169232-103169254 AGTCTCTCCCTTCAGCGTAATGG + Intergenic
1186600250 X:11029012-11029034 ATTCTCCCCCTTCTATGGAGGGG - Intergenic
1187376355 X:18758688-18758710 AGTCTCTATTTTCCATGAAAAGG - Intronic
1192045973 X:67674678-67674700 AGTCTCTCCCTTCAAGGAAGTGG + Intronic
1193676098 X:84454341-84454363 AGACTCTCCCTTCAAGGTAATGG - Intronic
1197881079 X:131167301-131167323 AGTATGTCCTTTCCATGAAAAGG + Intergenic
1199404217 X:147437146-147437168 AGTCTCTCCGTGCCATAGTAGGG + Intergenic
1200927544 Y:8668118-8668140 AGTCTCCCGCTTCTATGTAAGGG + Intergenic