ID: 1138577330

View in Genome Browser
Species Human (GRCh38)
Location 16:57916337-57916359
Sequence GAGAGGCCCAGCCCCCAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 464
Summary {0: 1, 1: 0, 2: 4, 3: 54, 4: 405}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138577318_1138577330 24 Left 1138577318 16:57916290-57916312 CCCAAGGACCATCTGAGCCTTGG 0: 1
1: 0
2: 16
3: 10
4: 177
Right 1138577330 16:57916337-57916359 GAGAGGCCCAGCCCCCAGGGAGG 0: 1
1: 0
2: 4
3: 54
4: 405
1138577320_1138577330 23 Left 1138577320 16:57916291-57916313 CCAAGGACCATCTGAGCCTTGGT 0: 1
1: 0
2: 0
3: 17
4: 176
Right 1138577330 16:57916337-57916359 GAGAGGCCCAGCCCCCAGGGAGG 0: 1
1: 0
2: 4
3: 54
4: 405
1138577321_1138577330 16 Left 1138577321 16:57916298-57916320 CCATCTGAGCCTTGGTGAAAGCC 0: 1
1: 0
2: 0
3: 17
4: 141
Right 1138577330 16:57916337-57916359 GAGAGGCCCAGCCCCCAGGGAGG 0: 1
1: 0
2: 4
3: 54
4: 405
1138577326_1138577330 -5 Left 1138577326 16:57916319-57916341 CCTTGAGTTTTATGGGTGGAGAG 0: 1
1: 0
2: 1
3: 11
4: 147
Right 1138577330 16:57916337-57916359 GAGAGGCCCAGCCCCCAGGGAGG 0: 1
1: 0
2: 4
3: 54
4: 405
1138577322_1138577330 7 Left 1138577322 16:57916307-57916329 CCTTGGTGAAAGCCTTGAGTTTT 0: 1
1: 0
2: 0
3: 14
4: 219
Right 1138577330 16:57916337-57916359 GAGAGGCCCAGCCCCCAGGGAGG 0: 1
1: 0
2: 4
3: 54
4: 405

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138577330 Original CRISPR GAGAGGCCCAGCCCCCAGGG AGG Intronic
900395520 1:2451732-2451754 TCGCTGCCCAGCCCCCAGGGAGG - Intronic
900486395 1:2924745-2924767 TAGAGCTCCAGCCCCCATGGAGG - Intergenic
900587464 1:3440077-3440099 CAGAGGCCCGGCCCACTGGGAGG - Intergenic
900591211 1:3460838-3460860 GAGCCTCCCAGGCCCCAGGGAGG - Intronic
900648091 1:3718045-3718067 GGGAGGCCCAGGCCTCAGGGTGG - Intronic
900765373 1:4501353-4501375 GAGAGGCTGTGCCCCCATGGTGG - Intergenic
901053149 1:6435773-6435795 GGGAGGACCAGCCACCAGGAGGG - Intronic
901053626 1:6438265-6438287 GGGAGGACCAGCCACCAGGAGGG - Intronic
901451298 1:9338305-9338327 GGGAGACCCTGTCCCCAGGGAGG + Intronic
902374328 1:16023205-16023227 GTGAGGGCCAGCTCCCAGGCTGG + Intronic
902379285 1:16045082-16045104 GTGAGGGCCAGCTCCCAGGCTGG + Intronic
902481092 1:16712276-16712298 GGGAGGACCAGCCACCAGGGGGG + Intergenic
902548700 1:17206456-17206478 GAGAGAACCAGCCCCCACAGCGG - Intronic
902614001 1:17613901-17613923 CACAGTACCAGCCCCCAGGGTGG + Intronic
902864396 1:19268865-19268887 GAGGGGCCCAGCATCCTGGGTGG - Intergenic
902869633 1:19306311-19306333 GAGGGGCCCAGCATCCTGGGTGG - Intronic
903236711 1:21955398-21955420 GAGAGGCCCAGCCCTCTTGCTGG - Intergenic
903353087 1:22730055-22730077 CACAGGGCCAGGCCCCAGGGTGG + Intronic
903372780 1:22847592-22847614 GAGGGGCCCAGGGCCCAGGCAGG + Intronic
903668657 1:25022746-25022768 CAGAGGCCCAGAGCCCACGGTGG - Intergenic
903738163 1:25543530-25543552 GACAGGCCCCGCCCCCAGACGGG - Intergenic
903850264 1:26301525-26301547 GGGAAGCCCAGCCCTCAGGGAGG + Intronic
904370368 1:30044232-30044254 GAGGGGCCCTTCCCCCAGAGGGG + Intergenic
904437481 1:30508116-30508138 GAGGCTCCCAGTCCCCAGGGGGG + Intergenic
904947253 1:34208438-34208460 GACAGGCCCAGCACACAGGAAGG - Intronic
905945767 1:41900541-41900563 GAGAGGCCCAGCCCAGGGAGAGG - Intronic
906141313 1:43535373-43535395 TAGAAGCCCAGGGCCCAGGGAGG - Intronic
906556671 1:46719271-46719293 GGGTGGCCCCGCCCCCAGGAGGG + Intergenic
906607247 1:47181124-47181146 GAGAGACCCAGCCTGCAGGAGGG - Intergenic
906835009 1:49073937-49073959 GAGATGCCCAGCCCACGAGGTGG + Intronic
907051822 1:51334870-51334892 GAGTGGCCCACCCCTCAGGAGGG + Intronic
907370889 1:54002709-54002731 GAGATGCTCAGCCACCAGGCAGG - Intergenic
907918679 1:58893652-58893674 GAGAGACCCAGCCTCCACAGGGG + Intergenic
909303909 1:74047815-74047837 TAGAGCCCCAACCCCCAGTGTGG + Intronic
910110055 1:83673316-83673338 GAGAGGCACAGCAACCAAGGAGG + Intergenic
912496892 1:110097617-110097639 CAGTGCCCCAACCCCCAGGGTGG - Intergenic
914418264 1:147504600-147504622 CAGAGGCCCAGACCCTAAGGAGG - Intergenic
915448592 1:155989311-155989333 GGGATGCCCAGGCCCCAAGGAGG - Intronic
915497352 1:156291583-156291605 GAGAGGCTCAGCCCCAGGGGCGG - Exonic
916063805 1:161120211-161120233 TACAGGCCCAGCCCACTGGGAGG + Exonic
916678800 1:167086224-167086246 GTGGGGCCCAGGCCCCAGCGGGG + Intronic
917960619 1:180141498-180141520 GAGAGCCCGAGCTACCAGGGAGG + Intergenic
918243522 1:182640388-182640410 GTGAGCCCCAGCCCCCTGGAAGG + Intergenic
919847359 1:201650302-201650324 GAGAGCCCCTGCCCTCAGAGAGG + Intronic
920400088 1:205670856-205670878 GAGAATCCCAGGCCCTAGGGGGG + Intronic
922748322 1:228059562-228059584 GAGGAGTCCCGCCCCCAGGGAGG - Exonic
922748354 1:228059658-228059680 GAGCAGCCCAGCCACCAGAGAGG - Exonic
923039244 1:230308090-230308112 GCGAGGAACAGGCCCCAGGGTGG - Intergenic
923790682 1:237108466-237108488 CAGCGGCCCTGCTCCCAGGGAGG - Intronic
1069124700 10:64615837-64615859 GAGAGTCCCACCCTGCAGGGAGG - Intergenic
1069894997 10:71674980-71675002 CTGAGGCCCAGACCCCAGTGAGG - Intronic
1069959316 10:72070287-72070309 GAGGAGCCCAGGCCCCAGGTAGG - Intronic
1070602526 10:77875861-77875883 AGGAGGCCGAGCCCCTAGGGAGG - Intronic
1070659242 10:78293096-78293118 GAGAGCCTCTGCCCCCAGGGAGG - Intergenic
1070824622 10:79384107-79384129 GGGAACCCCAGCCCCCAAGGTGG + Exonic
1071828384 10:89348284-89348306 TAGAAACTCAGCCCCCAGGGAGG - Intronic
1072619813 10:97072509-97072531 GAAAGACACAGCCCCCAGGCAGG + Intronic
1073102058 10:101011661-101011683 CAGAGTCCCAGAGCCCAGGGAGG - Intronic
1074199599 10:111223098-111223120 GACAGCCCCAGCTGCCAGGGTGG - Intergenic
1074313550 10:112342785-112342807 GAGAGGCCCTGGGCCCAGAGCGG - Intergenic
1075486499 10:122826340-122826362 GAGAGGTGCAGGCCCCATGGAGG + Intergenic
1075581356 10:123620842-123620864 GAGAGTCCCAGGGCCCAGGTGGG - Intergenic
1076055239 10:127367435-127367457 GAGAGTCCCAGGCCACAAGGAGG - Intronic
1076384495 10:130046685-130046707 GACACGCCCAGCCCGCAGCGCGG - Intergenic
1076729045 10:132429291-132429313 GGGAGGCCCAGACATCAGGGAGG - Intergenic
1076820954 10:132939355-132939377 GAGAGGCCCAGACCCCTGAGAGG - Intronic
1077015028 11:395599-395621 GTGAGGCCCAGCCCGGAGTGGGG - Intronic
1077078152 11:710487-710509 GTAAGGCCCCGCCCCCAGGTAGG + Intronic
1077094469 11:793430-793452 GACAGGCAGAGCCCCCAGGTGGG + Intronic
1077141824 11:1028130-1028152 CACAGGCCCAGCTGCCAGGGTGG - Intronic
1077183910 11:1228167-1228189 GCGGGGCCCAGCTCACAGGGGGG - Intronic
1080586928 11:33690941-33690963 GGGAGGCCCAGTCCACAGGGAGG - Intergenic
1081532225 11:43969870-43969892 GAGAGGCACAACCCCCTGAGTGG + Intergenic
1081947213 11:47007925-47007947 CAGAGTCCCAGCCCCCAACGTGG + Intronic
1083207575 11:61161681-61161703 AAGAGGCCCCGCCCACTGGGCGG + Intergenic
1083302627 11:61746758-61746780 GAGTCGCCCAGGCCCCTGGGAGG - Exonic
1083319712 11:61838302-61838324 TGGAAGCCCAGCACCCAGGGGGG - Intronic
1083609655 11:63998890-63998912 GTGAGAGCCCGCCCCCAGGGTGG + Intronic
1083662956 11:64260280-64260302 GTCAGACCCAGCCCCCTGGGAGG - Intronic
1083765455 11:64839343-64839365 GTGAGACCCAGGCCCCAGGTGGG - Intronic
1083848972 11:65354593-65354615 TAGAAGCCCCGCCCCCAGAGGGG + Intergenic
1083856602 11:65396195-65396217 GACAGGACCAGGCCCCATGGGGG + Intronic
1084635514 11:70389775-70389797 TAGAGACCCAGCCCCCCAGGAGG - Intergenic
1084939935 11:72607079-72607101 GAGGGGCTCAGCCCCCAGTGAGG - Intronic
1085043467 11:73340315-73340337 GAAAGGCCCTGCCCCCAAGAAGG - Intronic
1085265568 11:75236098-75236120 CAGAGGCCCAGGCCACAGAGCGG + Intergenic
1085568968 11:77542670-77542692 GAGAGGCCCAGCCCTTCAGGAGG + Intronic
1089332016 11:117696263-117696285 AAGAGATCAAGCCCCCAGGGGGG - Intronic
1089494113 11:118899887-118899909 GACAGGCCAGGGCCCCAGGGAGG - Intronic
1089504835 11:118956277-118956299 GTGAGGCCCTGCCCCTGGGGTGG - Intronic
1089605680 11:119639991-119640013 GAAAAGCCCCGCCCCCAGAGGGG - Intronic
1090626647 11:128614228-128614250 GACAGCCCCAGCCTCCAGGCTGG + Intergenic
1091331034 11:134730975-134730997 GAGAGGGGCAGCCACCAGGAGGG - Intergenic
1091374312 12:16015-16037 GAGTGGCCCAGCCACCGGAGGGG + Intergenic
1091754172 12:3040968-3040990 GAGAGGCCCCATCCCCTGGGGGG + Intergenic
1094719854 12:33052631-33052653 CAGAGGCCAAGACCCCGGGGTGG + Intergenic
1094838545 12:34333493-34333515 GAGAGGGCCCGCCCCACGGGCGG + Intergenic
1094870854 12:34598509-34598531 GAGAGTCTCAGGCCCCCGGGGGG + Intergenic
1096598535 12:52713811-52713833 GGGAGGCCCTGCCTACAGGGAGG + Intergenic
1096601714 12:52734465-52734487 GAGGGGCCCAGGCCTCAGTGTGG - Intergenic
1096842076 12:54385720-54385742 GTCAGGCCCAGGCCCCTGGGGGG - Intronic
1097260378 12:57716472-57716494 CAGAGGACCAGGCCCCAGGAGGG + Exonic
1099558997 12:84149048-84149070 GAGAGGCCCAAGGCCCTGGGAGG + Intergenic
1101790064 12:107918156-107918178 CAGAGACCCAGCACCCAGGGAGG + Intergenic
1102349211 12:112179686-112179708 GACAGGCCCCTCCCCGAGGGTGG + Intronic
1102573354 12:113840963-113840985 GATGGGCCAAGGCCCCAGGGGGG - Intronic
1103059553 12:117847681-117847703 GGCAGGGCCAGCCCCCACGGTGG - Intronic
1103558292 12:121779001-121779023 GATAGGCCCAGCCCCCTCGGTGG + Exonic
1104775456 12:131387897-131387919 GCGTGGCCCAGGCCCCAGGATGG + Intergenic
1104848044 12:131856914-131856936 GAGGAGCCCAGGCCCCATGGAGG - Intergenic
1105583631 13:21723919-21723941 AGGAGGCACAGCCCCCGGGGAGG - Intergenic
1105884493 13:24630243-24630265 AAGAAGCCAAGCCCCAAGGGAGG + Intergenic
1108274203 13:48791379-48791401 GAGAGGTGCAGTGCCCAGGGAGG - Intergenic
1110366137 13:74687975-74687997 GAGAGGCCCAGCCCGCCTTGAGG + Intergenic
1112802609 13:103129437-103129459 GAGAAGCCCGGCCCTCAGTGTGG + Intergenic
1113483323 13:110637416-110637438 GACAGGCCCAGGCCCAAGTGTGG - Intronic
1113782548 13:112985050-112985072 GGGAGGCCATGCCCCCAGCGGGG + Intronic
1113806963 13:113115592-113115614 GCGAGAGCCAGCCCCCGGGGTGG - Intronic
1113911630 13:113844078-113844100 GAGAGCCCCAGGCCACAGGCAGG + Intronic
1114516255 14:23301980-23302002 GTGCGGCCCAGCTGCCAGGGTGG + Intronic
1119170204 14:72529195-72529217 GAGAGGCCCAGGCCAGAGGGAGG + Intronic
1120698485 14:87671298-87671320 GAGAGGCCCAACCCCAAAGGCGG + Intergenic
1121320365 14:92988397-92988419 GACTGGCCCAGCCCCCCGAGGGG + Intronic
1121489753 14:94349350-94349372 CAGAGGCTCAGCCCTCAGGCAGG - Intergenic
1121517247 14:94560920-94560942 GTGAGGCCCTGCCCACAGGTGGG + Intergenic
1121535156 14:94686117-94686139 GAGAGACCCAGGCACCTGGGAGG + Intergenic
1122236391 14:100332861-100332883 GTGAGACCCTGGCCCCAGGGAGG - Intergenic
1122273313 14:100578035-100578057 GGGAGGCACAGCCCCCAAGAGGG - Intronic
1122278670 14:100608965-100608987 GAGGGGCCCAACGCCCAGGATGG + Intergenic
1122623822 14:103074189-103074211 GAGAAGCCCAGAGCCAAGGGAGG - Intergenic
1122941740 14:104984631-104984653 CAGGGCCCCAGGCCCCAGGGTGG + Intergenic
1124201394 15:27681435-27681457 CTGAGCCACAGCCCCCAGGGAGG + Intergenic
1125553966 15:40569248-40569270 GGGAGGCCCAGTCCCGAGGCGGG - Intergenic
1128501802 15:68231772-68231794 GAAAGGCCCAGCCCCCTGCCAGG - Intronic
1128738067 15:70064731-70064753 GGGAGGCCCAGTCCCCAGGGTGG + Intronic
1128761585 15:70219742-70219764 GGGCGCCCCAGCCCACAGGGTGG - Intergenic
1129399054 15:75269276-75269298 CAGAGGCCCCAGCCCCAGGGAGG + Intronic
1129402661 15:75293552-75293574 CAGAGGCCCCAGCCCCAGGGAGG + Intronic
1129688468 15:77699787-77699809 AAGGGGCCCTGCCACCAGGGAGG - Intronic
1129728477 15:77916084-77916106 CAGAGGCCCCAGCCCCAGGGAGG - Intergenic
1131013464 15:89038608-89038630 GGGAGGCCCAGCAGCCATGGTGG - Intergenic
1131516173 15:93078514-93078536 GAGATGACCAGACCCCAGGACGG - Intronic
1132252655 15:100345836-100345858 GAGGAGCCCAGAGCCCAGGGTGG - Intergenic
1132454611 16:15583-15605 GAGTGGCCCAGCCACCGGAGGGG + Exonic
1132457259 16:31090-31112 GCTTGGCCCAGACCCCAGGGAGG + Intergenic
1132623404 16:878969-878991 GACTGGCCCAGCCCCCCTGGAGG + Intronic
1132819628 16:1857316-1857338 GAGCTGCCCAGCAACCAGGGAGG - Intronic
1132977830 16:2719470-2719492 GAGTGTCCCGGCCCGCAGGGAGG + Intronic
1133078172 16:3295603-3295625 GAAAGGCCTAGCCCCTAGGGCGG - Intronic
1134024646 16:10944644-10944666 GAGCGGCCCAGCGCCCGCGGCGG - Exonic
1134025101 16:10947259-10947281 GAGTGGCACAAGCCCCAGGGTGG - Intronic
1134447205 16:14339661-14339683 GAGAGGCCCAGATCCTAGGATGG - Intergenic
1135822111 16:25693251-25693273 GAGAGGCCCAAGCCCCCGCGAGG + Intronic
1136247747 16:28985175-28985197 GAAAGTCCCTGCTCCCAGGGTGG - Intronic
1136458297 16:30394964-30394986 GAGAGGCCGAGGGCCCGGGGTGG - Intronic
1136923121 16:34347176-34347198 GTGAGGCCCAGAACCCATGGTGG - Intergenic
1136981452 16:35064630-35064652 GTGAGGCCCAGAACCCATGGTGG + Intergenic
1138081253 16:54093428-54093450 GAGAAGCCCAGCTCCCTGGCAGG + Intronic
1138106662 16:54290636-54290658 GAGAGGCGCAGCGCTCAGAGTGG + Intergenic
1138577330 16:57916337-57916359 GAGAGGCCCAGCCCCCAGGGAGG + Intronic
1139512442 16:67435293-67435315 GACAGTCCCAGGCCCCAGTGTGG - Intronic
1139711414 16:68779315-68779337 AAGAGGCACATCCTCCAGGGAGG + Intronic
1139711912 16:68782299-68782321 GAGAGGCAGTGCCCCCAAGGTGG - Intronic
1139963464 16:70731123-70731145 TCCAGGCCCAGCCCCCAGTGCGG - Intronic
1139974161 16:70795698-70795720 GAGAGCCCAAAGCCCCAGGGAGG - Intronic
1140188794 16:72796986-72797008 GAGAGGGACAGCGCCGAGGGGGG - Exonic
1141206612 16:81937944-81937966 CATCGGCCCAGCCCCCAGGGAGG - Intronic
1141249758 16:82344665-82344687 GAGATGCCCAGCCCCTATGTTGG + Intergenic
1141428904 16:83960812-83960834 CAGAGTCCCAGCCCCAAGTGGGG - Intronic
1141490368 16:84368470-84368492 GTGAGGCCCCGCCCCTGGGGCGG - Intergenic
1141643433 16:85354870-85354892 GAGTAGCTCAGTCCCCAGGGTGG + Intergenic
1141797598 16:86285640-86285662 GGGCGGCCCAGCCCGGAGGGGGG - Intergenic
1141806505 16:86345421-86345443 GAGAGGGTCAGCTCCCAGCGTGG - Intergenic
1141807588 16:86352090-86352112 GAGAGGGTCAGCTCCCAGCGTGG + Intergenic
1141927255 16:87177824-87177846 GCGAGGGTCAGGCCCCAGGGGGG + Intronic
1142185675 16:88693696-88693718 GAGAGCCCCTGGCCCCAGGCCGG - Intergenic
1142354791 16:89597277-89597299 GCCAGGCCCAGCCCTCTGGGGGG - Intergenic
1142781272 17:2182965-2182987 GAGAGGCCCAGCACTGTGGGAGG + Intronic
1142809335 17:2387834-2387856 GTGAGCCCCAGCCCCCACGCTGG - Intronic
1143088345 17:4433719-4433741 GAGTTGTCCAGTCCCCAGGGTGG + Exonic
1143092825 17:4459114-4459136 GTCAGGCCCAGCAACCAGGGAGG - Intronic
1143167008 17:4901833-4901855 GCGAAGCCCCGCCCCGAGGGCGG + Exonic
1143372629 17:6449797-6449819 CCGAGGCCCTGCCCCCAGGATGG - Intronic
1143866181 17:9925729-9925751 GAGAGGCCCAGCAGCCAGAGTGG + Intronic
1144781320 17:17809896-17809918 CATAGGCCCCGCCCCCAGTGTGG - Intronic
1145249027 17:21287395-21287417 GGGAGGCCCAGTGCCCAGGATGG - Intronic
1145978863 17:28999696-28999718 CTGAGGCCCAGCCCCCAGGTGGG - Intronic
1145998932 17:29120138-29120160 GACAGGCCCAGCTCCCAAAGGGG + Intronic
1146794922 17:35774155-35774177 CAGAGTCTCAGCCCTCAGGGAGG - Intronic
1148089803 17:45016500-45016522 GAGATGTGCGGCCCCCAGGGAGG - Intergenic
1148129559 17:45254801-45254823 GTGAGGCCCGACCCCCAGGGTGG + Intronic
1148381312 17:47200386-47200408 GAGAAGCTTAGCCCCCAAGGGGG - Intergenic
1149597370 17:57872313-57872335 CAGAGCCCCAGCCCCAAGGCAGG - Intronic
1150300044 17:64040231-64040253 GAGAAGCCCAGCGCCCTGGAAGG - Exonic
1150652413 17:67018641-67018663 GAGAGCCACACCCCTCAGGGAGG - Intronic
1151352877 17:73542166-73542188 GAGAGGCACAGCCCCCAGAGAGG - Intronic
1151495145 17:74454255-74454277 GCGAGGCCCAGCTCTGAGGGCGG - Intergenic
1151946610 17:77323180-77323202 GAAGGCCACAGCCCCCAGGGAGG - Intronic
1152076638 17:78164135-78164157 CAGAGGGGCAGGCCCCAGGGTGG + Exonic
1152231018 17:79114276-79114298 GAAAAGGCCAGGCCCCAGGGTGG - Intronic
1152259861 17:79261000-79261022 GAGAGGCCCCGGCCCCAGGACGG - Intronic
1152267899 17:79306842-79306864 CAGAGGCCCAACGCCCAGGCTGG - Intronic
1152637469 17:81436048-81436070 GAGAGGCCCAGTCGGCAGGGTGG - Intronic
1152691680 17:81720928-81720950 GTGAAGCCCAGCGACCAGGGAGG - Exonic
1152720962 17:81923688-81923710 GAGAGCCGCAGCCCCCAGCCTGG + Intronic
1152781718 17:82229807-82229829 GACTGGCCCAACACCCAGGGAGG - Intronic
1152858495 17:82680220-82680242 GAGAGACCCAGGCCCCAGTGTGG - Intronic
1152961269 18:81892-81914 GCTTGGCCCAGACCCCAGGGAGG + Intergenic
1153015052 18:576077-576099 GGGAGGTGGAGCCCCCAGGGTGG - Intergenic
1154028319 18:10727116-10727138 CAGATCCCCAGGCCCCAGGGAGG - Intronic
1154066281 18:11110383-11110405 GGGAGGCCCAACTCCCAGGGTGG - Intronic
1154411487 18:14144380-14144402 GAGGCCCCCAGCCCCCAGAGGGG - Intergenic
1157754117 18:50203235-50203257 TAGAGGCCAGGCCCACAGGGAGG + Intergenic
1158514209 18:58117705-58117727 GAGAGGCCCAGAAACCAGGCTGG - Intronic
1159927366 18:74281396-74281418 GAAAAGCCCAGGCCCCAGGGGGG + Intronic
1160851626 19:1195549-1195571 GAGAGGCCCAGGTCCCAGGTGGG - Intronic
1160851650 19:1195623-1195645 GAGAGGCCCAGGTCCCAGGTGGG - Intronic
1160851809 19:1196278-1196300 GAGAGGCCCAGGCTCCAGGTCGG - Intronic
1160852050 19:1197363-1197385 GAGAGGCCCAGGTCCCAGGTGGG - Intronic
1160852074 19:1197437-1197459 GAGAGGCCCAGGTCCCAGGTGGG - Intronic
1160852233 19:1198092-1198114 GAGAGGCCCAGGCTCCAGGTCGG - Intronic
1160894042 19:1394592-1394614 GAGGGGCGCGGTCCCCAGGGAGG - Intronic
1160894074 19:1394688-1394710 GAGAAGCACAGTCCGCAGGGAGG - Intronic
1161061042 19:2215092-2215114 TATAGTCCCAGCTCCCAGGGAGG + Intronic
1161136818 19:2624872-2624894 GAGTGGCCCAGCCCACAGCGTGG - Intronic
1161136852 19:2625011-2625033 CAGGGCCCGAGCCCCCAGGGAGG - Intronic
1161295815 19:3519741-3519763 AGGAGCCCCTGCCCCCAGGGTGG + Intronic
1161339078 19:3730800-3730822 TGGAGTCCCAGCCACCAGGGAGG - Intronic
1161489131 19:4552279-4552301 GAGAGGCCTCGGCCCCAGGCTGG - Intronic
1161934887 19:7365520-7365542 AAGAGGTCCAGATCCCAGGGAGG - Intronic
1162038526 19:7955505-7955527 GAGAGGCCCAGCCCCAAGCCAGG - Intergenic
1162495313 19:11020072-11020094 GAGAAGCCAGGGCCCCAGGGAGG - Intronic
1163442250 19:17328122-17328144 GCGAGGCCCCGCCCCCTGCGAGG + Intronic
1163490898 19:17616723-17616745 CAGAGACCCAGCGCCCACGGAGG + Intronic
1163591239 19:18195168-18195190 GAGACTCCCACCCTCCAGGGTGG - Intronic
1163613266 19:18311777-18311799 GAGAGGCCCAGTCCCGGGTGGGG + Intronic
1163633072 19:18426850-18426872 GAGATGCCCATCCACCATGGTGG - Intronic
1164536105 19:29087609-29087631 GACAGGCCCCGCACCCGGGGAGG + Intergenic
1165015239 19:32875686-32875708 GAAAGGCACAGTCCCCAGTGTGG - Intergenic
1165072220 19:33261996-33262018 GAGAGCCCCAACCCTCAGGTGGG - Intergenic
1165327787 19:35124408-35124430 GAGCGGCCCAGGTCCCAGGGAGG - Intergenic
1165901648 19:39172205-39172227 GAGAGGCCCTGGGCGCAGGGGGG + Intronic
1165934496 19:39380928-39380950 AAGAGGCCCAGACCCAAGAGTGG - Intronic
1165991266 19:39816077-39816099 GGGAGGCCAAGAGCCCAGGGAGG + Intergenic
1166872007 19:45876797-45876819 GAGACCCCCAGGCCCGAGGGAGG - Intergenic
1166881701 19:45934103-45934125 AAAAGGCCCAGGCCCCAGGCTGG - Exonic
1166994497 19:46713826-46713848 CCGAGGCCCCGCCCCCAGGCCGG + Intronic
1167411527 19:49347002-49347024 GAGGAGGCCAGCCCCCAGGGTGG - Intronic
1167419314 19:49393991-49394013 GAGAGACCTGGTCCCCAGGGTGG + Intronic
1168354224 19:55691915-55691937 GGGAGGTCCAGCCCCCACGCCGG + Exonic
1168557063 19:57351972-57351994 GAGAGGACCAGCTCCTCGGGCGG - Intronic
925375273 2:3379678-3379700 CCGAGGCCCTGCCCCCAGGCCGG - Exonic
926171132 2:10553184-10553206 GAGAAGCCCAGCCCACAGTGGGG + Intergenic
927187482 2:20492203-20492225 GCCAGGCCCAGCCCCCACAGAGG - Intergenic
928126582 2:28620683-28620705 GGAAGGCCCTGGCCCCAGGGAGG - Intronic
929454771 2:42057973-42057995 GAGGGGCACAGCCCCCAGTGGGG - Exonic
929584041 2:43102216-43102238 GAGAGGCCCAGGTCCCAGGTCGG + Intergenic
929600231 2:43200022-43200044 GGACGGCCCTGCCCCCAGGGAGG - Intergenic
929940006 2:46326422-46326444 GGGAGGCTCATCCCCCAGGCAGG - Intronic
931426190 2:62173894-62173916 CAGAGGCCCAGCCTCTAGGGAGG + Intergenic
932368602 2:71169269-71169291 GAGAGCCCTAGGCCCCAGAGCGG + Intergenic
932410753 2:71546115-71546137 GAGAGGCCCTGGCCCCAGAAAGG - Intronic
932445648 2:71779415-71779437 GAGAGGCCCTGAACCCTGGGTGG + Intergenic
932479834 2:72032559-72032581 GAGAGGCCCAGGCCCCTGGGTGG - Intergenic
932852438 2:75200148-75200170 GAGGGGCCAAGTCACCAGGGTGG - Intergenic
933834242 2:86232547-86232569 GAGAGGCCCAGTCCGCAGTGTGG - Intronic
933993784 2:87652588-87652610 GAGAAACCTAGCCCCCAGTGAGG - Intergenic
936300079 2:111298295-111298317 GAGAAACCTAGCCCCCAGTGAGG + Intergenic
936403491 2:112183424-112183446 GGGAGGCGGAGCACCCAGGGAGG + Intronic
936897396 2:117444193-117444215 GAGAGGCTCAGCCCTCCGAGAGG + Intergenic
937886146 2:126901225-126901247 GAGACTCACAGCCCACAGGGAGG - Exonic
937894958 2:126971597-126971619 GGGAGGGCCAGCCCCGTGGGAGG + Intergenic
937895014 2:126971759-126971781 TGGAGGACCAGCCCCCTGGGAGG + Intergenic
938696498 2:133840114-133840136 GGGAGGCCCAGCCAACAGGGAGG + Intergenic
938731394 2:134150587-134150609 GAGAGGCCCAACCTGCAGAGTGG - Intronic
938949573 2:136244227-136244249 GAGAGGCCCATCCATCACGGGGG + Intergenic
940473233 2:154126511-154126533 GGTAGTCCCAGCCACCAGGGAGG + Intronic
944316933 2:198293967-198293989 GAGATGTCCAGCCCCTTGGGTGG - Intronic
945019169 2:205553890-205553912 GAGAGGCACAGACCCAACGGGGG + Intronic
946056744 2:216909620-216909642 GGGAGGCCCAGCTCCGAGGCCGG - Intergenic
946331280 2:219010484-219010506 GAGAGCCTCAGAGCCCAGGGTGG - Intronic
947743602 2:232496548-232496570 TAGGGGCCCAGCCCCCATGGAGG - Intergenic
948030853 2:234816248-234816270 GGGAGGCACAGCCCCGAGGCAGG + Intergenic
948136657 2:235641571-235641593 GAGAGGCACAGCCGCGTGGGCGG - Intronic
948274044 2:236694790-236694812 GAGGGGCCCAGCCCCCACCCAGG - Intergenic
948578424 2:238968793-238968815 AGCAGGCCCAGCCCCCAGGATGG - Intergenic
948913555 2:241018674-241018696 GAGACGCCCTGCTCCCAGGCTGG + Intronic
948976349 2:241466145-241466167 CAGAGGCCAAGACCCCAGGTTGG + Intronic
948992651 2:241562623-241562645 GAGCTGCCCAGCCACCAGCGTGG + Intronic
1168965429 20:1895329-1895351 GGGAGGCCCAGCCGGGAGGGGGG + Intronic
1169477899 20:5949237-5949259 CAGAGTCCCAGCCACTAGGGAGG + Intronic
1170292424 20:14785473-14785495 GAGAGGGCCAGTCCCCCTGGGGG + Intronic
1171245315 20:23606068-23606090 GAGAGGAACAGCACCCAGGCAGG + Intergenic
1171412503 20:24956675-24956697 CTCAGGCCCAGCCCCCAGGAGGG - Intronic
1172314636 20:33944137-33944159 GCCAGTCCCAGCCCCCAGAGGGG - Intergenic
1172518820 20:35554389-35554411 AAGTGGCCCTGCCCCCATGGAGG + Intronic
1172703223 20:36864880-36864902 GAGACGCCCAGACGCCCGGGAGG - Intergenic
1172778076 20:37419787-37419809 GAGAGGGCAAGACCCCAGGATGG - Intergenic
1173185293 20:40835896-40835918 CAGACTCCCACCCCCCAGGGTGG + Intergenic
1173750110 20:45469875-45469897 GAGAGGCCCGGCGCCTAGAGGGG + Intronic
1173906353 20:46632443-46632465 AAGAAGGCCAGCCCCCAAGGGGG + Intronic
1174483325 20:50845861-50845883 CAGAGGCGCAGCCCCCAGAGAGG + Intronic
1175503018 20:59463685-59463707 GAGTGGCCAAGCTCCCAAGGTGG - Intergenic
1175854563 20:62113579-62113601 AAGAGGCCACACCCCCAGGGGGG + Intergenic
1176038995 20:63054675-63054697 GAGATGCCCAGTGACCAGGGCGG + Intergenic
1176100411 20:63361924-63361946 GAGGGGCCCCGCCCTCAGGTGGG + Intronic
1176138345 20:63534761-63534783 CAGTGACCCAGGCCCCAGGGAGG + Intronic
1176292907 21:5055674-5055696 GAGAGCAGCTGCCCCCAGGGAGG + Intergenic
1176296485 21:5076080-5076102 CAAAGGTCCAGCCCCGAGGGTGG + Intergenic
1179860564 21:44186041-44186063 CAAAGGTCCAGCCCCGAGGGTGG - Intergenic
1179864353 21:44207976-44207998 GAGAGCAGCTGCCCCCAGGGAGG - Intergenic
1180043856 21:45293893-45293915 GAGGGGACCAGCGCCCCGGGGGG + Intergenic
1180069072 21:45427166-45427188 GCTGGGCCCAGCCCCCAGCGTGG - Intronic
1180177783 21:46098604-46098626 GAGAGGCCCTGCGCCCCCGGAGG - Intronic
1180560186 22:16609600-16609622 GTGAGGCCCAGCCCCTCCGGCGG + Intergenic
1181370115 22:22409147-22409169 GAGAGCCCTGGCCACCAGGGAGG + Intergenic
1181390408 22:22576501-22576523 GAGGAGCCCAAGCCCCAGGGAGG - Intergenic
1181720785 22:24772952-24772974 CAGAGACCCAGCACCCAGGGAGG - Intronic
1182558788 22:31143051-31143073 GAGACTCCCAGATCCCAGGGAGG - Intergenic
1183282324 22:36938285-36938307 GAGAGGGCCGGGCCCCAGGCCGG - Exonic
1183394942 22:37566347-37566369 CTGATGCCCGGCCCCCAGGGGGG + Exonic
1183405359 22:37627827-37627849 GTGAGGACCAGCCCCCTGTGTGG - Intronic
1183464143 22:37971024-37971046 AAGTAGCCCAGTCCCCAGGGTGG - Intronic
1183535285 22:38397851-38397873 GAGAGGCCCAGCCCCTCCCGCGG + Intronic
1183761792 22:39826967-39826989 TATAGTCCCAGCCGCCAGGGAGG - Intronic
1183832122 22:40423817-40423839 GAGAAGAGCAACCCCCAGGGTGG + Intronic
1184003754 22:41694086-41694108 GAGAGACCCAGGCTCCAAGGTGG + Exonic
1184298862 22:43543310-43543332 GGGGGACCCAGCCACCAGGGCGG + Intronic
1184598055 22:45526171-45526193 GAGAGGCCCAGCCTCCAAAATGG + Intronic
1184674275 22:46032072-46032094 CAGCGGCCCAGCCCCGGGGGAGG + Intergenic
1184866811 22:47205891-47205913 GAGAGGCCCTGCCACCAGCCTGG - Intergenic
1185108123 22:48885632-48885654 GAGAGGCCCCCACCACAGGGCGG - Intergenic
1185239722 22:49736006-49736028 GGGAGACTCAGCCCCCTGGGAGG + Intergenic
1185411874 22:50686934-50686956 GAGAGGCACAGGCACCAGAGGGG - Intergenic
950178886 3:10897001-10897023 GAGAGGCACATCTCCCATGGTGG + Intronic
952476707 3:33718055-33718077 GAGCCGCCCAGCCTCCAGTGCGG + Intronic
952497063 3:33925165-33925187 GTCAGGCCCAGCACCCAGGAGGG - Intergenic
953927385 3:46989382-46989404 GTGAGACCCAGCCCACAGGAAGG + Intronic
954459944 3:50620626-50620648 AAGAGGCCCAGCTCCCTGGGAGG - Intronic
954624740 3:52016290-52016312 GAGAGGCCCAGCCTCCACCATGG - Intergenic
954990504 3:54836964-54836986 GACAGTCCCAGCCCCCAGCTGGG - Intronic
956466733 3:69527087-69527109 GAGAGACCCATGCCCCAGGACGG - Intronic
959944825 3:112115350-112115372 GAGAGGCCCAGGGCCCTGGGAGG + Intronic
961501461 3:127338572-127338594 GAGAGGCCCAGGCACAAAGGAGG + Intergenic
961681529 3:128603248-128603270 GAGAGACCCTACCTCCAGGGTGG - Intergenic
965339405 3:167468410-167468432 GAGCTGCCCAGCCCCCAGAGAGG - Intronic
965418522 3:168427195-168427217 GAGTGGCCAAGGCCCCAGGCAGG + Intergenic
965621208 3:170644021-170644043 AACAGACCCAGCTCCCAGGGTGG + Intronic
967975462 3:195031958-195031980 GAAATGCCCAGACCCCTGGGGGG - Intergenic
968423409 4:504327-504349 GAGAAGCCCCACACCCAGGGAGG - Intronic
968426374 4:526269-526291 GTGAGGCCCAGGCCCCCGTGTGG + Intronic
968492075 4:895413-895435 CAGAGGACCAGTCACCAGGGTGG + Intronic
968911943 4:3480899-3480921 GAGGGGCACAGACCCCAGGCTGG + Intronic
969705400 4:8788870-8788892 GAGAGGCGGAGCCCACAGAGCGG + Intergenic
978542454 4:109832743-109832765 AAGAGCCCCAGGCCCCAGGAAGG + Intronic
979844381 4:125490097-125490119 GGGAGGCACAGTCCCCAGGAGGG - Exonic
982131067 4:152229098-152229120 CAAAGTCCCAGCCCCAAGGGTGG + Intergenic
984844961 4:184101024-184101046 GGGAGGCTCAGGCCCCAGGGAGG + Intronic
985558625 5:570323-570345 GGGAGGTCCAGCTCCCAGGAAGG - Intergenic
985569297 5:635841-635863 CACAGGGCCAGCCCGCAGGGAGG - Intronic
985569332 5:635999-636021 CACAGGGCCAGCCCTCAGGGAGG - Intronic
985659632 5:1150426-1150448 CAAAGGCCCAGCCCACAGTGAGG + Intergenic
986313943 5:6573658-6573680 GAGAAGCCCACCAGCCAGGGTGG - Intergenic
988222639 5:28368829-28368851 GAGACGACCACGCCCCAGGGGGG + Intergenic
988670182 5:33372791-33372813 GAGAGGCACATCGCCCAGGGAGG - Intergenic
991298272 5:65103387-65103409 GGGAGGAACAGCTCCCAGGGCGG - Intergenic
992287312 5:75248579-75248601 GAGACGCCCTGCCCACAGAGTGG - Intergenic
992879187 5:81088215-81088237 GACATTCCCAGCCCCCAGGCTGG - Intronic
994781278 5:104093913-104093935 AAGATGCTCAGCCCCCAAGGAGG - Intergenic
997308395 5:132857790-132857812 GATAGTCCCAGCTCCCTGGGAGG + Intergenic
997594362 5:135096224-135096246 GAGAGGACCGGCAACCAGGGTGG + Intronic
998780297 5:145648642-145648664 GAGAGCCTCAAACCCCAGGGAGG - Intronic
999274075 5:150317288-150317310 CACAGGCACAGCCCCCAGGGAGG - Intronic
999425538 5:151484970-151484992 GGGAGACCCAGACCCCAGAGAGG + Intronic
1001285367 5:170419219-170419241 CAGAGGCCAAGACCCCAGTGAGG + Intronic
1002171629 5:177377985-177378007 AACAGCCCCAACCCCCAGGGAGG + Intergenic
1002176686 5:177404765-177404787 CAGAAGGCCAGCCCCCAGGTGGG - Intronic
1006380913 6:33696651-33696673 GAGAGGCCAGGCCAGCAGGGAGG - Intronic
1006833421 6:36982768-36982790 GAGAGCCCCTGCTGCCAGGGAGG + Intronic
1006844372 6:37052140-37052162 CAGAGGCCCCGCCTCCAGAGTGG + Intergenic
1006920588 6:37624933-37624955 GACAGAGCTAGCCCCCAGGGAGG - Intergenic
1011635819 6:89372161-89372183 GAGATGCCAAGGCCCCTGGGAGG + Intronic
1012583177 6:100892883-100892905 CAGAGCCCAAGCCCCCAAGGCGG - Intergenic
1015773694 6:136792887-136792909 GTCAGGGCCAGCCCCCAAGGAGG + Intergenic
1017716990 6:157219451-157219473 GAGAGGCCAGGCCGGCAGGGAGG - Intergenic
1018980985 6:168601622-168601644 GGCAGCCCCAGCCCCCAGTGAGG + Intronic
1019033046 6:169030082-169030104 GAGAGGACCAGCCCCCTCCGAGG - Intergenic
1019321216 7:416162-416184 GTGAGGCCCAGCCCCGTGGTGGG - Intergenic
1019446080 7:1072038-1072060 GAGGGGCCCAGCGCTCAGGATGG + Intronic
1020002825 7:4765408-4765430 GAGAGCCTCAGCCCCCAGCCTGG + Exonic
1021935398 7:25625745-25625767 GAAAGGCCCACTCTCCAGGGTGG + Intergenic
1023021713 7:36017284-36017306 GATAGTCCCAGCCCTCAGGGAGG - Intergenic
1023054159 7:36278447-36278469 GAGAGGCCCAGCCCTGGGGGTGG - Intronic
1026931307 7:74224370-74224392 CAGCCGCCCAGCCTCCAGGGTGG + Intronic
1027129284 7:75579771-75579793 GAGAGTCCAAGCCCCAAGAGTGG + Intronic
1027219078 7:76202463-76202485 CAGAGGCCCAGCATCCAGGTGGG - Intronic
1029424935 7:100489246-100489268 GGGAAGACCAGCCCCCACGGTGG + Exonic
1029482820 7:100823432-100823454 GCCTGGCCCGGCCCCCAGGGAGG - Intronic
1031688870 7:124764754-124764776 GCGAGCCCGAGCACCCAGGGAGG - Exonic
1033145999 7:138870515-138870537 GAGACCCCCTGCCCCCAGAGTGG + Intronic
1033658959 7:143390861-143390883 GCGAGGACCAGACCCCAGGGCGG - Exonic
1034089213 7:148348532-148348554 GAGAGGCCAGGCCCTCACGGAGG + Intronic
1034191836 7:149219110-149219132 TTGAGGCCCAACCTCCAGGGAGG - Intronic
1034735304 7:153423790-153423812 GAGATCCCAAGCCCCAAGGGAGG - Intergenic
1035037149 7:155902797-155902819 GGGAGGCCTGGCCCACAGGGAGG + Intergenic
1035179387 7:157078211-157078233 GAGAGGCCCAGCCCACGCTGAGG + Intergenic
1036710440 8:11075047-11075069 TAGTGCCCCAGCCTCCAGGGAGG - Intronic
1037923875 8:22829595-22829617 GAGTGGCTCAGGCCCCAGGAAGG + Intronic
1039942682 8:42104582-42104604 AAGAGTCCCAGACACCAGGGAGG + Intergenic
1040061111 8:43103575-43103597 GAGAGGCCTCGCCCCCCGAGAGG + Exonic
1040550702 8:48435019-48435041 GAGGGGTCCAGGGCCCAGGGTGG + Intergenic
1041693628 8:60714175-60714197 GGGATGCCCCGCCCCCCGGGGGG - Intronic
1045242604 8:100415739-100415761 GAGGGGCTCAGCCCCTTGGGAGG - Intergenic
1048214840 8:132484669-132484691 GAGATGCTCAGCCCCCAGTGGGG + Intergenic
1048277073 8:133074700-133074722 GAGAAGCCCAGCCCCCAACCTGG - Intronic
1048316912 8:133369548-133369570 GAGAGATGCAGCCCGCAGGGAGG + Intergenic
1048518217 8:135129986-135130008 TTGAAGCCCAGCCCCCAGTGTGG - Intergenic
1049206560 8:141366351-141366373 GACAGGCCCAGCCTCCTGCGGGG + Intronic
1049352880 8:142173439-142173461 CGGAGGCCCAGCCTCCAGGTTGG - Intergenic
1049656984 8:143803350-143803372 GGGAGGCCCGGTCCCCGGGGCGG + Intronic
1049678532 8:143904577-143904599 GGGAGGGGCAGCCCCCAGGCAGG - Intergenic
1049884029 9:16011-16033 GAGTGGCCCAGCCACCGGAGGGG + Intergenic
1051244556 9:15096742-15096764 GGGAGGCCCAGTTCCCAGGTAGG - Intergenic
1051410663 9:16786691-16786713 GAGAGGCCCTGCCCCAAATGTGG + Intronic
1056752278 9:89361150-89361172 GAGAGGCCCAGCTGCCTGTGAGG - Intronic
1057141659 9:92730048-92730070 GAGTGGCCCAGCCTCCAAGCAGG + Intronic
1059443501 9:114324089-114324111 GTGAGGGCCAGCCCTCAGGCAGG + Intronic
1059444691 9:114330863-114330885 GTGAGGGCCAGCCCTCAGGCAGG + Intronic
1060135933 9:121153759-121153781 GACTGGCCCAGACCCCAGGGTGG + Intronic
1060215771 9:121737525-121737547 CAGAGGCCCATTCCCAAGGGTGG - Intronic
1060219109 9:121755068-121755090 GAGCCGCCCACCTCCCAGGGTGG - Intronic
1060220144 9:121760209-121760231 GTGACGCCCAACCCCAAGGGCGG + Exonic
1060282325 9:122222834-122222856 GAGTGGCCAAGGCCCCATGGAGG - Intronic
1061009489 9:127946572-127946594 AAGAGGCCCCTCCCCCAGGCAGG - Intronic
1061076330 9:128343636-128343658 GAAAGGCCCTGCCCTCAGGTTGG + Intronic
1061272360 9:129550498-129550520 GAGAGGCTCAGCCCCGCGGAGGG - Intergenic
1061420999 9:130472782-130472804 GGGAGGCCGAGCCTGCAGGGTGG + Intronic
1061684605 9:132264807-132264829 GAGGGGTCCAGACCCCAGGGTGG - Exonic
1061820608 9:133225520-133225542 GAGAGGCGCTTCCTCCAGGGCGG - Intergenic
1061999921 9:134210774-134210796 AAGGGCCACAGCCCCCAGGGTGG + Intergenic
1062023914 9:134331824-134331846 GGGAGGACCTGTCCCCAGGGTGG + Intronic
1062152698 9:135030106-135030128 GAGAGGCCCAACCCGCAGGGTGG - Intergenic
1062189280 9:135239446-135239468 GGGGGGCTCAGCTCCCAGGGTGG - Intergenic
1062238657 9:135524538-135524560 GAGAGGCGCTTCCTCCAGGGTGG + Intronic
1062521048 9:136958093-136958115 GCGTGGCCCAGGCCCCAGGCTGG - Intergenic
1062523578 9:136969523-136969545 GAGACCACCAGCTCCCAGGGAGG - Intronic
1062532168 9:137006799-137006821 CACAGGCCAAGGCCCCAGGGAGG - Intergenic
1062532291 9:137007277-137007299 TACAGGCCCGGCTCCCAGGGAGG + Exonic
1062736889 9:138142244-138142266 GCTTGGCCCAGACCCCAGGGAGG - Intergenic
1185463196 X:341653-341675 GGGTGGCCCAGGCCCCAGGTCGG - Intronic
1186350243 X:8732369-8732391 GAGGGGCCCAGCTCCCACGCAGG + Intergenic
1189061091 X:37754427-37754449 GAGAGGCCCACACCTCAGTGGGG - Intronic
1191257014 X:58283932-58283954 GAGAGGCCCACACCCCGGGTGGG + Intergenic
1192522522 X:71814879-71814901 GAGAGTCTCTGCCCCCAGGCAGG - Intergenic
1194751219 X:97686245-97686267 TTGAGGCCCAGCCTACAGGGTGG - Intergenic
1194923416 X:99795578-99795600 TAGAGTCACAGCCCCCAGGGAGG - Intergenic
1196820372 X:119695733-119695755 TGGAGGCCCAGGCCCCAGGAGGG - Intergenic
1199798683 X:151227959-151227981 GAGAGGCGCTGCCGCCACGGCGG - Intergenic
1200137912 X:153883793-153883815 GAGTGGCCCAGGCTCCAGGAGGG - Intronic
1200143332 X:153912995-153913017 CAGGGCCCCAGCCCTCAGGGAGG + Intronic
1200333253 X:155320013-155320035 GAGATGCCCTGCCCAGAGGGAGG - Intronic
1200399099 X:156008295-156008317 GCTTGGCCCAGACCCCAGGGAGG - Intronic
1200401781 X:156024148-156024170 GAGTGGCCCAGCCACCGGAGGGG - Intergenic
1201147087 Y:11070880-11070902 GTGAGGCCCAGCACGCCGGGAGG + Intergenic