ID: 1138578163

View in Genome Browser
Species Human (GRCh38)
Location 16:57922084-57922106
Sequence GTGGGCAACTGGACTGAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 327
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 304}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138578155_1138578163 14 Left 1138578155 16:57922047-57922069 CCCTATCTCATAAAATGTGAGTC 0: 1
1: 0
2: 0
3: 12
4: 150
Right 1138578163 16:57922084-57922106 GTGGGCAACTGGACTGAGGGTGG 0: 1
1: 0
2: 3
3: 19
4: 304
1138578154_1138578163 18 Left 1138578154 16:57922043-57922065 CCTACCCTATCTCATAAAATGTG 0: 1
1: 0
2: 1
3: 8
4: 145
Right 1138578163 16:57922084-57922106 GTGGGCAACTGGACTGAGGGTGG 0: 1
1: 0
2: 3
3: 19
4: 304
1138578153_1138578163 19 Left 1138578153 16:57922042-57922064 CCCTACCCTATCTCATAAAATGT 0: 1
1: 0
2: 1
3: 11
4: 202
Right 1138578163 16:57922084-57922106 GTGGGCAACTGGACTGAGGGTGG 0: 1
1: 0
2: 3
3: 19
4: 304
1138578159_1138578163 -8 Left 1138578159 16:57922069-57922091 CCACTGCGTGCTGCAGTGGGCAA 0: 1
1: 0
2: 1
3: 17
4: 102
Right 1138578163 16:57922084-57922106 GTGGGCAACTGGACTGAGGGTGG 0: 1
1: 0
2: 3
3: 19
4: 304
1138578151_1138578163 24 Left 1138578151 16:57922037-57922059 CCTACCCCTACCCTATCTCATAA 0: 1
1: 0
2: 1
3: 23
4: 262
Right 1138578163 16:57922084-57922106 GTGGGCAACTGGACTGAGGGTGG 0: 1
1: 0
2: 3
3: 19
4: 304
1138578152_1138578163 20 Left 1138578152 16:57922041-57922063 CCCCTACCCTATCTCATAAAATG 0: 1
1: 0
2: 0
3: 11
4: 187
Right 1138578163 16:57922084-57922106 GTGGGCAACTGGACTGAGGGTGG 0: 1
1: 0
2: 3
3: 19
4: 304
1138578156_1138578163 13 Left 1138578156 16:57922048-57922070 CCTATCTCATAAAATGTGAGTCC 0: 1
1: 0
2: 2
3: 14
4: 147
Right 1138578163 16:57922084-57922106 GTGGGCAACTGGACTGAGGGTGG 0: 1
1: 0
2: 3
3: 19
4: 304
1138578150_1138578163 25 Left 1138578150 16:57922036-57922058 CCCTACCCCTACCCTATCTCATA 0: 1
1: 0
2: 2
3: 19
4: 259
Right 1138578163 16:57922084-57922106 GTGGGCAACTGGACTGAGGGTGG 0: 1
1: 0
2: 3
3: 19
4: 304

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138578163 Original CRISPR GTGGGCAACTGGACTGAGGG TGG Intronic
900167074 1:1248101-1248123 CTGGGAGGCTGGACTGAGGGAGG + Intergenic
900536314 1:3179427-3179449 GTGGGCAGCTCCCCTGAGGGAGG + Intronic
900552060 1:3261772-3261794 GTGGGGACCAGGACGGAGGGCGG - Intronic
900851949 1:5150712-5150734 GTGGGCAACAGAAATGAAGGAGG - Intergenic
901860836 1:12073309-12073331 CTGAGCAACTGGCCTGAGGCTGG + Intronic
902109324 1:14064881-14064903 GGGGGCAACTGGACCTTGGGTGG - Intergenic
902373507 1:16019308-16019330 GGGGGCATCTGGACTGGGTGTGG - Intronic
902632704 1:17714940-17714962 TTGAGCAACTGGACAGAGAGTGG + Intergenic
902728039 1:18350274-18350296 GTGGGGAGCAGGAGTGAGGGTGG + Intronic
903485119 1:23684107-23684129 CTGGGAAACTGGGCTGATGGAGG - Intergenic
904012160 1:27395916-27395938 CTGGGGAGCTGGACAGAGGGTGG + Intergenic
904113858 1:28147659-28147681 GTGGGCATCTAGATTTAGGGAGG - Exonic
904751215 1:32742198-32742220 GTCGGCACCTGGGCTGAGCGCGG + Intronic
904935324 1:34126083-34126105 GTGGGCAACTGGAGTGGGTCTGG - Intronic
905471131 1:38192825-38192847 GTGGTCAGCTGGGCTGAGGTGGG - Intergenic
907934083 1:59026526-59026548 GTGGGCAACTCAGCTGCGGGTGG - Intergenic
908823176 1:68108542-68108564 GTGGGTGATTGGACTGAGGTGGG + Intronic
911628202 1:100151239-100151261 GAGGGCAACTGGATAGATGGTGG - Intronic
912249242 1:107993656-107993678 GTTGGCAACCGGAATGAGAGGGG - Intergenic
913528672 1:119716823-119716845 GAGGGCAACTGGGCAGTGGGTGG - Intronic
913550843 1:119915734-119915756 GAGGGCAGGTGGACTGAGGCTGG + Exonic
915913850 1:159929868-159929890 GTGAGCACCTGGCGTGAGGGAGG - Intronic
916635285 1:166661725-166661747 GTGGCCAACCACACTGAGGGTGG - Intergenic
916688545 1:167169815-167169837 GTGAGTCAGTGGACTGAGGGAGG - Intergenic
918094954 1:181326832-181326854 TCGGGCAACAGGACGGAGGGCGG - Intergenic
919975163 1:202605672-202605694 GTGGACAACTCCACTGAGAGTGG - Exonic
920131085 1:203732311-203732333 CTCGGCAATTAGACTGAGGGAGG - Intronic
920181996 1:204137794-204137816 CTGGGGAACTGGACTGGGGTGGG - Intronic
920308166 1:205032132-205032154 GTGGGCAATGGGAGTGATGGAGG - Intergenic
920872393 1:209805520-209805542 TTGGGAAACTGGAGTGAGGGTGG - Intronic
920874671 1:209822953-209822975 GTGGGGAACTGCACAGAGGATGG - Intergenic
920973800 1:210766498-210766520 CTGGGCAACAAGATTGAGGGGGG + Intronic
924153347 1:241151097-241151119 GTGCGCCAGTGGACTGAGTGGGG - Intronic
924940601 1:248810623-248810645 GTGGGCAACTGGACTCTGCACGG - Exonic
1063425678 10:5948405-5948427 GTGGGCACCTGGCCTGGGCGTGG - Intronic
1064246589 10:13672713-13672735 GGGGGCAACTAGAATGATGGAGG - Intronic
1064696281 10:17968932-17968954 GTTGGGAAATGTACTGAGGGAGG - Intronic
1064795833 10:19010121-19010143 TTGGGAAATTTGACTGAGGGTGG - Intergenic
1065813165 10:29461003-29461025 GTGGGAAACAGGAATTAGGGAGG - Intronic
1067567441 10:47349247-47349269 GTGGGCGAGCGGACTGGGGGAGG + Exonic
1069853033 10:71422889-71422911 CTGGGCAACTTCACTGGGGGAGG + Intronic
1076659366 10:132045112-132045134 GTGGGAACCTGAACTGAGGCAGG - Intergenic
1076664617 10:132079130-132079152 GTGGGCACCTGGCCTGGGAGCGG + Intergenic
1076907659 10:133371506-133371528 CTGGCCAACTGGACGCAGGGTGG + Intronic
1076926575 10:133493179-133493201 GTGGGCATCTAGAATGTGGGAGG + Intergenic
1077141403 11:1026471-1026493 GTGGGCACCTGGAGGGAGGCAGG + Exonic
1077424242 11:2466985-2467007 GTGGGCAGCTGGGCTGCAGGGGG + Intronic
1078563172 11:12390663-12390685 GTGGGAGAATGGAGTGAGGGAGG - Intronic
1078733723 11:14000641-14000663 GGGGGAAAATGGGCTGAGGGTGG - Intronic
1079355257 11:19725315-19725337 GTGGGCGGCAGCACTGAGGGAGG - Intronic
1080063412 11:27981573-27981595 GTGCCCCACTGGGCTGAGGGAGG - Intergenic
1080408001 11:31997057-31997079 GTGCCCACCCGGACTGAGGGTGG + Intronic
1081690578 11:45075100-45075122 TTGGGCACCTGGGCTCAGGGGGG + Intergenic
1083776747 11:64897816-64897838 GTAGGCTGCTGGACTGCGGGTGG - Intronic
1084021867 11:66422571-66422593 GTGGGAAATTGGACCGAGGAAGG - Intronic
1084342466 11:68515167-68515189 GTGGGCAGCTGGAGCCAGGGGGG + Intronic
1084356756 11:68644025-68644047 GTGGGCAGCTGGAGCCAGGGGGG + Intergenic
1084598067 11:70128962-70128984 GTGACCACCTGGACTGAGGATGG - Intronic
1086701108 11:89901129-89901151 GTGGGTAACTGGGTTGGGGGTGG + Intergenic
1086705059 11:89943398-89943420 GTGGGTAACTGGGTTGGGGGTGG - Intergenic
1087572358 11:99944939-99944961 GTGTGCAACTGGGCAGAGGAAGG + Intronic
1087688311 11:101290346-101290368 GTGAGTAGCTGGACTGAGTGAGG + Intergenic
1088757270 11:112895938-112895960 GTGGACATCTGGGCTGATGGGGG - Intergenic
1088999363 11:115038198-115038220 CTGGGCAACTGGAAAGAGGAAGG - Intergenic
1089561328 11:119344764-119344786 GTGGGCACCAGGAGTCAGGGAGG + Intronic
1089635198 11:119807518-119807540 CTGGGCACCTGGGCTGGGGGAGG + Intergenic
1089909083 11:122077640-122077662 GTGGCCAGCTGGACTTAGGCTGG - Intergenic
1091455913 12:607782-607804 GTGGCCCACAGGACTGGGGGTGG + Intronic
1092998829 12:13976910-13976932 GTGGGCAAATGGACTGAAATTGG - Intronic
1093465082 12:19440258-19440280 GAGGGCTACGGGACTGGGGGAGG + Exonic
1097107331 12:56633462-56633484 GGGCGCAGCTGGACTGGGGGTGG + Intronic
1097367611 12:58735122-58735144 ATGGGCAACTGACCTGAGGCAGG - Intronic
1097581576 12:61463861-61463883 GTGCCCATCTGGATTGAGGGTGG + Intergenic
1097635406 12:62115649-62115671 GTGGGAAGCAGGACTGTGGGAGG - Intronic
1098682676 12:73377790-73377812 GTGGACAACTGGATTGATAGTGG - Intergenic
1101213704 12:102560344-102560366 GTGCCTACCTGGACTGAGGGTGG - Intergenic
1101353739 12:103957157-103957179 CTGGGCAACAGGTCTAAGGGCGG + Exonic
1101676581 12:106922422-106922444 GTGGGGGGCTGGAGTGAGGGAGG - Intergenic
1103198637 12:119068493-119068515 CTGGGCAGCTGCAGTGAGGGTGG + Intronic
1103858503 12:123992215-123992237 GTAGGAAAGTGGTCTGAGGGTGG + Intronic
1104681021 12:130751992-130752014 GTGACCAGCTGAACTGAGGGTGG - Intergenic
1105402117 13:20105150-20105172 GTGAGCAGCTGGACTGAGGACGG - Intergenic
1105633946 13:22199308-22199330 GAGAGGAACTGGCCTGAGGGCGG - Intergenic
1106138491 13:26991903-26991925 TTGGTCAACTGGACAGAGGTTGG - Intergenic
1106305288 13:28504174-28504196 ATGAGCAACTGGACTGGGGCAGG - Intergenic
1108199136 13:48025492-48025514 GTGCCCACCTGCACTGAGGGTGG - Intergenic
1109171055 13:59097462-59097484 GTGCCCACCTAGACTGAGGGTGG - Intergenic
1110190457 13:72724424-72724446 ATGTGCAACTGGATTGATGGTGG + Intronic
1113608542 13:111627227-111627249 GTGGGCACCAGGCCTGGGGGTGG + Intronic
1115120445 14:29930511-29930533 CTGAGCAATTGGACTGATGGTGG + Intronic
1119252854 14:73171719-73171741 GCAGGTAACTGGAATGAGGGTGG + Intronic
1121422214 14:93824052-93824074 GTGGGAAAATGGGCTCAGGGAGG + Intergenic
1121884246 14:97528506-97528528 GGGGGCAACTAGGCTGAGGCAGG + Intergenic
1122029969 14:98905089-98905111 GTGGGCAACTGGGCCAAGGAAGG + Intergenic
1122055354 14:99094371-99094393 TTGGACAGCTGGACAGAGGGTGG - Intergenic
1122206955 14:100152431-100152453 GAGGGTAAGTGGACTGAGTGAGG + Intronic
1122904790 14:104796634-104796656 GTGGGCCTCTGGAATGGGGGAGG - Intergenic
1123129235 14:105972304-105972326 GGGGGCACCTGGACTCCGGGAGG + Intergenic
1124136172 15:27038107-27038129 GTGGCCAACCGGACTGAGATGGG - Intronic
1124203397 15:27697662-27697684 GTGGGGAAGTGGAGTGGGGGAGG - Intergenic
1124513573 15:30347953-30347975 GTGGGCAGGAGGAGTGAGGGTGG - Intergenic
1124729348 15:32182812-32182834 GTGGGCAGGAGGAGTGAGGGTGG + Intergenic
1125601465 15:40917974-40917996 GGGGGCAAATAGATTGAGGGGGG + Intergenic
1125928417 15:43582541-43582563 GTGAGTACCTGGCCTGAGGGAGG - Intronic
1125941583 15:43682376-43682398 GTGAGTACCTGGCCTGAGGGAGG - Intergenic
1125943847 15:43697701-43697723 GTGGTAAACTGAACTGAGAGAGG - Intronic
1126679351 15:51188494-51188516 GTGTGCAAGTGTACTTAGGGTGG - Intergenic
1127923595 15:63515850-63515872 GTGGACAGCAGGACTGAGAGTGG - Intronic
1128199981 15:65796561-65796583 TTGGGGAACGGGGCTGAGGGTGG + Intronic
1128326242 15:66725952-66725974 GTGGGCAGGAGGACTGAGGAAGG - Intronic
1128925454 15:71651209-71651231 ATGGCCAACTGGACTGAAGATGG - Intronic
1129440841 15:75579567-75579589 GAAGGCAACTCGACTGCGGGAGG + Intergenic
1129967641 15:79751151-79751173 GTGGTCAGCTGGAATGTGGGAGG - Intergenic
1131798340 15:96043762-96043784 GTGGGCATCTCCACCGAGGGAGG + Intergenic
1135166208 16:20141350-20141372 GGAGCCAACTGGACTTAGGGTGG + Intergenic
1135945415 16:26860625-26860647 GTGGTCAACAGGAATGAGGGAGG + Intergenic
1136074433 16:27807178-27807200 GTTAGCCACTGGTCTGAGGGAGG - Intronic
1136525641 16:30828243-30828265 GTGGATAACTGTACTGTGGGAGG + Intergenic
1137997741 16:53237284-53237306 GTGGGCACCTGGTCTAAGAGAGG - Intronic
1138578163 16:57922084-57922106 GTGGGCAACTGGACTGAGGGTGG + Intronic
1140248031 16:73268877-73268899 GTGGGCAACTGCAGACAGGGTGG + Intergenic
1141455114 16:84136159-84136181 GTGGGCACCTGAACTAAGGTGGG - Intronic
1142526547 17:545981-546003 GTGTGGTACTGGCCTGAGGGTGG + Intronic
1142805599 17:2369682-2369704 GAGGGCAACAGGGGTGAGGGCGG - Intronic
1143046367 17:4083359-4083381 CTGAGCCACTGGACTGTGGGTGG - Intronic
1143862074 17:9898360-9898382 GTGGGTATCTGGACTGGGGTGGG - Intronic
1145816190 17:27796733-27796755 GTGGGGAGCTGGAGTCAGGGAGG + Intronic
1145863640 17:28226975-28226997 GTGGGAAACTGGATTGGAGGGGG + Intergenic
1149065653 17:52476555-52476577 GTGAGAAACTGGACAAAGGGTGG + Intergenic
1149666393 17:58367691-58367713 CTGGGTGACTGGACAGAGGGTGG + Intronic
1150656836 17:67044899-67044921 GTGGGGATCGGGACGGAGGGTGG - Intronic
1150705979 17:67487750-67487772 GGGGGCCACTGGTCTGAGGGTGG + Intronic
1151535555 17:74737138-74737160 GGGGGCGACGGGACGGAGGGAGG + Intronic
1152492453 17:80646431-80646453 GTGGGTTACAGGACAGAGGGAGG + Intronic
1152609372 17:81308130-81308152 GTGAGGACCTGGGCTGAGGGTGG - Intergenic
1152716037 17:81901308-81901330 GTGCCCACCTGGATTGAGGGTGG + Intronic
1153047653 18:871425-871447 CTGGGAAACTGAACAGAGGGAGG - Intergenic
1153567013 18:6428901-6428923 GGGAGCACCTGGAGTGAGGGAGG - Intergenic
1154376716 18:13816951-13816973 GTGGGTCCCTGGACTGAGTGTGG + Intergenic
1155017872 18:21863467-21863489 GAGGGGAACTGGAGTGGGGGTGG + Intronic
1157725790 18:49962741-49962763 GGGGGCAACTGTGCTGAGAGGGG - Intronic
1159308078 18:66672017-66672039 GCGGGCAGGTGGACTGAGTGGGG + Intergenic
1160484327 18:79274985-79275007 GTTGGCCACTGGGCTCAGGGTGG - Intronic
1161724300 19:5919395-5919417 GTGGGCACCTGGGCTCAGGGAGG - Intronic
1162730403 19:12715220-12715242 GTGGGCCGCTGGGCTGGGGGTGG - Intronic
1163195548 19:15717219-15717241 GTGCCCACCTGGATTGAGGGTGG + Intergenic
1163257321 19:16164679-16164701 ATGTGCAAATGGACTGTGGGCGG + Intronic
1164547960 19:29184739-29184761 GTGCCCACCTGGATTGAGGGTGG - Intergenic
1164920866 19:32087677-32087699 GAGGTCAGCTGGACTGGGGGTGG - Intergenic
1165896559 19:39145174-39145196 CTGGGCAGCGGGCCTGAGGGTGG - Intronic
1167856584 19:52246937-52246959 GTGGGCATCTGAAGTGAGTGTGG - Intergenic
1168126805 19:54288495-54288517 GTGGGAAACATGACTGTGGGGGG + Intergenic
1168277492 19:55285597-55285619 GTGGGAAACAGGATGGAGGGTGG + Intronic
925097694 2:1220389-1220411 GCGGGCTGCTGGCCTGAGGGAGG - Intronic
925285813 2:2715182-2715204 GTGGGCATCTGTGGTGAGGGAGG - Intergenic
925471604 2:4168368-4168390 GTGCCCACCTGGATTGAGGGTGG - Intergenic
926121229 2:10242220-10242242 GGGGGCATCTGGATTTAGGGTGG - Intergenic
927438395 2:23090152-23090174 GTGCCCAACCAGACTGAGGGTGG - Intergenic
927713707 2:25340544-25340566 GAGGGGAACTGGGGTGAGGGCGG + Intronic
928184903 2:29101559-29101581 GTGCCCACCTGGATTGAGGGTGG + Intronic
928214156 2:29347336-29347358 GTGGGCTACTGGGCTGATGGAGG + Intronic
929509898 2:42558476-42558498 GTGGGCAGATGGCCTGAGGTCGG - Intronic
932177093 2:69613061-69613083 GTGGGCCATTGGACTGAGGGAGG - Intronic
934713446 2:96529940-96529962 GTGGGCAGCTGGGGTGAGGGAGG + Intergenic
935637531 2:105261238-105261260 GTGGGCAACCAGACAGAGGCAGG + Intergenic
935790279 2:106584431-106584453 GCGGGAACCGGGACTGAGGGCGG + Intergenic
937076846 2:119113334-119113356 GTCCTCAAATGGACTGAGGGCGG - Intergenic
939410333 2:141816303-141816325 GTGCCCACCTAGACTGAGGGTGG - Intronic
942128111 2:172847550-172847572 GTGGGACACTGGGCTGAAGGTGG + Intronic
942290402 2:174463934-174463956 GTGTACAAATGGATTGAGGGAGG - Intronic
943566939 2:189527053-189527075 GAGGGTGACTGGACTGAGAGGGG - Intergenic
947837786 2:233188020-233188042 GGGGGCAGGGGGACTGAGGGAGG - Intronic
948183339 2:236000474-236000496 GTGGGGGACTGGACTGGAGGAGG - Intronic
948594966 2:239073949-239073971 ATGGGCAGCAGGACTGAGGGGGG + Intronic
948594978 2:239073984-239074006 GGGGGCCGCAGGACTGAGGGGGG + Intronic
948594989 2:239074020-239074042 GGGAGCAGCAGGACTGAGGGGGG + Intronic
948594993 2:239074038-239074060 GGGGGCAGCAGGACTGAGTGGGG + Intronic
948595004 2:239074073-239074095 GGGGGCCACAGGACTGAGGGGGG + Intronic
1168821258 20:775128-775150 GAGGGGAACTGGCCTGGGGGAGG - Intergenic
1170441862 20:16387210-16387232 GTGGGCAAGAGAACTGATGGAGG + Intronic
1170570217 20:17628375-17628397 GAGGGCAACTTGACAGATGGCGG - Intronic
1172061170 20:32188385-32188407 GCGGGCAACAGGGCTGATGGTGG + Intergenic
1172778116 20:37419950-37419972 CTGGGCGAGTGGGCTGAGGGTGG - Intergenic
1173400774 20:42723874-42723896 GTAGGCAACTGGACTGGAGTGGG + Intronic
1174023394 20:47550214-47550236 GTGGGCAAATGACCTGAGGTTGG + Intronic
1174403443 20:50288722-50288744 TGGGGCAAGTGGACTGTGGGGGG + Intergenic
1176235553 20:64051929-64051951 GTGGCCAGCTGTGCTGAGGGAGG + Intronic
1176719006 21:10378460-10378482 GTGGGGAGCTGGAGTCAGGGAGG - Intergenic
1178365700 21:31987266-31987288 ATGGTCACCTGCACTGAGGGTGG + Intronic
1179468920 21:41597650-41597672 CTGGGCAACTGGCCTGGGAGTGG + Intergenic
1179468929 21:41597686-41597708 GTGGGCAACTAGCCTGGGAGTGG + Intergenic
1180167310 21:46036771-46036793 GTGAGCAGCTGGAGCGAGGGGGG + Intergenic
1180300238 22:11031442-11031464 GTGGGGAGCTGGAGTCAGGGAGG - Intergenic
1181316381 22:21973368-21973390 GTGGGAAGATGGACTGAGGCTGG - Intronic
1182534490 22:30990507-30990529 GTGAGCAAGTAGACTCAGGGCGG - Intergenic
1182566838 22:31206457-31206479 TGGGGCCACTGCACTGAGGGGGG - Exonic
1182737005 22:32537923-32537945 GTGAGGCACTGGACGGAGGGCGG + Intronic
1183652828 22:39168748-39168770 GAGGGAAACAGGACTGAGGTGGG + Intergenic
1184253772 22:43275804-43275826 GAGAGGAACTGGACTGTGGGAGG + Intronic
950101565 3:10360068-10360090 GTGGGCAACAAGACGGAGTGCGG - Exonic
950443917 3:13025290-13025312 GTGAGTCACTGGACTGAGGTTGG - Intronic
952893284 3:38058927-38058949 TTTGGCAAGTGGACTGAGGTTGG - Intronic
953790744 3:45946019-45946041 GTGGGCAACTGTGGTGAGGCAGG + Exonic
954289881 3:49644032-49644054 GTGGGCCACAGGACTGAGGGAGG - Intronic
955887069 3:63611828-63611850 GTGGGCATCTGGCCTAAGGTGGG - Intronic
956302741 3:67790284-67790306 CTTGGCAACTGGAGTGAGAGTGG - Intergenic
956561401 3:70580175-70580197 GCCCGCAACTGTACTGAGGGAGG - Intergenic
956888782 3:73588531-73588553 GTGGGAAACAGGACTGAGGAGGG - Intronic
958877541 3:99633227-99633249 GTGCCCACCTGCACTGAGGGTGG - Intergenic
963314416 3:143743653-143743675 GTGAGTTACTGGACTGAGTGGGG - Intronic
963343142 3:144061962-144061984 CTGGGCAACTGGATAGATGGTGG - Intergenic
963940595 3:151092624-151092646 CTGGGGAAGTGGAGTGAGGGAGG + Intronic
964001976 3:151785874-151785896 ATGGGCACCTGGTTTGAGGGAGG - Intergenic
966425846 3:179778846-179778868 GGGAGCAACAGGAGTGAGGGCGG + Intronic
966994675 3:185267981-185268003 GTGGGCAACTGGACTTATATTGG + Intronic
969425723 4:7122693-7122715 GTGGGTCACTGGAGAGAGGGAGG + Intergenic
969425743 4:7122762-7122784 GTGGGTCACTGGAGAGAGGGAGG + Intergenic
969425763 4:7122831-7122853 GTGGGTCACTGGAGAGAGGGAGG + Intergenic
969425782 4:7122900-7122922 GTGGGTCACTGGAGAGAGGGAGG + Intergenic
971565374 4:28132815-28132837 GTGCCTAACTGGATTGAGGGTGG - Intergenic
972925634 4:44003003-44003025 GTGGGAAGGTGGACTGGGGGTGG - Intergenic
973154201 4:46928670-46928692 GTTGGCAACAGAACTGAGGTGGG - Exonic
974989356 4:69065236-69065258 GTGGGTACCTAGACTGAGGGTGG - Intronic
975324052 4:73040237-73040259 GTGGGCAAATCGCCTGAGGTCGG - Intergenic
975409750 4:74036890-74036912 GTGGGGAACTGGAGGGTGGGGGG - Exonic
975796438 4:78011427-78011449 GTTGGCAACTGGAATAAAGGTGG + Intergenic
977687106 4:99859733-99859755 GTGGACATCTGTAGTGAGGGTGG - Intronic
979558321 4:122075943-122075965 TGGGGCCACTGCACTGAGGGGGG + Intergenic
982090467 4:151876017-151876039 GTGGGGGAGTGGAGTGAGGGGGG - Intergenic
982797044 4:159658944-159658966 GTGGGTCAGTGAACTGAGGGAGG + Intergenic
982965861 4:161906618-161906640 GGGGGAAACTGAAGTGAGGGAGG + Intronic
983377222 4:166945631-166945653 GTGGTCAATTGGAGTGAGGAGGG - Intronic
983459061 4:168004306-168004328 GTGCCCACCTGGATTGAGGGTGG + Intergenic
984451994 4:179914194-179914216 GTGCCCACCTGGACTGAGGATGG - Intergenic
985163289 4:187065976-187065998 CTGGGCATCTGGACGGAGGGAGG + Intergenic
985293776 4:188412875-188412897 GACTGCAACTAGACTGAGGGCGG - Intergenic
985635890 5:1035780-1035802 GGGGGCAACAGGGCTGGGGGTGG + Intronic
987158389 5:15114585-15114607 GTGCCCACCTAGACTGAGGGTGG + Intergenic
987907401 5:24094488-24094510 GTGCCCACCTGGATTGAGGGCGG + Intronic
989004130 5:36790962-36790984 GGGAGCAGCTGGACTGAGGCAGG + Intergenic
989712599 5:44418028-44418050 GTGGGCAAATGGTCTGGGGTGGG - Intergenic
990191653 5:53266567-53266589 GTGGGAAAATGGAGTGGGGGTGG - Intergenic
990921592 5:60974121-60974143 GTGCCCACCTGGACTGAGAGTGG - Intronic
991001568 5:61788706-61788728 GTGAACATCTGGCCTGAGGGTGG + Intergenic
991502567 5:67291543-67291565 GTGGAAAACTGCAGTGAGGGTGG - Intergenic
992243274 5:74792330-74792352 GTGCCCACCTGGATTGAGGGTGG - Intronic
995587184 5:113660162-113660184 GTGGGCAGCTGGGCTGGGGCAGG + Intergenic
996164627 5:120209922-120209944 GTGCCCACCTAGACTGAGGGTGG + Intergenic
998031132 5:138869028-138869050 GTGGGCAGATGGGTTGAGGGTGG - Exonic
999088165 5:148911722-148911744 TTAGGAAACTGGACTGAGGCTGG + Intergenic
1000042740 5:157497131-157497153 TTGGGCAACAGGGTTGAGGGTGG - Intronic
1000233718 5:159338315-159338337 GTGGGCAACTGGAAGGAAGTGGG + Intergenic
1000373733 5:160560605-160560627 AGGGGAAACAGGACTGAGGGTGG - Intergenic
1003032172 6:2611378-2611400 GAAGCCAGCTGGACTGAGGGTGG - Intergenic
1003443083 6:6161260-6161282 GTGGGCCAGTGGCCTGAGTGTGG - Intronic
1003443087 6:6161278-6161300 GTGGGCCACTGGCCTGAAGTGGG - Intronic
1003528358 6:6917112-6917134 GTGGGAAGCTGGACTGAGCTGGG + Intergenic
1004014416 6:11719091-11719113 GTGGGCTGCTGGACTGAGAAGGG - Intronic
1004583344 6:16975737-16975759 GTAGGAAGCTGGAGTGAGGGTGG - Intergenic
1006640257 6:35485975-35485997 GTGGGGAAGGGGACTGAGGAGGG + Intronic
1006717792 6:36131172-36131194 CTGGGCAGCTGGGCTGAGAGGGG - Intronic
1007211422 6:40195952-40195974 CTGGGCCACTGGACTGGGAGTGG + Intergenic
1007309534 6:40934579-40934601 GTGTGCAACTTAACTGAGGAAGG + Intergenic
1007725585 6:43913834-43913856 GTGGGCAGCTGGAGGGAGGGAGG + Intergenic
1008682763 6:53891629-53891651 GTGGGAAGCTGGATTGATGGGGG + Intronic
1010327186 6:74577889-74577911 GTGGATAGCTGGACTCAGGGGGG + Intergenic
1013658499 6:112270395-112270417 GTGGGCAGCTGGAATAAGGCTGG + Intergenic
1016435761 6:144035513-144035535 GTGCCCAACCAGACTGAGGGTGG + Intronic
1018900502 6:168049640-168049662 GTGGCCAAACGGCCTGAGGGAGG - Intergenic
1019422613 7:958087-958109 AGGGGCAAATGGACTGAGGCCGG + Intronic
1022131544 7:27409381-27409403 GAGGGATACTGGAGTGAGGGAGG - Intergenic
1026869665 7:73842515-73842537 GTGGGCAACAGGACTCGGGGCGG + Exonic
1027186169 7:75972040-75972062 GTGGGGACCTGGGCTGTGGGTGG + Intronic
1027580429 7:79987986-79988008 GTGCCCACCTGGATTGAGGGTGG - Intergenic
1029623950 7:101708029-101708051 GTGGGCAGCTGTAATGAGGCAGG - Intergenic
1030362286 7:108607665-108607687 TTGGGCAAATGGACTGGGGGCGG - Intergenic
1032062275 7:128735140-128735162 GGGAGCAACAGGAATGAGGGAGG - Intergenic
1032652808 7:133896951-133896973 GTGGGCAACTGGGCCGGGTGTGG - Intronic
1033301769 7:140192517-140192539 GTGGGTAACGTGTCTGAGGGGGG + Intergenic
1033441897 7:141387705-141387727 GTGGGCAGGTGGGCAGAGGGAGG - Intronic
1033653872 7:143361193-143361215 GTGGTGAACCGGACTGAGGAGGG + Intronic
1034026377 7:147708641-147708663 GTGGGAACCTGGACTGTTGGGGG + Intronic
1034502446 7:151459612-151459634 CTGGGGACTTGGACTGAGGGGGG - Intergenic
1034523535 7:151639477-151639499 GTGGGTCAGTGGACTGAGTGGGG + Intronic
1034567098 7:151924117-151924139 CTGGGCCACTGGACCGAGGGAGG + Intergenic
1035326291 7:158068087-158068109 GTGGGCAACAGGACTTGGTGGGG + Intronic
1035559601 8:594533-594555 GTGGACAAATGGACTGGGGAAGG - Intergenic
1037930529 8:22877632-22877654 GTGGGCCCCTGGGGTGAGGGTGG - Intronic
1038209392 8:25501685-25501707 GTGGGCACCTGGCCTGTAGGAGG - Intronic
1038411668 8:27363834-27363856 GTGGCCCACAGGACTGGGGGTGG - Intronic
1039426979 8:37494114-37494136 ATGGGCACCTGGACTGAAGAAGG - Intergenic
1039527806 8:38231875-38231897 GCGGGCGGCTGGACCGAGGGAGG + Intronic
1039675000 8:39653024-39653046 GTGGGAAACTGGGGTGATGGTGG + Intronic
1040514641 8:48124790-48124812 CTGGGCATCTGGTCTGAGGTGGG + Intergenic
1042581690 8:70286267-70286289 CTGGGCATGTTGACTGAGGGAGG + Intronic
1047489831 8:125365372-125365394 GAGGGCAGCTCGGCTGAGGGTGG - Intronic
1048336086 8:133503516-133503538 GTGGGGGGCTGGACGGAGGGAGG - Intronic
1048521505 8:135159716-135159738 GTGCCCACCTGGATTGAGGGTGG - Intergenic
1048923175 8:139248694-139248716 GTGGCCAACAGGAATGAGAGGGG + Intergenic
1052595479 9:30552277-30552299 GTGGGCTACTGGATGGAGGCTGG + Intergenic
1053864714 9:42424869-42424891 GTCTGGAACTGCACTGAGGGTGG + Intergenic
1057210360 9:93198030-93198052 CTGGGAAACTTTACTGAGGGGGG - Intronic
1058230011 9:102413855-102413877 GTGCCCACCTGGATTGAGGGTGG + Intergenic
1059730886 9:117055754-117055776 GAGGGCAAGGGGACTGAGGGAGG + Intronic
1060801741 9:126549453-126549475 GTGGGCAGCTGCTCTGGGGGAGG + Intergenic
1061076516 9:128344727-128344749 GGGAGCAGCTGGACTGTGGGAGG + Intronic
1061224421 9:129272546-129272568 GCGGGTAACTGGGCTGGGGGAGG - Intergenic
1061952239 9:133943054-133943076 GTGGGCACCTGACCAGAGGGCGG + Intronic
1062331037 9:136045063-136045085 GTGGGCAGCTGGTCTGAGGCTGG + Intronic
1185541560 X:906649-906671 GTGGGGAGCTGGAGTCAGGGAGG + Intergenic
1186420290 X:9420186-9420208 GTGGGGAACTGGGCTCAGGCAGG + Intergenic
1186732014 X:12420143-12420165 ATGGGCAACTAGACAGAGTGTGG - Intronic
1187467876 X:19542590-19542612 GGGGACAACTGCACAGAGGGAGG + Intronic
1187575746 X:20552806-20552828 GTGCCCACCTAGACTGAGGGTGG + Intergenic
1189092808 X:38105153-38105175 GTGTCCAACTGGACAAAGGGAGG + Intronic
1190322391 X:49186655-49186677 GTGGCCAACTGGACTGAGAGGGG + Intergenic
1191079727 X:56496640-56496662 GTGGGCAGATCGACTGAGGTTGG - Intergenic
1191210545 X:57880417-57880439 GTGGACAACTGGACAGTGGAGGG + Intergenic
1192172900 X:68867828-68867850 GGGGGCAACTGGGCGGAGGAGGG - Intergenic
1193391564 X:80935373-80935395 GTGCCCACCTGGATTGAGGGTGG - Intergenic
1194641358 X:96407197-96407219 CTGGGCTACTGGCCAGAGGGAGG + Intergenic
1194722574 X:97357467-97357489 GTAGGCAACTGGAAGGAGGGGGG - Intronic
1195220184 X:102738967-102738989 GGGGGCAACTGGAAGCAGGGAGG + Intronic
1195223600 X:102769446-102769468 GTGGGAAACTGGGCTCAGAGAGG - Intergenic
1195676164 X:107508664-107508686 CTGGGCAACTGGCTTGGGGGAGG - Intergenic
1197013767 X:121598993-121599015 GTGCCCACCTGGATTGAGGGTGG + Intergenic
1198748421 X:139914221-139914243 CTGGGAAAATGGACTGAGAGAGG - Intronic