ID: 1138579333

View in Genome Browser
Species Human (GRCh38)
Location 16:57930070-57930092
Sequence TTGGATAAACAACCAGAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 477
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 442}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138579333_1138579335 -7 Left 1138579333 16:57930070-57930092 CCCTGTTCTGGTTGTTTATCCAA 0: 1
1: 0
2: 2
3: 32
4: 442
Right 1138579335 16:57930086-57930108 TATCCAAAATAATCAAAATCAGG 0: 1
1: 11
2: 62
3: 324
4: 1386

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138579333 Original CRISPR TTGGATAAACAACCAGAACA GGG (reversed) Intronic
900801709 1:4741120-4741142 GTGGATGAACAAACAGAAAACGG + Intronic
902725590 1:18333890-18333912 TTGGAGAAAAAAACAGAAGAAGG + Intronic
904426922 1:30432882-30432904 TTGGATAAACACCCAGCAGTGGG - Intergenic
904446415 1:30576568-30576590 AAGGATAAACAACAATAACAGGG - Intergenic
905760432 1:40552124-40552146 TTGGATAAATACCCAGAAGTGGG + Intergenic
907478147 1:54721493-54721515 TTGGAAAAAAAATCAGAATATGG - Intronic
907877916 1:58512391-58512413 TTGGATAAATATCCAGAAGTAGG - Intronic
908873871 1:68647513-68647535 TTTGATAGACAATGAGAACAGGG - Intergenic
909236414 1:73157844-73157866 TTGGATATATAACCAGAAATGGG - Intergenic
909267496 1:73579140-73579162 TTGGGTAAACAACAAAATCAAGG + Intergenic
909911929 1:81270608-81270630 TTGGTTAAACAACAACAAAATGG - Intergenic
911082517 1:93947381-93947403 TTGGATAAATACCCAGTAGAGGG + Intergenic
913474168 1:119220830-119220852 TTGGATAAATACCCAGAAGTGGG + Intergenic
914333500 1:146694645-146694667 TTGGATAAATACCCAGAAGTGGG + Intergenic
914963659 1:152231463-152231485 TTGGATAAACACCCAGGAGTGGG + Intergenic
916862382 1:168820107-168820129 TTGGATAAATAACCAGAAGTGGG - Intergenic
917917380 1:179716165-179716187 TTGGATATACATCCAGAAGTGGG + Intergenic
917977113 1:180247111-180247133 TTGGATGAACAAACAGTACTAGG - Intronic
918365115 1:183799315-183799337 TTGGATAAATACCCAGAACTAGG + Intronic
918547221 1:185698789-185698811 TTGGATATATACCCAGAAGAGGG + Intergenic
918678810 1:187325445-187325467 TTGGAAAAGCATCCAGACCAGGG - Intergenic
919255827 1:195123112-195123134 TTGGATAAAGAGCCAGAAGTAGG + Intergenic
919462383 1:197893237-197893259 TTGGATAAATAACCAGAAGTGGG + Intergenic
919874021 1:201848292-201848314 TTGGAAAAACAATGAGTACAAGG - Intronic
920416643 1:205803306-205803328 TTGGATAAATATCCAGAAGTGGG - Intronic
920654509 1:207865757-207865779 TGGGATAATAAACCAGTACAAGG + Intergenic
921917624 1:220629951-220629973 TTGGATAAATACCCAGAAGTGGG + Intronic
922462261 1:225822940-225822962 TGGGCTAAATAACAAGAACAGGG + Intronic
923909595 1:238426427-238426449 TTGGATAAACACCCAGTAGCAGG + Intergenic
923919102 1:238544374-238544396 TTGCATAAACAAGAAGAAAATGG + Intergenic
924119945 1:240786375-240786397 TTGAAGAAACATCCATAACATGG - Intronic
924812219 1:247413149-247413171 TTGGATACACACTCAGAAGAAGG + Intergenic
1064142395 10:12801510-12801532 ATGGATAAACAAATAGAAGATGG - Intronic
1064815997 10:19263144-19263166 CTGGATATACACCCAGAACTGGG + Intronic
1065201798 10:23319509-23319531 TTGGATATATAACCAGCAAAGGG + Intronic
1067179847 10:43976686-43976708 TTGGGTAAACACCCAGAAATTGG + Intergenic
1067304883 10:45053887-45053909 TTGGGTAAATAACCAAAAGAGGG + Intergenic
1068423602 10:56826533-56826555 TTGGATAAACAACAAAATTAAGG + Intergenic
1068820665 10:61374552-61374574 TTGGATAAACAACAAAATTAAGG - Intergenic
1069256815 10:66343213-66343235 TTGGATAAATTACCAGTACCAGG - Intronic
1069755472 10:70772038-70772060 GTGGAAAAACAAGCAGACCATGG - Intronic
1069795977 10:71052221-71052243 TTGCAAAAACAAGCAGAGCACGG - Intergenic
1070861760 10:79672795-79672817 TTGGAAAAACAAGAAAAACACGG + Intergenic
1070875391 10:79801834-79801856 TTGGAAAAACAAGAAAAACACGG - Intergenic
1071642319 10:87323976-87323998 TTGGAAAAACAAGAAAAACACGG - Intergenic
1071798655 10:89032862-89032884 TTGGATAAAGATCCAGAATATGG + Intergenic
1072176201 10:92924571-92924593 TTTGTTAAACACCCAGAAAAAGG + Intronic
1072228539 10:93392975-93392997 CTGGTTAAACAAGAAGAACACGG + Intronic
1073705668 10:105981185-105981207 TTGGATTTACAACTAGGACAGGG - Intergenic
1074664292 10:115701208-115701230 TTGGATAAACAACAAAATTAAGG + Intronic
1074982762 10:118632988-118633010 TGAGATAAGCAACCAGGACAAGG - Intergenic
1077821253 11:5743635-5743657 TTGGATACACAACAAAATCAAGG + Intronic
1078123948 11:8540047-8540069 TTGGGTATACACCCAGAAGAGGG - Intronic
1079474731 11:20817853-20817875 TTGAATAAACAATTAAAACAAGG - Intronic
1079726028 11:23882444-23882466 TTGGCTAAAGAACAAGAACTAGG - Intergenic
1079887116 11:26002807-26002829 TGGGATACAAAATCAGAACATGG + Intergenic
1080473810 11:32571434-32571456 TGGGAGAAAAAACTAGAACAGGG - Intergenic
1080492179 11:32777548-32777570 CTGGATTAACAACCCTAACAGGG + Intronic
1082753107 11:57044020-57044042 TTGGATATACACCCAGAAGTGGG - Intergenic
1083841902 11:65309349-65309371 ATGGAGAAACACCCAGAGCAGGG - Intergenic
1084986808 11:72881526-72881548 TTGGATAAATATCCAAAAGAGGG - Intronic
1085952664 11:81351291-81351313 TTGGATAAATACCCAGAAATTGG + Intergenic
1087899381 11:103623365-103623387 TTGTATAAACACCCAGAAGCAGG - Intergenic
1088612993 11:111596711-111596733 TTGGATAAATACCCAGAAGTGGG - Intergenic
1089734888 11:120543639-120543661 TTGGATAAATACCCAGAAGTGGG - Intronic
1090621330 11:128563614-128563636 TTGGATAAACAGCCACACCACGG + Intronic
1090920528 11:131202622-131202644 TTGGATAAATACCCAGAAGTGGG + Intergenic
1092553410 12:9528436-9528458 ATGAATAAATAACCAGAAGATGG - Intergenic
1092788631 12:12052724-12052746 TTGGATAAATACCCAGAAGTGGG + Intronic
1093365889 12:18298028-18298050 TTGGATAAACACCCATAAGTAGG + Intronic
1093370415 12:18358099-18358121 TTGGATAAATACCCAGAAGTAGG + Intronic
1093487694 12:19669618-19669640 TTGGATAAACACCCAGAAATGGG - Intronic
1093862804 12:24188324-24188346 TTGGATAAACAACAATACTAGGG - Intergenic
1093940691 12:25050618-25050640 TTGGATAAATACCCAGAAGTGGG - Intronic
1094518689 12:31162187-31162209 ATGAATAAATAACCAGAAGATGG + Intergenic
1094722721 12:33081167-33081189 TTGAATAAACAACAACAAAAAGG + Intergenic
1097247666 12:57615466-57615488 TTGGAAAAAGAACAAGAAAAAGG - Intronic
1097736449 12:63187103-63187125 TTGGATATACAACCAGAAATGGG + Intergenic
1097819906 12:64118095-64118117 TTGGATAAATACCCAGAAGTAGG + Intronic
1099233202 12:80051433-80051455 TTGGATAAATACCCAGTAGAGGG + Intergenic
1099931373 12:89079261-89079283 TTGGGTAAACGCCCAGAAGATGG + Intergenic
1100161592 12:91866926-91866948 TTGGACTTCCAACCAGAACATGG - Intergenic
1101004355 12:100387110-100387132 TTGGATAAATACCCAGAAGTGGG + Intronic
1101312306 12:103593169-103593191 TTGGATATATAACCAGAAGTAGG + Intronic
1101657274 12:106733823-106733845 TTGGATACACACCCAAAAGAAGG + Intronic
1102753508 12:115317402-115317424 TTGGATATACACCCAGAAGTGGG - Intergenic
1105938646 13:25127234-25127256 TTGGATAAATACCCAGAAGTGGG - Intergenic
1107046445 13:35997964-35997986 CTGGATCAGCAATCAGAACATGG - Intronic
1107101969 13:36602989-36603011 TTGGATAAATACCCAGAAGTGGG - Intergenic
1107422215 13:40258014-40258036 TTGCATAAACACCCAGAAGTGGG + Intergenic
1107995372 13:45854211-45854233 TGGGATGAATAAGCAGAACACGG - Intergenic
1108295318 13:49011201-49011223 GTGAAAAGACAACCAGAACAGGG - Intronic
1108440368 13:50447122-50447144 TTGGATAAATATCCAGAAGTGGG + Intronic
1108900229 13:55393996-55394018 TTGGATAAATATCCAGAAATGGG - Intergenic
1109318708 13:60782922-60782944 TTGGATAAATACCCAGAAGTGGG + Intergenic
1109491250 13:63102349-63102371 TTGGATAAATATCCAGAAGTAGG - Intergenic
1111055078 13:82938470-82938492 TTGGATGCAAAACAAGAACATGG + Intergenic
1111069201 13:83141498-83141520 TTGCAGAAACACCCAGGACATGG + Intergenic
1111271099 13:85886584-85886606 TTGGATAAATATCCAGAAGTAGG + Intergenic
1111317221 13:86578375-86578397 TTGGATAATTAACAAAAACAAGG - Intergenic
1111392043 13:87609059-87609081 TTGGATCAAGAACCACAACTTGG + Intergenic
1111565585 13:90010624-90010646 TTGAATAAACAAACGGAATAGGG + Intergenic
1111660036 13:91198164-91198186 TTGGGTATACACCCAGAAGATGG - Intergenic
1112691148 13:101896074-101896096 TTGGAGAACCAAGCAGTACATGG - Intronic
1112902753 13:104378743-104378765 TTGGATATATAACCAGAAGTGGG + Intergenic
1113364081 13:109660370-109660392 TTGGATATATACCCAGAAGAGGG - Intergenic
1114355275 14:21900803-21900825 TTGGAGAAACAACCTGCACAAGG - Intergenic
1114464192 14:22909402-22909424 TTGGAAAAATAACCAGAATAGGG - Intronic
1114849318 14:26364189-26364211 TAGGATAAACAATCAGGAAATGG + Intergenic
1115035531 14:28852228-28852250 TAAGATAAACTACTAGAACAGGG - Intergenic
1115363604 14:32531987-32532009 TTGGATAAACACCCAGGAGTGGG + Intronic
1115409777 14:33060981-33061003 TTGGATTCACAACCAAAAGAGGG + Intronic
1115657743 14:35459903-35459925 TTGGATAAACTTCCTGAACTGGG + Intergenic
1115705817 14:35997162-35997184 TTGGATAAATACCCAGAAGTGGG + Intergenic
1115737583 14:36350797-36350819 ATGGAGAAACATCCATAACATGG + Intergenic
1115791539 14:36884477-36884499 TTGGATATACACCCAGAAGTGGG + Intronic
1116052124 14:39817052-39817074 TTGGATAAACACCTAGAAATGGG + Intergenic
1116766724 14:49081177-49081199 TTGGGTAAACAACAAAAATAAGG - Intergenic
1117091020 14:52250307-52250329 TTGAATAAACAACCAGACACAGG + Intergenic
1117889937 14:60409309-60409331 TTGGATAAATAACAAAATCAAGG - Intronic
1118019898 14:61700638-61700660 TTGGATACATATCCAGAAGAGGG + Intronic
1119541932 14:75444848-75444870 CTGCATAAACAACCAGAAACTGG - Intronic
1119562893 14:75605097-75605119 TTGGAAAAAGATCAAGAACAAGG - Intronic
1119629268 14:76212593-76212615 GTGGATAAAAAACTAGGACATGG + Exonic
1121027890 14:90629901-90629923 TTGGAAAAAAAACTAGAAAAGGG + Intronic
1122588815 14:102830596-102830618 TTCTATAAATAACCAGAAGAAGG - Intronic
1123828907 15:24113341-24113363 ATGTATAAACAAACAGAAAAGGG - Intergenic
1124417574 15:29485998-29486020 TTGGATAAACAGCCAGCAGTGGG - Intronic
1124843451 15:33266357-33266379 TTGGATATACAACCAGAAGTAGG + Intergenic
1124913163 15:33943098-33943120 TTGGATAAATATCCAGAAGCAGG - Intronic
1125013897 15:34911293-34911315 TTGGATAAACATTCAGAAGTGGG + Intronic
1125072263 15:35569246-35569268 TTGGATAAATACCCAGAAGTGGG + Intergenic
1125170985 15:36766408-36766430 TTGGATAAATACCCAGAAGCAGG + Intronic
1125356741 15:38824551-38824573 TTGGATAAATACCCAGAAATGGG - Intergenic
1125671521 15:41476881-41476903 GTGGCTAAACCACCATAACAAGG - Intronic
1125772934 15:42183770-42183792 TTGGATAAAGAGACAAAACAAGG - Intronic
1126819707 15:52490225-52490247 TTGGATATATAACCAGAAGTGGG - Intronic
1126864871 15:52925415-52925437 ATGGATAAACAACCAGCACTGGG + Intergenic
1126865020 15:52926962-52926984 ATGGACAAACAACCAGCACTGGG - Intergenic
1127270700 15:57398870-57398892 ATGGTTAAACAACAAAAACATGG - Intronic
1127410533 15:58701624-58701646 TTGGATAAACACCCAGTAGCAGG - Intronic
1129075110 15:72988086-72988108 TTGGATATATATCCAGAAGAGGG - Intergenic
1129978892 15:79847990-79848012 TTGGATAAATACCCAGAAGTGGG - Intronic
1131694686 15:94863853-94863875 TTGCATGAACTACCAGAGCAAGG + Intergenic
1131767310 15:95692503-95692525 TTGGATACAGAACCAGGAAAGGG + Intergenic
1131879456 15:96847085-96847107 TTGCATAAATCACCAGAACATGG - Intergenic
1133129101 16:3665216-3665238 GTCGGCAAACAACCAGAACACGG + Exonic
1135784527 16:25336663-25336685 TTGGATAAATATCCAGAAGTAGG + Intergenic
1136353217 16:29725753-29725775 TTGGATATACACCCAGAAGTGGG + Intergenic
1137281664 16:46982137-46982159 TTGGATATACACCCAGAAGTGGG + Intergenic
1137810370 16:51346874-51346896 TTGGATAAATAACCAGAATTAGG + Intergenic
1138579333 16:57930070-57930092 TTGGATAAACAACCAGAACAGGG - Intronic
1138810271 16:60140841-60140863 ATGTAAAAGCAACCAGAACAAGG + Intergenic
1139162537 16:64528444-64528466 TTGGAGAGAGAGCCAGAACAAGG + Intergenic
1140000120 16:71016603-71016625 TTGGATAAATACCCAGAAGTGGG - Intronic
1141399079 16:83731166-83731188 TTGGATAAACACCCAGTAGTAGG + Intronic
1142571933 17:880326-880348 TTGGATTAACAACCAGGGCTGGG + Intronic
1143284325 17:5777843-5777865 TTGGATATACACCCAGAAGGGGG - Intronic
1143944906 17:10582363-10582385 TTGGGTAAATACCCAGAACTGGG + Intergenic
1144153836 17:12478480-12478502 TTGGATATATACCCAGAAGAGGG + Intergenic
1144544512 17:16180412-16180434 TTGAGTATACAACCAGAAGAGGG - Intronic
1148286051 17:46392872-46392894 TTGGAGAAGGAATCAGAACAAGG - Intergenic
1148308218 17:46610462-46610484 TTGGAGAAGGAATCAGAACAAGG - Intronic
1148399753 17:47346571-47346593 TTGGATAAATACCCAGAAGTGGG + Intronic
1148744612 17:49911396-49911418 TTGGAAAAAGAACCAGAAACAGG - Intergenic
1149899977 17:60466364-60466386 ATGGATAAACTATCAAAACATGG - Exonic
1150271011 17:63865121-63865143 TAGCATAAACAACCAGCTCAGGG + Intergenic
1150274596 17:63888323-63888345 TAGCATAAACAACCAGCCCAGGG + Intergenic
1150952160 17:69815472-69815494 TTTGATAAATATCCAGAACTGGG + Intergenic
1151759655 17:76093369-76093391 TTGGAGAAACAGGCAGAGCAGGG - Intronic
1152511433 17:80792125-80792147 GTGCACAAACAAACAGAACAAGG - Intronic
1153113914 18:1631116-1631138 TTGAATAAATACCCAGAAGAAGG - Intergenic
1153278226 18:3390058-3390080 TAGTATACACAACCAAAACAAGG - Intergenic
1153536170 18:6104213-6104235 TTGGATAAATATCCAGAAGTGGG - Intronic
1156344903 18:36247954-36247976 TTGGATAAATACCCAGAAGTGGG + Intronic
1156652540 18:39241368-39241390 TTGTATAAATACCCAGAAAAGGG - Intergenic
1156738292 18:40291215-40291237 TTGGATATATACCCAGAAGAAGG - Intergenic
1156773032 18:40752620-40752642 TGGGATAACTAACCAGATCATGG - Intergenic
1157619251 18:49006653-49006675 TTGGAGAAACATGCAGTACAAGG + Intergenic
1157634726 18:49140699-49140721 TTGGCTAAAAAACAGGAACAGGG + Intronic
1158173659 18:54628375-54628397 TTGGATATATACCCAGAACTGGG - Intergenic
1158755810 18:60323479-60323501 TTGGATAAATACCCAGAAGTGGG + Intergenic
1159123087 18:64192679-64192701 TGGGAAAAAAAACCTGAACATGG + Intergenic
1159170517 18:64760418-64760440 TTGGATAAACAATGAAATCAAGG + Intergenic
1159763046 18:72452589-72452611 TTGGATACAAACCCAGAACTAGG - Intergenic
1159854999 18:73575742-73575764 TTGAATAGACAACCAAAAAAAGG - Intergenic
1160001565 18:75029159-75029181 ATGAACAAACAAGCAGAACATGG - Intronic
1161531135 19:4790696-4790718 TTGGATAAAGACCCAGAAGTGGG - Intergenic
1162593777 19:11611513-11611535 TTGGATAAAACACCAGAACATGG - Intronic
1164667454 19:30050977-30050999 GTGGATGAACACCCAGATCAGGG - Intergenic
1165765663 19:38349430-38349452 TTGGTTAGAGAACAAGAACAAGG - Intronic
1165999226 19:39868074-39868096 ATGAATTAACATCCAGAACATGG + Intronic
925212683 2:2063541-2063563 TTGGATTAAAAAAAAGAACATGG + Intronic
925467442 2:4120242-4120264 TTGGATAAATACCCAGAAATGGG + Intergenic
925898744 2:8493721-8493743 TAGGATAAACAAACAGAATTGGG - Intergenic
926861826 2:17317859-17317881 TGGGAAAAACAAACTGAACAGGG + Intergenic
927265413 2:21142814-21142836 TTGAACAAACAACTAGAACCGGG - Exonic
927342063 2:21993595-21993617 TTGGAGAAACAGCAAGAAAAAGG - Intergenic
927542212 2:23922996-23923018 TTGGATAAATACCCAGAAGTTGG - Intronic
928717929 2:34084506-34084528 TTGGATAAATACCCAGTAGAAGG + Intergenic
929166140 2:38883905-38883927 TTGGATAAACACCCAGAAGTAGG - Intronic
929166223 2:38884476-38884498 TTGGATAAACACCCAGAAGTAGG + Intronic
929244977 2:39691624-39691646 TTGGATAAATACCCAGAAGTGGG - Intronic
929814152 2:45218052-45218074 TTGGATAAATACCCAGAACAAGG - Intergenic
933593788 2:84262133-84262155 TTGGATAAATACCCAGTAGAGGG - Intergenic
933992671 2:87644761-87644783 TTGGATAAATACCCAGAAATGGG + Intergenic
934570282 2:95366532-95366554 TTGGGTAAATAACCAGAAATGGG + Intronic
934868813 2:97840642-97840664 TTGTAATAACAGCCAGAACAGGG + Intronic
936301183 2:111306080-111306102 TTGGATAAATACCCAGAAATGGG - Intergenic
936614544 2:114035111-114035133 TTGGATAAATACCCAGAAGTAGG + Intergenic
936816025 2:116461951-116461973 TTGGATAAATAACCAGTAGTGGG - Intergenic
937525342 2:122761581-122761603 TTGGATAAATACCCAGAAGTGGG + Intergenic
937869115 2:126775206-126775228 TTGGATGGATACCCAGAACAAGG - Intergenic
939211460 2:139180532-139180554 TTAGATAAACAACAATACCATGG - Intergenic
939535508 2:143422835-143422857 TGAGATAAACCACCAGAATAGGG + Intronic
940966514 2:159843857-159843879 TTGTATAAACAATCTGATCAGGG - Intronic
941587318 2:167377078-167377100 TTGGGTAAACAACAAAATCAAGG - Intergenic
941876558 2:170439594-170439616 TTGGATATGAAACCAAAACATGG - Intronic
942849691 2:180469560-180469582 TTGGATATACACCCAAAACTGGG - Intergenic
942929919 2:181477831-181477853 TTGGATATATACCCAGAAGAGGG - Intronic
945347548 2:208736502-208736524 TTGGATAAACAACAAAATTAAGG - Intronic
945911778 2:215658115-215658137 TTGAAAACACAACCAGAAGAAGG + Intergenic
946148646 2:217749385-217749407 GTGCATAACCACCCAGAACATGG + Intronic
946623517 2:221585468-221585490 TTGGATAAATACCCAGAAGTGGG + Intergenic
946783017 2:223211737-223211759 TTGGATAAATACCCAGTACTGGG - Intergenic
947429916 2:230018320-230018342 TTGGATATACACCCAGAAGACGG - Intergenic
948899387 2:240948505-240948527 ACGGATAAACACCCAGCACAGGG + Intronic
1168740319 20:184310-184332 TTGGATAAACAACAAAATGAAGG + Intergenic
1169541911 20:6608695-6608717 AGGGATTAACAACCAGAATAAGG + Intergenic
1170070229 20:12358359-12358381 TTGGATAAACCATCATAAAAAGG + Intergenic
1170715285 20:18825658-18825680 GTGGAGAAACACCCAGAACTTGG - Intronic
1171111852 20:22491276-22491298 GTGGGTGATCAACCAGAACAAGG - Intergenic
1171818807 20:29813646-29813668 TTGGATAAACAGGCAGAAGTTGG - Intergenic
1172760934 20:37321191-37321213 TTGGATAAATACCCAGAAGTGGG + Intergenic
1173065985 20:39712115-39712137 TTGGATATATACCCAGCACAGGG + Intergenic
1173691103 20:44961780-44961802 TTGGATAAACAAAGATAAAAAGG - Intergenic
1173707971 20:45127024-45127046 TTGGATAAATACCCAGAAGGGGG + Intergenic
1174193249 20:48754979-48755001 TAGGATAAATACCCAGAACTTGG - Intronic
1175726071 20:61319535-61319557 TTGGATAAATACCCAGAAGTGGG + Intronic
1177231222 21:18322364-18322386 TTGGATAAATATCCAGCAGAGGG - Intronic
1177429867 21:20978053-20978075 TTGGATAAACATCCAGTAGTGGG + Intergenic
1177610707 21:23443863-23443885 TTGGATATAGACCCAGAAGAGGG + Intergenic
1178458686 21:32780374-32780396 TTGTATCAACAACAACAACAAGG + Intergenic
1178758471 21:35376643-35376665 TTGGATAAATACCCAGAAGTGGG + Intronic
1181763713 22:25076224-25076246 TTGGATATATACCCAGAAGAGGG + Intronic
1182755977 22:32679481-32679503 TTGGATATATATCCAGAAGAGGG + Intronic
1183758463 22:39792935-39792957 TTGGATAAATACCCAGAAGAGGG + Intronic
1183936042 22:41262968-41262990 TTGGTTAGACACCCAGACCATGG + Intronic
1183978536 22:41526828-41526850 TTTGAGAAACAAACAGAACCAGG + Exonic
949504322 3:4712794-4712816 TTGGATAAGAAAACAGAAAACGG + Intronic
951288941 3:20851975-20851997 TTGGGTATACAACCAGAAAATGG - Intergenic
951292264 3:20887130-20887152 TTGGAAAAATAATCAGAATATGG - Intergenic
952014317 3:28938949-28938971 TTGGGTATATACCCAGAACAGGG - Intergenic
952393296 3:32899378-32899400 CTGGATAAACAGCCATAAAAAGG + Intergenic
952674933 3:36017258-36017280 TTGAATATACACCCAGAAAAGGG + Intergenic
954785288 3:53088151-53088173 TTTAATAAACAAACAAAACAAGG + Intronic
954939570 3:54359116-54359138 TTAGAGAAACAAATAGAACATGG + Intronic
955249105 3:57260440-57260462 TTGAATTAACAAGCAGAAAAAGG - Intronic
955681132 3:61503343-61503365 CTGGATAAAGAACCAGGACCTGG - Intergenic
956024067 3:64963381-64963403 TTGAATTAAAAACCATAACAAGG - Intergenic
957245238 3:77708174-77708196 TTTGATAGACATCCAGAAAAGGG - Intergenic
959825327 3:110788039-110788061 TTGGTTAAACAACTAGATTAAGG - Intergenic
959856758 3:111168147-111168169 TTGGATGAACAGCCAGATAAGGG + Intronic
959865517 3:111265210-111265232 TTGGATATATACCCAGAAGAGGG - Intronic
960715450 3:120570444-120570466 TTGGATAAATATCCAGAAGTGGG - Intergenic
960772409 3:121209273-121209295 TTGGATACATAACCAGAAATGGG + Intronic
960779118 3:121297982-121298004 TTGGATAAATACCCAGAAGTAGG + Intronic
961227578 3:125266474-125266496 TTGGATAAACAATGAAATCAAGG + Intronic
961927562 3:130497430-130497452 TTGGATAAACACCCAGAAGTGGG + Intergenic
962078261 3:132108739-132108761 TTGGATATATAACCAGTACTGGG + Intronic
963132461 3:141871445-141871467 TTTGAAAAACAACCAAAAGAAGG - Intergenic
963579212 3:147103118-147103140 TTGGATATATACCCAGAACTTGG + Intergenic
963726177 3:148924043-148924065 TTGGATAAATACCCAGAAGTGGG - Intergenic
964642629 3:158926399-158926421 TTTTATTAACAAACAGAACATGG + Intergenic
965686807 3:171312533-171312555 TTGGATACCCACCAAGAACAAGG - Intronic
967141168 3:186561862-186561884 TTGGATAAATACCCAGAAGTGGG - Intronic
969252831 4:5981180-5981202 ATGGAAAAACGCCCAGAACACGG - Intronic
970234809 4:13947794-13947816 CTGGATAAATAAGCTGAACATGG - Intergenic
971507624 4:27383502-27383524 TTGGATAAATACCCAGAAGTGGG - Intergenic
971585978 4:28406381-28406403 TTGGATATACACCCAGTACTGGG - Intergenic
972147428 4:36045179-36045201 TTGGATATATACCCAGAACTGGG - Intronic
972415677 4:38838233-38838255 TTAGATAAACATCCAGAAGTGGG - Intronic
974410545 4:61536120-61536142 TTGGATAAACAACAACATTAAGG - Intronic
974965467 4:68755466-68755488 TTGTAAAAACAATCAGAAAAGGG + Intergenic
974988380 4:69057518-69057540 ATGGATAAATATCCAGAAGAGGG - Intronic
974995557 4:69154601-69154623 TTATATAAACAATCATAACATGG + Intronic
975448331 4:74494379-74494401 TTGGATAAATATCCAGAAGAGGG + Intergenic
975758187 4:77592074-77592096 TTGGATAAATATCCAGAAGTGGG - Intronic
975886157 4:78967812-78967834 TTGGATAAATACCCAGAAGTAGG + Intergenic
976006361 4:80435466-80435488 ATGGATAAAGAACAACAACATGG + Intronic
977009445 4:91618221-91618243 TTGGATAAATATCCAGTACCAGG - Intergenic
977753775 4:100640897-100640919 TTGGATATATAACCAGAAGTAGG - Intronic
978024967 4:103862297-103862319 TTGGATACACACCAAGAACTGGG + Intergenic
978866971 4:113524643-113524665 TTGGATATATAACCAGAAGTGGG + Intronic
978949012 4:114534685-114534707 TTCCAGAAACAAACAGAACATGG + Intergenic
978985911 4:115012678-115012700 TTGGATATACACCCAGCACTGGG - Intronic
979489089 4:121304434-121304456 TTGGATAAATACCCAGTACTGGG + Intergenic
979578788 4:122330230-122330252 TTGGATAAATACCCAGAAGTGGG + Intronic
980212460 4:129807498-129807520 GTGGATAAATAACTTGAACAGGG + Intergenic
980433248 4:132732271-132732293 TTGCATACACAACCAGAATGTGG + Intergenic
980477708 4:133339961-133339983 GTGGATAAATAACCAGAAGTGGG + Intergenic
981113701 4:140965379-140965401 TTGGATATATACCCAGAAGAGGG - Intronic
981271967 4:142856100-142856122 TTGGGTATAAAACCAGAAAAGGG - Intergenic
981781159 4:148431112-148431134 TTGTATAAATAAGAAGAACAAGG + Intronic
981798403 4:148626808-148626830 TTTGATAAATAACCAGAAATGGG - Intergenic
983831117 4:172329504-172329526 TGGGATGAACACCCAGAAGAAGG - Intronic
985474360 5:70463-70485 TTGGGTAAATAACCAGAAGTGGG - Intergenic
985499024 5:229249-229271 TTGGATATACACCCAGAAATGGG - Intronic
986514398 5:8545994-8546016 TTGGATATACACCCAGAAAAGGG - Intergenic
986672551 5:10155731-10155753 TTGGATATACACCCAGAAGTGGG - Intergenic
986750651 5:10784263-10784285 TTGGATAAACACCCAGTAGTAGG - Intergenic
987479855 5:18440178-18440200 TTGGATAAACACTCAGAAGTGGG + Intergenic
988815181 5:34827500-34827522 TTCCATATACAAACAGAACATGG + Intronic
991342791 5:65629936-65629958 CTGGGTAAACAATCAGAAAAGGG + Exonic
992220845 5:74571562-74571584 TTGGATAAACAACAAAATTAAGG - Intergenic
993776762 5:92009660-92009682 TTGAATAAATAACCAGAAGTAGG - Intergenic
993935376 5:93994153-93994175 TTGGATATATACCCAGAAAAGGG - Intronic
994580905 5:101640721-101640743 TTGAATAAGAAACCAGAAGAGGG - Intergenic
994958916 5:106572733-106572755 TTTGTGAAACAACCATAACATGG + Intergenic
995964847 5:117892428-117892450 TTAGATAAAAAACCATAACGTGG - Intergenic
996241982 5:121215363-121215385 TAGGATACACAAGCACAACAAGG - Intergenic
996521742 5:124435435-124435457 TTGGATATATACCCAGAAGAGGG - Intergenic
996697364 5:126413343-126413365 TTGGATAAACAACAAAATTAAGG - Intronic
998450390 5:142229850-142229872 TTGGATAAATACCCAGAAGTGGG - Intergenic
999094019 5:148962228-148962250 TTGGAGAAACAACCGAATCAGGG + Intronic
999107063 5:149082657-149082679 TTGGATATATACCCAGAAGAAGG - Intergenic
999111647 5:149126623-149126645 ATGGAAATAGAACCAGAACATGG + Intergenic
999409134 5:151335123-151335145 TTGGAGAAAGAACATGAACAAGG + Intronic
999868096 5:155723444-155723466 CTGGATAATCAAACAGAACCAGG - Intergenic
1000424071 5:161070799-161070821 TTGGATAAACAACCAAATTAAGG + Intergenic
1000824010 5:166021621-166021643 TTGGAAAAAAAAGGAGAACAAGG - Intergenic
1001488786 5:172140754-172140776 TTGGATAAATACCCAGAAGTGGG - Intronic
1002277269 5:178112224-178112246 ATGGATAAACCTCCAAAACATGG - Intergenic
1005731033 6:28696905-28696927 TTGGATAAAGAAGCAGCCCAAGG - Intergenic
1005885080 6:30091465-30091487 GTGGAGAAACAAAAAGAACAAGG + Intergenic
1005918443 6:30375836-30375858 TTGGGAAAACTGCCAGAACATGG - Intergenic
1007456767 6:41984293-41984315 TTGGATATACACCCAGAAGTTGG + Intronic
1008194642 6:48503522-48503544 TTGGATAAATAACCAGTAATGGG - Intergenic
1008201069 6:48591528-48591550 TTGGGTAAATAACCAGTACTGGG + Intergenic
1008392905 6:50973528-50973550 GTGGAGAAATTACCAGAACATGG - Intergenic
1009065432 6:58555326-58555348 TTGGAGATACTACAAGAACAGGG - Intergenic
1009313325 6:62185763-62185785 TTGGATAAGCAAACAGGAAATGG - Intronic
1009573877 6:65426604-65426626 TTTGATAGACAAAAAGAACAGGG - Intronic
1009673815 6:66790170-66790192 CTGGAAAAACAAACACAACATGG + Intergenic
1010023708 6:71190980-71191002 TTATAAAAACAACCAGAAGAGGG + Intergenic
1010246843 6:73668528-73668550 TTGGATATACACCCAGAAATGGG + Intergenic
1010385681 6:75276979-75277001 TTGAATAAAGAACCAAAAGAGGG - Intronic
1010411313 6:75565225-75565247 TTGGATAAACAACAAAACTAAGG + Intergenic
1010480415 6:76345402-76345424 TTGGATATACACCCAGAAGTGGG + Intergenic
1010484720 6:76396427-76396449 TTGGATAAATACCCAGAATTGGG - Intergenic
1011368345 6:86605396-86605418 ATGGGCCAACAACCAGAACATGG + Intergenic
1011705586 6:89997858-89997880 TGGCATTAACAACCAGAACTGGG - Intronic
1011841469 6:91505920-91505942 TTGGACCAACAGCAAGAACAAGG - Intergenic
1012903048 6:105030150-105030172 TTGTAAAAACAAGCAGCACATGG - Intronic
1014140870 6:117940481-117940503 TTGGATATACAACCAGATGTGGG - Intronic
1014190460 6:118489775-118489797 TTGGATAAATATCCAGAAGTAGG - Intronic
1014525658 6:122498478-122498500 TTGGGTAAACAACAAAAATAAGG + Intronic
1015656458 6:135524607-135524629 TTGGAAATCCAACCTGAACAGGG - Intergenic
1015708821 6:136117424-136117446 ATGTATGAAAAACCAGAACATGG + Intronic
1016167019 6:140958734-140958756 TTAGATAACCAACCTGAAAAAGG - Intergenic
1016400897 6:143678443-143678465 TTGGATAAAAAACCACAGCGAGG - Intronic
1017424940 6:154310525-154310547 TTGGATATACACCCAGAATACGG - Intronic
1017432901 6:154388515-154388537 TTGGATAAATATCCAGAAATAGG + Exonic
1018465745 6:164043153-164043175 TTGGATAAACAAAAAGAATAAGG - Intergenic
1018524818 6:164697689-164697711 ATGGATAGACAATTAGAACAGGG + Intergenic
1020472602 7:8556122-8556144 TTGGATCAATAGCCATAACATGG - Intronic
1021061956 7:16124054-16124076 TTGGATAAATAACCAGTAGTTGG + Intronic
1021292523 7:18863975-18863997 TTGGATAAACATCCAGAAGTGGG + Intronic
1021318232 7:19177965-19177987 ATAGATAAACAACAATAACAAGG + Intergenic
1021662499 7:22934362-22934384 CTGGAGAAACAAAAAGAACAGGG - Intergenic
1021739760 7:23674632-23674654 TTGGATAAATACCCAGTAAAGGG + Intergenic
1021754335 7:23836549-23836571 TTGGATAATTAACGGGAACAAGG + Intergenic
1023068772 7:36406381-36406403 TTGGATAAACAAGCGGTACCAGG - Exonic
1023085967 7:36570503-36570525 TTGGATAAATACCCAGAAGTGGG + Intronic
1023329121 7:39095094-39095116 ATGGGTAAATATCCAGAACAAGG + Intronic
1023334089 7:39150357-39150379 TTGGGTAAACACCCAGAAGAAGG + Intronic
1024686899 7:51755863-51755885 ATGGAAAAACAAGGAGAACAGGG - Intergenic
1024848282 7:53676936-53676958 TTGGGTATACATCCAGAAGAGGG + Intergenic
1027445530 7:78269287-78269309 TTGGATATACAACCAGTAATGGG + Intronic
1028123748 7:87087619-87087641 TTGGATAAATACCCAGATCTAGG + Intergenic
1028322827 7:89482671-89482693 TTGGATAAACATCCAGTAGTGGG - Intergenic
1029476681 7:100789214-100789236 TTAGGTCAACAACCAGAAGATGG + Exonic
1030254912 7:107498783-107498805 TTGGATAAAAACCCAGAAGTGGG - Intronic
1030665977 7:112279199-112279221 TTGGATAAATAACCAGAAGTGGG + Intronic
1031271577 7:119656607-119656629 TTGGGTATACACCCAGAAAAGGG + Intergenic
1031407512 7:121404401-121404423 GTGGATACACAACCAACACAGGG + Intergenic
1031771732 7:125852284-125852306 TGGGACAAACAAGCAGAAGAGGG + Intergenic
1032869644 7:135970129-135970151 TTAAATAAACATCCAGAAAATGG + Intronic
1032955614 7:136968515-136968537 TTGGATATACACCCAGAAGTGGG - Intronic
1033384496 7:140859217-140859239 TTTGATAAGCTACCAAAACAGGG - Intronic
1034718649 7:153267130-153267152 TTGGATAAACACCCAAGAGAAGG + Intergenic
1035359701 7:158302611-158302633 CACGATAAACAACCAAAACAGGG + Intronic
1037181104 8:16006576-16006598 TTGGGTAAACACCCAGAAATGGG - Intergenic
1037321168 8:17644736-17644758 TAGAATAAAGAACGAGAACAAGG - Exonic
1037635272 8:20696191-20696213 TTAGATAAATAACCAGTTCAAGG - Intergenic
1038316325 8:26487538-26487560 TTGGATAAATACCCAGAAGTGGG + Intronic
1038885715 8:31660525-31660547 TTGGAAAAACAATTAAAACAAGG + Intronic
1039005638 8:33033841-33033863 TTGGATAAATAACCAGCAGTGGG - Intergenic
1039646787 8:39293551-39293573 TTGGATAAATACCCAGAAGTGGG + Intergenic
1039746176 8:40430065-40430087 TTGGATAAATACCCAGAAATGGG - Intergenic
1039926580 8:41939130-41939152 TTGGATAAATAAACAGATGAGGG + Intronic
1040039838 8:42904767-42904789 TTGGAGGAAGAAACAGAACAGGG - Intronic
1042665082 8:71195569-71195591 TTGGAAAATAAAACAGAACATGG - Intergenic
1042917264 8:73887955-73887977 TTGGATAAATTCCCAGAAGAGGG - Intergenic
1043317051 8:78935919-78935941 TTGGATATATACCCAGAAGAGGG + Intergenic
1043938104 8:86166253-86166275 TTGAATAAACAGACAGTACATGG - Intergenic
1044157437 8:88865379-88865401 TTGAATATACACCCAGAACTGGG + Intergenic
1044259737 8:90104224-90104246 TTGGATATATACCCAGAACAGGG + Intergenic
1044737272 8:95291975-95291997 TTGGATAAACACCCAGAAGTGGG - Intergenic
1045057240 8:98379785-98379807 TTGGATAAATACCCAGAAGTGGG - Intergenic
1045785970 8:105920721-105920743 TTGGATAAACAACAAAATTAAGG + Intergenic
1046140124 8:110080594-110080616 TTGGATAAATAACTAGAAGTAGG - Intergenic
1046814278 8:118566895-118566917 TTGGATGAACAAACAAAACTTGG + Intronic
1046852956 8:118996363-118996385 TTGGATAAATACCTAGAACTAGG + Intronic
1046938495 8:119908287-119908309 CTGGATAAAAAACCAGTAAATGG + Intronic
1047681811 8:127261400-127261422 TTGGGTAAAGACCCAGAAAAGGG + Intergenic
1048482805 8:134816393-134816415 TGAAAAAAACAACCAGAACATGG + Intergenic
1048515191 8:135101822-135101844 TTGGATGTACACCCAGAACAGGG + Intergenic
1048941460 8:139404115-139404137 TGGGATAAAGATGCAGAACATGG - Intergenic
1050753116 9:8964790-8964812 TTGGATAAACAATGAAATCAAGG - Intronic
1051046113 9:12875676-12875698 TTGGATAAATATCCAGAAGTGGG - Intergenic
1051473704 9:17479181-17479203 TTGGATAAATACCCAGAAGTGGG - Intronic
1052385295 9:27816019-27816041 TTGGATAAACACCCAGTAGTGGG - Intergenic
1052547672 9:29900950-29900972 TTGGATAAACATCCAGAAATGGG + Intergenic
1053156238 9:35781586-35781608 AAGGATTAACAACCAAAACAAGG - Intergenic
1053582499 9:39420614-39420636 TTGGATAAATACCCAGAAGTGGG + Intergenic
1054104078 9:60979355-60979377 TTGGATAAATACCCAGAAGTGGG + Intergenic
1054582271 9:66927491-66927513 TTGGATAAATACCCAGAAGTGGG - Intronic
1055176779 9:73328204-73328226 TTGGATATACACCCAGAAGTGGG + Intergenic
1055570581 9:77612853-77612875 TTGGATAAATACCCAGAAGTTGG - Intronic
1055727729 9:79249562-79249584 TTGGATAAATACCCAGAAGTGGG - Intergenic
1057405161 9:94763618-94763640 TTGGAGAAATGTCCAGAACAGGG + Intronic
1057822923 9:98347081-98347103 TTGGATAAACACCCAGTAGTGGG + Intronic
1058382711 9:104395463-104395485 TTGGATATATATCCAGAACTGGG + Intergenic
1058673048 9:107376889-107376911 TTGGGTAAATACCCAGAAGAGGG - Intergenic
1058742617 9:107959052-107959074 TTGGAGAAACACCCAGTTCAGGG + Intergenic
1062296734 9:135834292-135834314 TTGGATATATACCCAGAAGAGGG - Intronic
1062714983 9:138005105-138005127 TTGGATAAACACCCAGCAGTGGG - Intronic
1203370468 Un_KI270442v1:298915-298937 TTGGATAAACAGGCAGAAGTTGG - Intergenic
1187074819 X:15923799-15923821 TTGGATAAATACCCAGAAGTGGG + Intergenic
1188082804 X:25865045-25865067 TTGGATAAATAACCAGTAGTGGG - Intergenic
1188084691 X:25889063-25889085 TGGGATAAATAACCAGAAAAAGG + Intergenic
1188173952 X:26964704-26964726 TTGGATACACATCCAGAAGTGGG - Intergenic
1188938811 X:36211916-36211938 TTGTAAATACCACCAGAACAGGG - Intergenic
1188958008 X:36457009-36457031 TTGGATAAACAACAACATGAAGG + Intergenic
1190482920 X:50895471-50895493 TTGGATAAATACCCAGTAGAGGG - Intergenic
1190811042 X:53883751-53883773 TTGGATAAATACCCAGAAGTGGG + Intergenic
1191042661 X:56101468-56101490 TTGGATATACAACCAGTAATGGG + Intergenic
1191183839 X:57589687-57589709 TGGGAAATACAAACAGAACAAGG + Intergenic
1191777938 X:64838088-64838110 TTGGATAAATAACCAATACTGGG + Intergenic
1192009071 X:67248651-67248673 TTGGAAAAAAAATCAGAATATGG + Intergenic
1192091560 X:68163588-68163610 TTGGGTATATAACCAGAAGAGGG + Intronic
1192613803 X:72595932-72595954 TTGGATAAATATCCAGAAGTGGG - Intronic
1192762803 X:74112175-74112197 TTGGATAAATACCCAGTACTTGG - Intergenic
1193117911 X:77793358-77793380 TTGGATATACACCCAGAAATAGG - Intergenic
1193306680 X:79959233-79959255 TGGGATACAGAATCAGAACATGG + Intergenic
1193546384 X:82835707-82835729 TTGGATAAATACCCAGCACTGGG - Intergenic
1194046209 X:89006862-89006884 TGGGAAAAACAACAATAACATGG - Intergenic
1194433144 X:93836719-93836741 TGGGAAAAACAATCAGAAGAAGG - Intergenic
1194816901 X:98453349-98453371 TTGGATATACACCCAGAAGTAGG + Intergenic
1195632710 X:107075869-107075891 TTGGATAAATACCCAGAAATGGG - Intronic
1195889703 X:109678869-109678891 TAGGTTAAACATCCAGAAAATGG - Intronic
1196291047 X:113941530-113941552 TTGGATAAATACCCAGAAGTGGG - Intergenic
1196592462 X:117502969-117502991 TTGGATATACATCCAGAAGTAGG - Intergenic
1197330694 X:125150761-125150783 TTGGGTAAACAAGCTGCACAAGG + Intergenic
1197491711 X:127125001-127125023 TTTGCTAAACAACTTGAACATGG + Intergenic
1197841620 X:130753861-130753883 TTGGATAAATACCCAGTAGAAGG + Intronic
1197925243 X:131639295-131639317 ATGGATAAAGAACCAGCATATGG - Intergenic
1197960397 X:131998992-131999014 TTGGATAAATACCCAGAAGTGGG + Intergenic
1198524554 X:137487668-137487690 TTGGATAAATATCCAGTACTGGG - Intergenic
1198629955 X:138625309-138625331 TTGGATATATAACCAGAAGTGGG - Intergenic
1198668465 X:139051344-139051366 TAGGATACACAACCTGATCAAGG - Intronic
1199328379 X:146529020-146529042 TTGGACAAATACCCAGAAGAAGG + Intergenic
1200166596 X:154039802-154039824 CTGGATGAATAACCACAACACGG + Intronic
1200720252 Y:6598292-6598314 TTGGATAAGTATCCAGAACTGGG + Intergenic
1201772557 Y:17630070-17630092 TTGGCTAAAAAAAAAGAACAGGG - Intergenic
1201828998 Y:18275917-18275939 TTGGCTAAAAAAAAAGAACAGGG + Intergenic