ID: 1138582568

View in Genome Browser
Species Human (GRCh38)
Location 16:57951105-57951127
Sequence GGGTGGTCCCAATTTCAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 86}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138582558_1138582568 9 Left 1138582558 16:57951073-57951095 CCGCCCTCCAGGGAAACTCATCT 0: 1
1: 0
2: 0
3: 20
4: 207
Right 1138582568 16:57951105-57951127 GGGTGGTCCCAATTTCAGATGGG 0: 1
1: 0
2: 1
3: 10
4: 86
1138582561_1138582568 2 Left 1138582561 16:57951080-57951102 CCAGGGAAACTCATCTTTCTCAT 0: 1
1: 1
2: 2
3: 30
4: 295
Right 1138582568 16:57951105-57951127 GGGTGGTCCCAATTTCAGATGGG 0: 1
1: 0
2: 1
3: 10
4: 86
1138582555_1138582568 25 Left 1138582555 16:57951057-57951079 CCTGGGTCTAGAGGCTCCGCCCT 0: 1
1: 0
2: 0
3: 11
4: 118
Right 1138582568 16:57951105-57951127 GGGTGGTCCCAATTTCAGATGGG 0: 1
1: 0
2: 1
3: 10
4: 86
1138582553_1138582568 29 Left 1138582553 16:57951053-57951075 CCCTCCTGGGTCTAGAGGCTCCG 0: 1
1: 0
2: 0
3: 10
4: 102
Right 1138582568 16:57951105-57951127 GGGTGGTCCCAATTTCAGATGGG 0: 1
1: 0
2: 1
3: 10
4: 86
1138582559_1138582568 6 Left 1138582559 16:57951076-57951098 CCCTCCAGGGAAACTCATCTTTC 0: 1
1: 0
2: 1
3: 20
4: 201
Right 1138582568 16:57951105-57951127 GGGTGGTCCCAATTTCAGATGGG 0: 1
1: 0
2: 1
3: 10
4: 86
1138582560_1138582568 5 Left 1138582560 16:57951077-57951099 CCTCCAGGGAAACTCATCTTTCT 0: 1
1: 0
2: 2
3: 25
4: 257
Right 1138582568 16:57951105-57951127 GGGTGGTCCCAATTTCAGATGGG 0: 1
1: 0
2: 1
3: 10
4: 86
1138582554_1138582568 28 Left 1138582554 16:57951054-57951076 CCTCCTGGGTCTAGAGGCTCCGC 0: 1
1: 0
2: 0
3: 7
4: 136
Right 1138582568 16:57951105-57951127 GGGTGGTCCCAATTTCAGATGGG 0: 1
1: 0
2: 1
3: 10
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138582568 Original CRISPR GGGTGGTCCCAATTTCAGAT GGG Intronic
900344301 1:2203813-2203835 GCGTGGCCCCACTTACAGATGGG + Intronic
901093421 1:6659195-6659217 GCCTGGTCCCTATTTCACATTGG + Intronic
906911075 1:49951499-49951521 GGGTGGTGCCAATCTAAGGTTGG - Intronic
912229575 1:107776409-107776431 GGGTGGTGGCAATTTTAGACAGG + Intronic
916155183 1:161838486-161838508 TGGAGGACCCACTTTCAGATTGG + Intronic
919019861 1:192091582-192091604 GGTTGGTTCCAATCTCAGTTCGG + Intergenic
923511550 1:234657963-234657985 GGGTGGTTTAAATTTCAGAGGGG - Intergenic
1063222880 10:3987239-3987261 TGGTGGTCTCCATTTCAGTTGGG + Intergenic
1067770621 10:49120985-49121007 GGGAGGTCCACATTTCAGGTAGG - Intergenic
1071670842 10:87608229-87608251 GCCTGGGCCCAATTTCAGAGAGG - Intergenic
1072328114 10:94318592-94318614 GGATGGACACAATTTCAGCTTGG - Intronic
1073729337 10:106270980-106271002 CAGTGGTCCCCATTACAGATTGG - Intergenic
1083814313 11:65123826-65123848 GGGTGGTGCCAGTTCAAGATTGG + Intronic
1084479447 11:69410295-69410317 GGGGGGACCCATTTACAGATAGG + Intergenic
1085178590 11:74512071-74512093 GGGTGTTCCCTAATGCAGATAGG + Intronic
1086013146 11:82130554-82130576 TGGTGGTTCCAATTGCAGTTTGG + Intergenic
1089156299 11:116405510-116405532 AGGTGGTCTTAATTTCAGAGAGG - Intergenic
1089505547 11:118959588-118959610 GGGTGGTGCCAATATCAGTGTGG - Intergenic
1095376668 12:41537492-41537514 GGGTGGTTCCTACTTCAGTTTGG + Intronic
1097747278 12:63315251-63315273 CAGTGGTCCCAATTGCAGATTGG + Intergenic
1102803344 12:115756889-115756911 GGGTGGGTGAAATTTCAGATTGG - Intergenic
1108856662 13:54800788-54800810 TGGTGGTCCGAATTTCAAAATGG - Intergenic
1109979936 13:69894585-69894607 TGATGGGCCCAATTTCATATGGG - Intronic
1111832831 13:93351777-93351799 CGGTGGTTCCAATTAGAGATGGG - Intronic
1119461077 14:74804210-74804232 GGGTAGTCCCAATCTCAAAAGGG - Intronic
1120443097 14:84562846-84562868 CAGTGGTCCCCATTGCAGATTGG + Intergenic
1120458891 14:84768026-84768048 GGGTGGGCCCAATTATAGATGGG - Intergenic
1121480388 14:94264551-94264573 TGGTCGTTTCAATTTCAGATTGG - Intronic
1122642304 14:103167165-103167187 CAGTGGTCCCCATTGCAGATTGG - Intergenic
1129925819 15:79363773-79363795 GGGTGGACCCAAGTTCGGTTTGG - Intronic
1131355145 15:91738720-91738742 GGGTGATCCCAAGTACAGAATGG + Intergenic
1136611838 16:31371244-31371266 AGGTGGTCCTAGGTTCAGATGGG + Intronic
1138582568 16:57951105-57951127 GGGTGGTCCCAATTTCAGATGGG + Intronic
1144058799 17:11563081-11563103 AGGCGGTTCCAATTTCAGAGAGG + Exonic
1144479244 17:15615283-15615305 GGGTCTTCCCAATCTCACATTGG + Intronic
1144919058 17:18748449-18748471 GGGTCTTCCCAATCTCACATTGG - Intronic
1152036924 17:77879386-77879408 GGGTGGGCGCAGTTTCACATGGG - Intergenic
1155284899 18:24277515-24277537 GGGTGGTCACCATTTTAAATAGG + Intronic
1155649786 18:28127416-28127438 GCTGCGTCCCAATTTCAGATAGG - Intronic
1158112062 18:53951433-53951455 GAGTTGTCCCATTTTCAGATGGG - Intergenic
1162482380 19:10935708-10935730 GGGAGGGCCCAATGTCTGATAGG + Intergenic
1163842785 19:19621506-19621528 GGTTGGTCCCAAGCTCAGCTGGG - Intergenic
1167624368 19:50577805-50577827 GGGTGGTTCCTCTTTAAGATGGG - Intergenic
934591937 2:95561441-95561463 AGGAGGACCCAATTTCAGAAAGG - Intergenic
942531548 2:176915467-176915489 GGGTCGTTCCAATTTCAGACAGG - Intergenic
946734276 2:222738973-222738995 GGGGGGTCACAAGGTCAGATGGG + Intergenic
1175482842 20:59323615-59323637 GGGTGGTTGCAGTTTGAGATGGG + Intronic
1175710980 20:61220724-61220746 CGGTGGACCCACTCTCAGATGGG - Intergenic
1180649673 22:17368366-17368388 CGGTGGTCCACCTTTCAGATAGG - Intronic
1183662939 22:39232021-39232043 TCATGGTCCCATTTTCAGATGGG - Intronic
1183838945 22:40481579-40481601 GGGTGGTGATAATTTTAGATAGG + Intronic
949969073 3:9387010-9387032 CTGTAGTCCCAATGTCAGATAGG + Intergenic
965197840 3:165623048-165623070 CAGTGGTCCCCATTTCAGATTGG + Intergenic
967696837 3:192542708-192542730 GGGTGCTCCCTAATACAGATGGG - Intronic
968865749 4:3210119-3210141 GGGAGGACTCCATTTCAGATGGG + Intronic
974565844 4:63577625-63577647 TGGTGGTCCCCATGGCAGATTGG + Intergenic
976562180 4:86514310-86514332 GGGTGGTGCCAATCTGAGGTTGG - Intronic
982999173 4:162390157-162390179 GGATGATCCCTATTTCAGTTGGG - Intergenic
984771543 4:183440963-183440985 AGGTGGCTTCAATTTCAGATGGG - Intergenic
992424457 5:76642221-76642243 GTGGGGTCCCAATTTTATATTGG - Intronic
998607254 5:143647935-143647957 GGGAGGTCCACATTTCTGATGGG + Intergenic
998820155 5:146050812-146050834 GGGTGGTTACAATTTTAGATAGG + Intronic
999405622 5:151304252-151304274 GGAGGGTCGCAATTTTAGATTGG + Intergenic
999626175 5:153522619-153522641 GGATGGTCCCTCTTTCAGCTTGG - Intronic
1000423244 5:161061182-161061204 GGATGGTGCCAATCTAAGATTGG - Intergenic
1000996803 5:167967674-167967696 GGGTGGTCTCAATTTGTAATTGG - Intronic
1001437708 5:171713382-171713404 GGGGTGTGCCAGTTTCAGATTGG + Intergenic
1007225435 6:40310392-40310414 AAGTGGTTCCAAATTCAGATAGG - Intergenic
1011134555 6:84086288-84086310 GGGTGGTGCCAGTTCCAGGTTGG + Intronic
1011426075 6:87231698-87231720 TGATGGTCCCAATCTCAAATAGG - Intronic
1012553519 6:100485892-100485914 GCCTGATGCCAATTTCAGATGGG + Intergenic
1012561852 6:100590726-100590748 GGGTGCTAACAATTTCAAATGGG + Intronic
1017627217 6:156360617-156360639 GTGTGGTTCCAGTTTGAGATGGG - Intergenic
1017879455 6:158549751-158549773 GGGTGATGCCAATTTGAGGTTGG + Intronic
1018777750 6:167033860-167033882 GGCTGGTACTAATTTCAGAAGGG - Exonic
1019042848 6:169120747-169120769 CAGTGGTCCCCATTGCAGATTGG - Intergenic
1023795604 7:43789525-43789547 GTGTGGTCCCAGCTCCAGATAGG - Intronic
1024286798 7:47764949-47764971 GGGTGGACCCAAGTTCGGTTTGG - Intronic
1024447017 7:49492508-49492530 GGGTGGTGCCACTGGCAGATGGG + Intergenic
1024710366 7:52008767-52008789 GTTTGCTCCCAACTTCAGATTGG + Intergenic
1031811461 7:126374714-126374736 GGGTGGTACCAGTTTGAGGTTGG + Intergenic
1034476146 7:151283677-151283699 GGGTGGCCCCAATTTGAGATTGG - Intergenic
1037046458 8:14310872-14310894 GGGTAGACCAAATTTCAGACAGG + Intronic
1038702594 8:29862989-29863011 GGGTGGACCCAAATTCAGTTTGG - Intergenic
1043570680 8:81599354-81599376 GGGGGGTCACAAGATCAGATGGG + Intergenic
1044836996 8:96305554-96305576 GGTTGGTCCAAGTTTCAGCTGGG - Intronic
1046288306 8:112125240-112125262 GTGTGGTCCCAGACTCAGATAGG - Intergenic
1047928665 8:129704761-129704783 GGGTGGTCGTCAATTCAGATGGG - Intergenic
1048857338 8:138696060-138696082 AGGTGGTCCCCTTTTCACATAGG + Intronic
1059141259 9:111855573-111855595 GGGTCATCCCAGTTTCAGATGGG - Intergenic
1062200619 9:135300839-135300861 GGGTGGTGCCAATTCCAGCCAGG - Intergenic
1186637446 X:11421762-11421784 GGGTGGTTCCAATATCAGCTGGG - Intronic
1190110354 X:47585425-47585447 GGGTGGTCCCCATTTCCAGTGGG - Intronic
1190147797 X:47912785-47912807 TGATGGTGCCACTTTCAGATGGG - Intronic
1195853576 X:109308026-109308048 CAGTGGTCCCCATTGCAGATTGG + Intergenic
1198743638 X:139867361-139867383 GGGAGGTTGCAATTTTAGATAGG + Intronic
1199091148 X:143693700-143693722 TGGTGGTGCCATTTTGAGATGGG + Intergenic
1201967108 Y:19750152-19750174 GGGTGGACCCAGTTTCTGATGGG + Intergenic